ID: 902244990

View in Genome Browser
Species Human (GRCh38)
Location 1:15114938-15114960
Sequence GCTTGGCTGCTCCACAGTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902244990_902244999 13 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902244999 1:15114974-15114996 TTAAACGGAGCTGCCAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 66
902244990_902244998 12 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902244998 1:15114973-15114995 CTTAAACGGAGCTGCCAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 61
902244990_902245001 19 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902245001 1:15114980-15115002 GGAGCTGCCAAGGTGGGAGGAGG 0: 1
1: 0
2: 5
3: 66
4: 621
902244990_902244993 -2 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902244993 1:15114959-15114981 GCAGTCCCTGGAGCCTTAAACGG 0: 1
1: 0
2: 0
3: 15
4: 186
902244990_902244996 9 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902244996 1:15114970-15114992 AGCCTTAAACGGAGCTGCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 89
902244990_902245000 16 Left 902244990 1:15114938-15114960 CCGTCACTGTGGAGCAGCCAAGC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 902245000 1:15114977-15114999 AACGGAGCTGCCAAGGTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902244990 Original CRISPR GCTTGGCTGCTCCACAGTGA CGG (reversed) Exonic
900368199 1:2320046-2320068 GCTGGGATGCTCCACGGTGGGGG - Intergenic
901234660 1:7661479-7661501 CCTGGGCTGCACCATAGTGAGGG + Intronic
902244990 1:15114938-15114960 GCTTGGCTGCTCCACAGTGACGG - Exonic
902850805 1:19154699-19154721 GCTTGGGGTCTCCACAGTGGAGG + Intronic
903737421 1:25538820-25538842 TCTTGGCTGGTCCCCAGGGAAGG - Intergenic
903975643 1:27148212-27148234 GATTTGCTGCTCCACAGATAAGG + Intronic
904312233 1:29636238-29636260 GCTGGGCAGCTGCACAGGGATGG + Intergenic
905561041 1:38927515-38927537 ACATGGCAGCTTCACAGTGATGG - Intronic
910069449 1:83194131-83194153 GCATGGCTGATCTAGAGTGATGG - Intergenic
912384616 1:109265087-109265109 GCCTGGCTGATCCACAGCCAGGG + Intronic
913062189 1:115218670-115218692 GCCTGGCAGCTCCAGGGTGAAGG + Intergenic
913682514 1:121199922-121199944 GCATGGCTGCTGCACACTTATGG + Intronic
914034357 1:143987551-143987573 GCATGGCTGCTGCACACTTATGG + Intergenic
914155093 1:145080419-145080441 GCATGGCTGCTGCACACTTATGG - Intronic
915044234 1:152998616-152998638 GCATGGCTGCCCCGCAATGATGG - Intergenic
916748085 1:167699725-167699747 GCATGGCTGGATCACAGTGAGGG - Intronic
916886033 1:169069170-169069192 GCTTGGACTCTCCAAAGTGATGG - Intergenic
917450461 1:175143656-175143678 GGTGGGCTGGTCCACAGTGGAGG + Intronic
918133300 1:181647238-181647260 CCTTAGCTGCTCCACAGTAGAGG + Intronic
919792210 1:201299402-201299424 GCTGGGCTGCTACAAACTGAGGG + Intronic
920469827 1:206218440-206218462 GCATGGCTGCTGCACACTTATGG + Intronic
921136174 1:212261177-212261199 GCTTGTTTGGGCCACAGTGAAGG - Intergenic
1063454882 10:6176073-6176095 ACTTGACTTCTCCACACTGATGG - Intronic
1068081773 10:52327398-52327420 GCTTGTCTGCTCCAAAGTCCAGG + Intergenic
1068658340 10:59596840-59596862 GCCTGGCTGCTCAACTGAGATGG + Intergenic
1073303068 10:102482651-102482673 GCTCTGCTGCTCCAGAGAGAGGG + Intronic
1074748271 10:116557705-116557727 GCAGGGCTACTCTACAGTGAAGG - Intronic
1076286020 10:129297078-129297100 GGGTGGCTGCTGCACAGGGAGGG - Intergenic
1076619165 10:131775948-131775970 GCTGGGCTTCTGCACAGTGACGG + Intergenic
1076628901 10:131841140-131841162 GCTCAGCTGCCCCACAGTGAAGG - Intergenic
1079350004 11:19684498-19684520 GCTTGGGTGCTCCAGACTAAGGG - Intronic
1080268891 11:30429555-30429577 GGTTGGCTGGCACACAGTGAGGG - Intronic
1081773500 11:45663680-45663702 GCCAGGATGCTTCACAGTGATGG - Intronic
1084468149 11:69339353-69339375 GCGTGGCTGCTGCAGAGTTAGGG - Intronic
1085495098 11:76961912-76961934 ACTTGGCTTCTCCACTGTAAAGG - Intronic
1088586556 11:111364801-111364823 GCAAGGCAGCACCACAGTGAGGG + Intronic
1089183928 11:116602167-116602189 TCTTGCCTGCTCTACAGTGATGG + Intergenic
1089574690 11:119433095-119433117 GTCGGGCTGCTCCAAAGTGAGGG + Intergenic
1093401214 12:18748900-18748922 GCTGGGCTGCCCCATAATGATGG - Intergenic
1098322193 12:69257466-69257488 TCTTGGCTGCTGCAGAGTGCTGG + Intronic
1100852321 12:98726046-98726068 CCTTCGCTGCCCCACAATGACGG - Intronic
1101029895 12:100648096-100648118 GCAGGGATGCTCCACAGGGAAGG + Intergenic
1101643005 12:106601942-106601964 GCCTGGCTGCTTCACAGAGGGGG - Intronic
1102155445 12:110723758-110723780 GCTTGGCCTCTCCAAAGTGCTGG + Intronic
1103298681 12:119909986-119910008 GCTTGGATGCTTCCCAGTGGAGG + Intergenic
1103871433 12:124095199-124095221 GCTTTGCTGCTCCATGCTGAGGG + Intronic
1104246176 12:127043609-127043631 TCTAGGCTGAGCCACAGTGAAGG + Intergenic
1104588700 12:130067523-130067545 GCTTGGCTGCTGCCAAGTGTAGG + Intergenic
1104698476 12:130882720-130882742 GCTACGCAGATCCACAGTGACGG - Intergenic
1104698495 12:130882858-130882880 GCTACGCAGATCCACAGTGACGG - Intergenic
1104981646 12:132575669-132575691 GCATGGTTGCTCCACAGAGGAGG + Intronic
1104991468 12:132626072-132626094 GATGTTCTGCTCCACAGTGAAGG + Intronic
1106657293 13:31759776-31759798 GCTTTGCTGCCCCACTTTGATGG - Intronic
1108142473 13:47438986-47439008 GCTTGGCTCTTTCAGAGTGAAGG + Intergenic
1113158516 13:107352743-107352765 CCTTAGCTGCTTCACAATGAAGG + Intronic
1113397368 13:109961200-109961222 CCTTGGATGCTCCACCTTGAAGG + Intergenic
1113651703 13:112037810-112037832 CCATGGCTGCTCTACAGAGAGGG + Intergenic
1115821304 14:37215154-37215176 CCTTGGCTGCCCAACAGGGAAGG + Intronic
1120800260 14:88680390-88680412 GCCTGGGTTCTCCACAGAGAAGG + Intronic
1122895661 14:104755580-104755602 GCTTCGTTGGTACACAGTGAAGG + Intronic
1123139973 14:106066542-106066564 GTTTAGCTCCTTCACAGTGAAGG - Intergenic
1125020025 15:34975312-34975334 ACTTGGCTGATATACAGTGAAGG + Intergenic
1125401837 15:39312334-39312356 GCTTCTCTGCACCATAGTGACGG + Intergenic
1126457403 15:48878412-48878434 GCCTGGCTGCTCCCCAGCGTTGG - Exonic
1127009624 15:54608962-54608984 GAGTGGCTGCTTCAAAGTGATGG + Intronic
1127295601 15:57606176-57606198 GCCTGCCTACTCCACTGTGAAGG - Intronic
1128797904 15:70478512-70478534 CCCTGGCTGCTCCACTGTGGGGG - Intergenic
1129017729 15:72483318-72483340 GCTTGTTTCCTCCAGAGTGAGGG + Intronic
1129621058 15:77146130-77146152 ACAAGGCTGCTGCACAGTGATGG - Intronic
1132583811 16:697208-697230 GCCTGGCTGCTCCACTGTCCCGG - Exonic
1132931879 16:2462800-2462822 GCTTGTCTGCGCCTCAGGGAAGG + Intronic
1132937771 16:2490284-2490306 GCTTCTCTGCTCCACACTCAGGG + Intronic
1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG + Intronic
1138066527 16:53947130-53947152 GCCTTGCTGCTGCACTGTGAAGG + Intronic
1138071719 16:53999097-53999119 ACTTGGGTGCTCCACATGGAGGG - Intronic
1138156653 16:54711933-54711955 GATGGGCTCCTCCACACTGATGG + Intergenic
1140277948 16:73527677-73527699 GCTTGCTTCCTCCAGAGTGAGGG - Intergenic
1140605667 16:76533873-76533895 ACTTGGTTTCTCCTCAGTGAAGG - Intronic
1143015738 17:3890296-3890318 GCTTGGGGGCTCCCCAGGGATGG - Intronic
1143377432 17:6475063-6475085 GCTTGTCTGGTACACAGTGCAGG - Intronic
1145781237 17:27564864-27564886 GCTTTGCAGCTCCACAGGAAGGG + Intronic
1149356507 17:55845373-55845395 GCCTGGCTGCACCACGGAGACGG - Intergenic
1151473351 17:74331385-74331407 GCTGGGCTGGGCCACCGTGAGGG + Intronic
1153513167 18:5877673-5877695 GGTTTGCTACTCCACAGTGTGGG + Intergenic
1155923416 18:31628660-31628682 GCGTCCCTGCCCCACAGTGATGG - Intronic
1157416107 18:47504479-47504501 GCCTGGCTGCTTTATAGTGATGG + Intergenic
1157609095 18:48944954-48944976 CCTTGGCTGCTCCCCAGGGTTGG - Intronic
1160451281 18:78967661-78967683 GCTGGGCTGACCCACAGTCATGG + Intergenic
1164530583 19:29045374-29045396 GCCTGGCTTCTCCAGAGTAATGG - Intergenic
1165152836 19:33771085-33771107 TCCTGGCTGCTCCACAGGGCAGG + Intronic
1165335763 19:35168627-35168649 CTGTGGCTGCTCCAGAGTGAGGG - Intronic
1166500849 19:43340103-43340125 CCTGAGCTGCTCCACAGGGAGGG - Intergenic
925512049 2:4638606-4638628 GCTTGGCTGGTCCAGAATGCAGG + Intergenic
927713736 2:25340668-25340690 GCTTCGCATCTGCACAGTGAAGG - Intronic
928142182 2:28739393-28739415 CCCAGGCTACTCCACAGTGATGG - Intergenic
932951952 2:76303878-76303900 ACTTGGCTACTCCACAGGCAAGG - Intergenic
934117550 2:88811323-88811345 GCTGGGATTCTCAACAGTGAGGG + Intergenic
935008907 2:99112696-99112718 GCATGGCTGGAGCACAGTGAGGG + Intronic
935172423 2:100620781-100620803 GCTTGACTGAGCCACAGGGAAGG - Intergenic
935812743 2:106815960-106815982 GCTGTGCTGCTTCACAGTGAGGG + Intronic
937198483 2:120181034-120181056 CCTTGGCTTCTCCAAAGTGCTGG - Intergenic
938764701 2:134452807-134452829 GCTCTGCAGCTCCACAGGGATGG - Exonic
941221144 2:162783090-162783112 CCTTTGTGGCTCCACAGTGAAGG - Intronic
943081170 2:183260744-183260766 GCTCAGCTGCTGCACGGTGAGGG + Intergenic
946362933 2:219229807-219229829 TCTTCGCTGCTCCGTAGTGACGG + Exonic
948273674 2:236692401-236692423 GCTTGCCAGGGCCACAGTGAGGG + Intergenic
948375076 2:237515906-237515928 CCTTGCCTGCTCCTCTGTGAGGG - Intronic
948563366 2:238868253-238868275 GCTTGTCTGCACCCCAGAGAGGG - Intronic
949048224 2:241881979-241882001 ACTTGGCTGGGCCCCAGTGAAGG - Intergenic
1169682536 20:8231781-8231803 GGTTGGCTGATCCACAGTAGAGG + Intronic
1175198333 20:57261669-57261691 CTTTGGCTGCTCACCAGTGAGGG + Intronic
1176232980 20:64041490-64041512 GCTTGGCTGCTCCAGGGAGGTGG + Intronic
1176914851 21:14612569-14612591 GCTTGGCTGCTCCGTGGTCAAGG - Intronic
1179317037 21:40253166-40253188 GGATGGTTGGTCCACAGTGAGGG + Intronic
1179323085 21:40312097-40312119 GCTTTGGTGCTCCACAGCGGCGG + Exonic
1180049894 21:45326286-45326308 GCCCTGCTCCTCCACAGTGAAGG - Intergenic
1180904414 22:19398599-19398621 GTTTGGAGGCTCCATAGTGAAGG - Intronic
1182042758 22:27251087-27251109 GCTTGGCTGGGCTACAGAGAAGG - Intergenic
1183688743 22:39376420-39376442 GCTGCTCTGCACCACAGTGAGGG - Intronic
1183954182 22:41369262-41369284 ACTTTGCTCATCCACAGTGAGGG - Intronic
952173461 3:30835400-30835422 GGTTGGCTGCACCACAGATATGG + Intronic
953784665 3:45902144-45902166 GCCAGGGTGCTCCACAGTGCCGG - Exonic
953838176 3:46365930-46365952 GCTTGTCTGCTGCCCAGTGGGGG + Intergenic
955558983 3:60168430-60168452 GCTTGCCAGCTCCAAGGTGAAGG + Intronic
960537293 3:118828010-118828032 GCTTGGCTGCTTCTCTGTTAAGG - Intergenic
961112975 3:124300909-124300931 GCTTTGCTGCTCTACACTAAAGG - Intronic
961781977 3:129325635-129325657 GCTGGCCTCCTCCACAGAGAGGG + Intergenic
963287198 3:143444760-143444782 GCTTGACTTCTCCAAGGTGAGGG + Intronic
967504082 3:190233427-190233449 GGTTGTCTACTCCACAGTGGAGG - Intergenic
967633218 3:191771530-191771552 GGGTTGCTGCTACACAGTGAGGG - Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969946708 4:10790690-10790712 GCATGGCTGGTGCACAGTTAGGG - Intergenic
970723105 4:19010718-19010740 CCATGGCAGCTCCACAGTGATGG - Intergenic
972232884 4:37096023-37096045 CCTTGGCTGCTCCCTAGTCATGG - Intergenic
972844049 4:42966082-42966104 CCTTGGATACTCCACAGTGGGGG + Intronic
973538158 4:51905682-51905704 GCTTGTCTCCACCACAGAGAAGG - Intronic
976453960 4:85224042-85224064 GCATGGCTGCTGCAGAGGGATGG + Intergenic
979467697 4:121059531-121059553 GCATGGCTGCCATACAGTGATGG + Intronic
979929843 4:126617072-126617094 GCCTGGCTGCTCCCAAGGGAGGG + Intergenic
980114968 4:128670505-128670527 GCTTGTCTGCTACAGAGAGATGG - Intergenic
980176687 4:129354587-129354609 GCTTTTCTGCTTCATAGTGATGG - Intergenic
983551480 4:169021775-169021797 CCTTGGCTCTGCCACAGTGAAGG - Intergenic
986658643 5:10039448-10039470 GCTTGGCTGCTTGGCAGTGGAGG + Intergenic
986770379 5:10967356-10967378 CCTTGGCTACTGCTCAGTGAAGG - Intergenic
992240016 5:74758489-74758511 CTTTGGCTGCTCCAGAGTAATGG - Intronic
997642767 5:135460342-135460364 CGATGGCTGCTCCACAGTGTCGG + Intergenic
999497431 5:152113214-152113236 GCTTAGATGCTCCACAGAGTAGG - Intergenic
1002066131 5:176652660-176652682 GCTTGGGTGTGCCACAGGGAAGG - Intronic
1002090007 5:176798765-176798787 GCTTGGCTGATCCACGATGTCGG + Intergenic
1002437095 5:179238366-179238388 GCGTGGCCGCTCCACAGAGCAGG - Intronic
1002450865 5:179317837-179317859 GTGGGGCTGGTCCACAGTGAGGG + Intronic
1003007680 6:2397063-2397085 GCTGGGCTGCTGAACAGGGAGGG - Intergenic
1005897543 6:30190965-30190987 ACTTGGCTGCCCCACAGAGAAGG + Intronic
1006297391 6:33175948-33175970 GCTTGGCGTCTCCAGAGTGGAGG + Intronic
1007138155 6:39543012-39543034 GCCTGGATTCACCACAGTGAAGG + Intronic
1007405680 6:41634865-41634887 GCTGGCCTGCTCCACTTTGAAGG + Intergenic
1009398472 6:63228961-63228983 GCCTGGCTGCTCCACCATCAGGG - Intergenic
1015935890 6:138405162-138405184 ACTTGGCTGGTCCATAGTGTCGG - Exonic
1017115682 6:150974492-150974514 GCTTGGTTGCACAACAATGAAGG - Intronic
1018581208 6:165309662-165309684 GCCTGGTTGCTCAGCAGTGAAGG - Intergenic
1019014738 6:168871737-168871759 GGTTGGCTGCTCCACAGAAGCGG - Intergenic
1019020758 6:168915680-168915702 CCTTGGGTGGTCCACAGTGGTGG - Intergenic
1019137930 6:169922718-169922740 GCCTGGCTCCTCCAGAGAGAGGG + Intergenic
1019263272 7:94459-94481 GCTTGGCTGCTCTCTAGAGAGGG + Intergenic
1019965523 7:4495673-4495695 GCATTACTGCTCCACAATGAAGG - Intergenic
1020736665 7:11957864-11957886 GCTTGGCCACTCCTCATTGAGGG - Intergenic
1024083740 7:45876754-45876776 CCCTGGCTGCTGCCCAGTGATGG - Intergenic
1027007774 7:74710067-74710089 GTTTTGCTGCTACACAGTGGTGG - Intronic
1027287231 7:76659313-76659335 GCATGGCTGATCTAGAGTGATGG - Intergenic
1027787398 7:82597909-82597931 TCTTGGCTGCCCCACAGGGCTGG - Intergenic
1028728026 7:94111133-94111155 GCTAGTCTGCTGCACAGTGAGGG + Intergenic
1028771740 7:94632501-94632523 CCTTGGCAACTCCACAGTAAAGG + Intronic
1029603336 7:101583021-101583043 GGATGGCTGCTGCACAGTGGAGG + Intergenic
1030171250 7:106605197-106605219 GCTCGGCTGCTCTACAAGGAAGG - Intergenic
1031076611 7:117219473-117219495 GCTGGGCTGGTCCATTGTGAGGG + Intronic
1031651570 7:124297534-124297556 GATTTGCTGCTTCACAGTGCAGG + Intergenic
1032011027 7:128348040-128348062 TCCTGGCTCCTGCACAGTGATGG - Intergenic
1033780888 7:144667757-144667779 CCTTGGAAGCTCCACAGTAATGG + Intronic
1033868469 7:145720755-145720777 GCTTGGCTCCTCCAAGGAGAGGG + Intergenic
1035461381 7:159041230-159041252 GCGTGGCTGCCCCACCGGGAGGG - Intronic
1035590120 8:806349-806371 GCACGGCTGCTGCAGAGTGACGG - Intergenic
1036174976 8:6528816-6528838 CCTTGGCTGGTCCACAGCGTGGG + Intronic
1038198573 8:25390681-25390703 GAGTGGCTGGTCCCCAGTGATGG + Intronic
1042335721 8:67628285-67628307 CCTTAGCTGCTGCACAGTCAAGG - Intronic
1045189123 8:99865948-99865970 GGTTTCCTGCTCCACAATGAAGG + Intronic
1046432083 8:114141314-114141336 TCATGACTGCTCCAAAGTGACGG + Intergenic
1048333827 8:133488994-133489016 CCTTGGCTGTCCCACAGGGAGGG - Intronic
1048856437 8:138690364-138690386 GCTTGGCTGCTTCACCTTTAGGG - Intronic
1049966400 9:784207-784229 TGGTTGCTGCTCCACAGTGATGG - Intergenic
1051370684 9:16356414-16356436 GCTTGGCTTCTCCTAGGTGAGGG + Intergenic
1051930887 9:22384060-22384082 GCTTTGCAGCTGCTCAGTGAAGG + Intergenic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1057302353 9:93894312-93894334 GCTGGGATGCCCCACAGTAAAGG - Intergenic
1060546500 9:124465002-124465024 GCTTAACTGCTCCCCGGTGATGG + Intronic
1060967056 9:127717278-127717300 CCTGGGCTGGTCCACAGTCAGGG + Intronic
1061147469 9:128808291-128808313 CTTCGGCTGCTCCACAGGGAAGG + Exonic
1062027445 9:134347051-134347073 GCCTGTCACCTCCACAGTGATGG - Intronic
1190938429 X:55017591-55017613 ACTTGGCTGCTCCACTGTTACGG + Exonic
1191779606 X:64851001-64851023 GCTGGGCTGCTCCACTGTGGAGG - Intergenic
1194397873 X:93408206-93408228 GCATGGCTGCCCCAAAATGAGGG - Intergenic
1197472662 X:126882570-126882592 TCTTGGCAGCTCCCAAGTGATGG + Intergenic