ID: 902246241

View in Genome Browser
Species Human (GRCh38)
Location 1:15122662-15122684
Sequence GAGCCCCCTGATATTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902246233_902246241 17 Left 902246233 1:15122622-15122644 CCCTGCAGGTGGGGCTGGGCAGG No data
Right 902246241 1:15122662-15122684 GAGCCCCCTGATATTCAGACAGG No data
902246235_902246241 16 Left 902246235 1:15122623-15122645 CCTGCAGGTGGGGCTGGGCAGGC No data
Right 902246241 1:15122662-15122684 GAGCCCCCTGATATTCAGACAGG No data
902246229_902246241 23 Left 902246229 1:15122616-15122638 CCTCTCCCCTGCAGGTGGGGCTG No data
Right 902246241 1:15122662-15122684 GAGCCCCCTGATATTCAGACAGG No data
902246232_902246241 18 Left 902246232 1:15122621-15122643 CCCCTGCAGGTGGGGCTGGGCAG No data
Right 902246241 1:15122662-15122684 GAGCCCCCTGATATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902246241 Original CRISPR GAGCCCCCTGATATTCAGAC AGG Intergenic
No off target data available for this crispr