ID: 902251418

View in Genome Browser
Species Human (GRCh38)
Location 1:15156111-15156133
Sequence TGAGGCCCAAACTGCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902251411_902251418 24 Left 902251411 1:15156064-15156086 CCTTCACTCATGACTGTTGGTCA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902251418 Original CRISPR TGAGGCCCAAACTGCCAGCC TGG Intronic
900265732 1:1756105-1756127 TGAGGCCCATGGTGGCAGCCCGG - Intronic
901609881 1:10489514-10489536 TGAGTCCCAAGCAGCCAGACTGG - Intronic
901742914 1:11353997-11354019 GGAGGCTCAGATTGCCAGCCTGG + Intergenic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
902573660 1:17363146-17363168 TGTCGCCCAAGCTGCCAGGCTGG + Intronic
902835221 1:19043053-19043075 CCAGGTCCACACTGCCAGCCTGG + Intergenic
903337531 1:22635093-22635115 TGAGGCCCTACCTTCAAGCCAGG - Intergenic
903790996 1:25892794-25892816 TGAGGCCCAGGCTCCCACCCGGG - Intronic
905520518 1:38595925-38595947 TGAAGCCCAAACTGGCATCCCGG - Intergenic
907160934 1:52368522-52368544 CGAGGCCCTGCCTGCCAGCCGGG + Intergenic
907280530 1:53344235-53344257 GGAGGCCCAAACCCCCAACCCGG + Intergenic
907282492 1:53360186-53360208 TCTGGCCCAAACTGCCTCCCAGG - Intergenic
907401551 1:54227786-54227808 AGAACCCCAGACTGCCAGCCTGG - Intronic
907617404 1:55938723-55938745 GGAGGCACGAGCTGCCAGCCAGG - Intergenic
909091921 1:71236694-71236716 TGAGGCTGAAATTGCCAACCTGG - Intergenic
914991323 1:152501843-152501865 GGAGGCCCACAAGGCCAGCCTGG - Intergenic
915268549 1:154735527-154735549 TGAGGCCCACGCAGCCAGCCAGG - Intronic
915660766 1:157403360-157403382 AGAGGGTTAAACTGCCAGCCTGG - Intergenic
916999420 1:170340177-170340199 TGAGGCCCACAGTGTCACCCAGG - Intergenic
919831342 1:201542165-201542187 TGAGCCCTAAACTGAAAGCCAGG - Intergenic
922036196 1:221851092-221851114 TGAGGCCCAACCTTCCAGGGTGG + Intergenic
923803314 1:237231708-237231730 TGAGTCCCAGACTGCCTGGCTGG - Intronic
924106226 1:240651908-240651930 TGAGACCCAAACTGATAGCAAGG - Intergenic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
1065432682 10:25675234-25675256 TGAGACCCAAACAGAGAGCCTGG + Intergenic
1070914515 10:80144440-80144462 TGGGGCCCTCCCTGCCAGCCAGG - Intronic
1073034075 10:100550970-100550992 TGTGTCCCACACTGCCAGCTAGG - Exonic
1074455492 10:113592250-113592272 TGAAGTCATAACTGCCAGCCCGG + Exonic
1076472617 10:130729319-130729341 GGAGGCCAAAGCTGCAAGCCAGG - Intergenic
1076752599 10:132551102-132551124 TGAGGCCCAGAGTGCGAGCCTGG + Intronic
1076890375 10:133280466-133280488 AGGTGGCCAAACTGCCAGCCTGG - Intronic
1077329866 11:1979515-1979537 TGGTGCCCACACTGCAAGCCAGG + Intronic
1077366402 11:2163020-2163042 TGAGGAACAGACTGCCAGGCTGG + Intergenic
1080445506 11:32333909-32333931 TGAAGCCCACAGTGCCTGCCTGG - Intergenic
1080851993 11:36078243-36078265 TGAAGCCCAATCTTCAAGCCAGG - Intronic
1085014622 11:73165143-73165165 TGGGGCCCAAACTGGAAGACAGG + Intergenic
1085160541 11:74339689-74339711 TGAGGGGCAAACTTCCAGGCAGG - Intronic
1085403923 11:76250513-76250535 TGAGGCCCCACCTTCAAGCCAGG + Intergenic
1085512153 11:77093864-77093886 TGTGGCCCTCACTGCCAGACAGG + Intronic
1088743941 11:112788785-112788807 TGAGCCCCAAGCCACCAGCCAGG - Intergenic
1089416643 11:118297629-118297651 TAAGGTCAAAACTGCCAGTCAGG + Intergenic
1090863365 11:130673689-130673711 AGAGGCCGAAAGTGCCAGCCAGG - Intronic
1202812844 11_KI270721v1_random:34694-34716 TGGTGCCCACACTGCAAGCCAGG + Intergenic
1095517630 12:43024105-43024127 TGAGGCCACAACTGTAAGCCAGG + Intergenic
1099287541 12:80733293-80733315 TAAGATACAAACTGCCAGCCAGG + Intergenic
1104133522 12:125916885-125916907 TCAGCCCCAGCCTGCCAGCCAGG + Intergenic
1104662530 12:130621286-130621308 TTAGGCCCAAAAAGCCAGCAGGG - Intronic
1105019136 12:132804818-132804840 GGAGGCAAAAAATGCCAGCCTGG - Exonic
1106300508 13:28460066-28460088 TGTTGCCCAATCTGCCAGACTGG - Intronic
1108442233 13:50466651-50466673 TCAGGACCAAGCTCCCAGCCAGG - Intronic
1108533359 13:51347508-51347530 TTTGGACCAAACTGCCACCCTGG + Intronic
1109399307 13:61805097-61805119 TAAGGACCAAGCTGCCAGGCTGG - Intergenic
1109959130 13:69607496-69607518 TGTGGCCCAGGCTGCCAGGCTGG - Intergenic
1110977381 13:81856453-81856475 GAAGGCCCAATGTGCCAGCCTGG - Intergenic
1111354453 13:87080166-87080188 TGAGGCCGAATCTTCAAGCCAGG - Intergenic
1111948387 13:94689719-94689741 TGTGGCCCAAACTTCAAGTCTGG + Intergenic
1112128442 13:96496031-96496053 TGTGGCCCAAACAGCAAGACAGG - Intronic
1114272111 14:21107201-21107223 TGAGGCCCAGGTTTCCAGCCAGG - Intergenic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1117485835 14:56195813-56195835 TGGGGCCCAAACTGCCAGCTGGG - Intronic
1117719764 14:58618056-58618078 TGAAGGCCAAATAGCCAGCCAGG - Intergenic
1118346650 14:64946026-64946048 TGAGGCCCAGACTGTTAACCAGG - Exonic
1119415666 14:74467756-74467778 TGTGACCCAAACCCCCAGCCAGG + Intergenic
1119663152 14:76465675-76465697 GGAGGCCCCAGCTGCCACCCTGG - Intronic
1122616277 14:103020140-103020162 TGAGGCCCAAACAGTCAGGGTGG - Intronic
1124063063 15:26313226-26313248 AGAGGCCCAAACCCCAAGCCTGG + Intergenic
1124455757 15:29841172-29841194 TAAGGCCCAGACTTCCAGGCTGG - Intronic
1126486566 15:49187857-49187879 TGAGTCCAAAAATGCCATCCAGG + Intronic
1127130325 15:55855582-55855604 TAAGGTCCAAGCTGCCATCCAGG + Intronic
1127564917 15:60177844-60177866 TGATGACAAATCTGCCAGCCAGG - Intergenic
1128388054 15:67164667-67164689 TGAGGCCCGCTCTGCCAGCTGGG + Intronic
1129704751 15:77787711-77787733 TGGAGCCTAAACTGCCAGCAAGG - Intronic
1131255561 15:90859753-90859775 TGAGGGCCAGACTCCCACCCTGG + Intergenic
1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG + Intronic
1134055686 16:11168488-11168510 TGAGGCCCAGCCTGCCTGTCTGG + Intronic
1138584203 16:57960019-57960041 TGGGGCCCAAGCTGCAGGCCCGG - Exonic
1139088707 16:63618215-63618237 TGAAGCCCCAACTTCAAGCCAGG - Intergenic
1140350347 16:74256592-74256614 TGTTGCCCAGACTGCCAGACTGG - Intergenic
1140468057 16:75197865-75197887 AGAGGTCCTCACTGCCAGCCTGG + Intergenic
1141143102 16:81509989-81510011 TGAGGTTCAATTTGCCAGCCAGG - Intronic
1141693194 16:85607840-85607862 TGAGGCCCCCACTGCCACTCTGG + Intergenic
1141989281 16:87601456-87601478 TGAGCCAGAAACTGCAAGCCAGG - Intergenic
1142067591 16:88071659-88071681 TGAGGCCTAAAATCCAAGCCAGG - Intronic
1142155682 16:88531949-88531971 TGAAGGCCAGCCTGCCAGCCAGG - Intronic
1142602267 17:1059525-1059547 TGAAGCCCCACCTGCTAGCCTGG + Intronic
1142788302 17:2243000-2243022 TGAGGCAAAAACTGCCAGAGTGG + Intronic
1142805951 17:2371292-2371314 TTGGGCCCAGCCTGCCAGCCTGG + Exonic
1143769962 17:9162221-9162243 TGAGGCCCCTGCTGCCAGCCTGG - Intronic
1145941317 17:28744601-28744623 GGAGGCTCAAACTGCCACGCGGG - Intronic
1146454610 17:32999097-32999119 TGATGCCCCTACTGCCAGCAGGG - Intergenic
1147445789 17:40474550-40474572 TGAGGGCAAAGCAGCCAGCCCGG - Intergenic
1147728549 17:42582091-42582113 CCAGGCCCCACCTGCCAGCCGGG - Exonic
1151680527 17:75620463-75620485 GCAGAGCCAAACTGCCAGCCTGG - Intergenic
1152286714 17:79416905-79416927 TCCTGCCCAACCTGCCAGCCAGG - Intronic
1153812106 18:8761236-8761258 TGATGCCCAAAATGTAAGCCAGG + Intronic
1157535200 18:48452651-48452673 AAAGCCCCACACTGCCAGCCTGG + Intergenic
1158023388 18:52869532-52869554 TGAGGCCCCACCTTCAAGCCAGG - Intronic
1160720574 19:595370-595392 AGAGGCCCATGCTGACAGCCGGG - Intronic
1160795727 19:944581-944603 GGAGGGCCCGACTGCCAGCCTGG + Intronic
1161320574 19:3638958-3638980 TGAAGTAGAAACTGCCAGCCAGG - Exonic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1161909661 19:7183760-7183782 TGAGGTCCACAATGCCAGACTGG + Intronic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1163214381 19:15864829-15864851 TGGGGCCCAAACTTCCCCCCAGG - Intergenic
1165309327 19:35021113-35021135 TGAGTCCCAAACTGACCTCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165728893 19:38131519-38131541 TGAAGCCCACACCGCCTGCCTGG - Intronic
1166329739 19:42070934-42070956 TGAGGCAGGAGCTGCCAGCCTGG + Exonic
1166960328 19:46493033-46493055 GGAGGCCCCAGCTCCCAGCCAGG - Exonic
1168145637 19:54418947-54418969 TGGAGCCCCAGCTGCCAGCCTGG + Intronic
925466641 2:4111903-4111925 TGAGGCCACTACTGCCATCCAGG - Intergenic
926109709 2:10174002-10174024 TGAGGCCCAAACCCCCAGTGTGG + Intronic
926166271 2:10523507-10523529 TGAGGATCACACAGCCAGCCGGG - Intergenic
927226160 2:20767637-20767659 TGAGGCCCCACCTGCAGGCCAGG + Intronic
927393983 2:22628365-22628387 TGAGGTCCAAACTCCAGGCCTGG - Intergenic
928690236 2:33791720-33791742 GGAGGGCCAATCTGTCAGCCAGG + Intergenic
929792537 2:45034261-45034283 TGAGGTCCCCAATGCCAGCCAGG + Intergenic
930305821 2:49673332-49673354 TGAGGCCAGAAGTCCCAGCCGGG - Intergenic
930467065 2:51768497-51768519 TGAGGCCCCAACTGCAACACTGG + Intergenic
931460023 2:62442540-62442562 TGAGGACCAAGCTGCCAGTTTGG - Intergenic
933678442 2:85078168-85078190 TGAAGGCCCAACAGCCAGCCTGG - Intergenic
936085968 2:109469377-109469399 TGGGGCCAGAACTGCCTGCCTGG + Intronic
937073265 2:119082120-119082142 TGAGGCCCACTCTGACTGCCCGG - Intergenic
938899390 2:135786963-135786985 TGAGTCCCAACCTGGCAGTCAGG - Intergenic
942553431 2:177145458-177145480 GGCGGCCCAATCTACCAGCCAGG - Intergenic
943960205 2:194254417-194254439 TGAAGCCCCAACTTCAAGCCAGG + Intergenic
944241076 2:197485518-197485540 TGAAGGTCTAACTGCCAGCCGGG - Intergenic
944961154 2:204875546-204875568 TCATGCCCACACTGCCAGCCTGG + Intronic
946373956 2:219297156-219297178 TCTGGCCCACACAGCCAGCCTGG + Intronic
949022211 2:241748013-241748035 TGAGGCCAAACCTGCTAGCGGGG + Intronic
1169065003 20:2690216-2690238 TGATTCCCAAACTCCAAGCCTGG + Intergenic
1169421500 20:5464530-5464552 TGAGGCCCAACCTTCAAACCAGG + Intergenic
1170770083 20:19325211-19325233 TGAGGCCAGAAGTTCCAGCCTGG + Intronic
1172008005 20:31830705-31830727 AGAGGCCCAAGCTGCCAGAGTGG - Intronic
1172334291 20:34101147-34101169 TCAAGACCAATCTGCCAGCCAGG + Intronic
1173291582 20:41719596-41719618 TGGGGGCCACCCTGCCAGCCTGG - Intergenic
1173342815 20:42168429-42168451 GGAGGCACTGACTGCCAGCCAGG - Intronic
1173461867 20:43249324-43249346 TGGGGTCCTCACTGCCAGCCAGG + Intergenic
1175541275 20:59749493-59749515 TGAGAGCCACACTGTCAGCCTGG - Intronic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1175818445 20:61895846-61895868 CGGGGCCCAAAATGACAGCCTGG - Intronic
1177167557 21:17619557-17619579 TGATGCCCAGGCTGCCAGACTGG - Intergenic
1179169227 21:38959857-38959879 TGTGGCCCAACCAGACAGCCAGG + Intergenic
1179435519 21:41359678-41359700 TAAGGACCAAACAGCCAGTCTGG + Intergenic
1179731807 21:43372438-43372460 TGAGACCCAGACCTCCAGCCCGG - Intergenic
1180065850 21:45411852-45411874 TGCGGCCCAAACGGCCAGGCTGG + Intronic
1182165852 22:28172276-28172298 TTAGGCCCAAGCAGCAAGCCAGG + Intronic
950228766 3:11257857-11257879 TGAGGCCAAGACTTGCAGCCTGG - Intronic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
954236592 3:49261856-49261878 TGAGGCCCAAAAAGCCACACAGG + Intergenic
954737009 3:52715076-52715098 TGAGGCCCCACCTTCCGGCCAGG + Intronic
959830721 3:110858556-110858578 TGAAGCCCACACTACCAGCCAGG + Intergenic
960690582 3:120342230-120342252 TGGGGGCCAAGCTGCCAGTCGGG + Intronic
961680889 3:128599218-128599240 TGAGGCCCAAACTGAAAGTAGGG - Intergenic
963281176 3:143385976-143385998 CGTGGCCCAAAATACCAGCCTGG - Intronic
964680079 3:159328699-159328721 TGGTGCCCAAACACCCAGCCTGG - Intronic
968959003 4:3733397-3733419 TGAGGCCCTACCCGCCTGCCTGG + Intergenic
972609845 4:40646329-40646351 TCATGCCCAAAGTTCCAGCCAGG + Intergenic
973026932 4:45284420-45284442 TGATGCCCCACCTTCCAGCCAGG - Intergenic
974551332 4:63379382-63379404 TGAGGCCCACCCTTCAAGCCAGG + Intergenic
975098819 4:70488929-70488951 TGAGTCCCTAACTGCCTGGCAGG + Intergenic
980309050 4:131102285-131102307 TGAAGCCCCAACTTCAAGCCAGG - Intergenic
980550412 4:134327896-134327918 GGAGGCCCTCAGTGCCAGCCTGG + Intergenic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
983810250 4:172051779-172051801 AGAGGCCCTACCTGCAAGCCTGG - Intronic
986125403 5:4879152-4879174 AGAAGCCCAACCTCCCAGCCCGG - Intergenic
989023632 5:37041287-37041309 TGAGGCTCACACTGTCACCCAGG + Intronic
993702446 5:91134424-91134446 TGATCCCCACCCTGCCAGCCTGG + Intronic
997280354 5:132639725-132639747 TGAGGCTCTAGCAGCCAGCCAGG + Intronic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
1002486182 5:179538746-179538768 TGAGGCCAAGAGTTCCAGCCTGG + Intergenic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1007309684 6:40935391-40935413 TGAGGTGCTCACTGCCAGCCTGG - Intergenic
1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG + Exonic
1007751614 6:44074927-44074949 TGAGCCCCTATCTGCCAGCTCGG - Intergenic
1007958750 6:45940056-45940078 TGAAGCCCACAGTGCCAGCTTGG - Intronic
1010007875 6:71015257-71015279 TGAGGCCCAAATTGCAGGCCAGG + Intergenic
1010743701 6:79537225-79537247 TTAGGACCAAACTCCCAGCTGGG + Exonic
1019103142 6:169648307-169648329 CGAGGCCCCAAATGCCACCCAGG - Intronic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1019415222 7:923946-923968 TGGGGCCCAAACGTCCAGCCTGG - Intronic
1019501584 7:1367380-1367402 TGAGGCCCGAGCTGGCATCCTGG - Intergenic
1019548888 7:1592513-1592535 TGAGACGTAAACAGCCAGCCAGG + Intergenic
1019752834 7:2743246-2743268 TGAGACCCAAACTGCCAACTTGG - Intronic
1020659623 7:10966512-10966534 TGAGGACCAACCTTCAAGCCAGG - Intergenic
1021609311 7:22442478-22442500 TGAGGCCCAACTTGCAGGCCAGG - Intronic
1022335174 7:29415271-29415293 TGACTCCCCAAGTGCCAGCCAGG - Intronic
1023832272 7:44046397-44046419 GGAAGCCCAAACTGCCAGGTGGG - Intronic
1025723699 7:64038419-64038441 TGTAGCCCAAGCAGCCAGCCCGG - Intronic
1026082436 7:67233936-67233958 TGAGGTCCTAACTCCCAGCGTGG + Intronic
1028435837 7:90802569-90802591 TGAAGTCCAAACTGCAATCCAGG - Intronic
1028604890 7:92644857-92644879 GGAGGCCCACATTGGCAGCCTGG - Intronic
1034147122 7:148883797-148883819 TGAGGCTCGAGCTGCCACCCTGG + Intronic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1036655126 8:10672858-10672880 TGGGGCCCAAACTTCAGGCCAGG + Intronic
1036776057 8:11613750-11613772 TCAGGCCCAGCCTCCCAGCCTGG - Intergenic
1037554004 8:20004499-20004521 TGAGGCCCCACCTTCAAGCCAGG - Intergenic
1040279047 8:46028765-46028787 GGTGGCCCAAAATGCCACCCCGG + Intergenic
1040448654 8:47522132-47522154 TGTCGCCCAAGCTGCCAGGCTGG - Intronic
1043910688 8:85859844-85859866 TAAGGCCCATGCTGTCAGCCAGG - Intergenic
1044435131 8:92152977-92152999 AGATGCAGAAACTGCCAGCCAGG - Intergenic
1044581407 8:93829823-93829845 TGAGGCCTAAAATGCCCCCCAGG - Intergenic
1046820194 8:118626356-118626378 TGAGCCCCAAACTGTGAGCTAGG - Intergenic
1046934643 8:119874305-119874327 TGAGGCGCAGGCTGTCAGCCGGG - Intronic
1051169195 9:14301679-14301701 TGAGGCCCCAGTTGCCAGCTGGG - Intronic
1051208209 9:14712680-14712702 TGAAACCCAAACTCTCAGCCAGG + Intergenic
1052817761 9:33114686-33114708 TGAGGACCAAAATGAAAGCCTGG + Intronic
1054949539 9:70834755-70834777 TGCAGCCCCAACTGCCATCCTGG + Intronic
1055794691 9:79962986-79963008 TTAGGAACAAAATGCCAGCCTGG + Intergenic
1057608951 9:96523605-96523627 TGAGGCCCAATCACCGAGCCAGG + Exonic
1058952182 9:109914219-109914241 TGAGGCACAAACTGCCATCTTGG - Intronic
1060180123 9:121527915-121527937 TGAGGCCCCACCTTCAAGCCAGG - Intergenic
1060216718 9:121742879-121742901 TGAGGCTCAAACTGAAAGCCTGG + Intronic
1060952963 9:127616531-127616553 TGAGCCACAACCTCCCAGCCAGG - Intronic
1061743254 9:132722568-132722590 TGAGGCCCCACCTTCAAGCCAGG - Intergenic
1062124956 9:134855295-134855317 TGTGGCCCAAGCTCCCACCCTGG - Intergenic
1062454329 9:136628632-136628654 TGAGGCCCAAGCTGGCTGCCGGG + Intergenic
1062635279 9:137487347-137487369 AGTGGCCCAAAGTGCCGGCCTGG + Intronic
1188317661 X:28694404-28694426 TTTGGCCCAATCTGCCAGGCAGG + Intronic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1194049803 X:89054509-89054531 TCAGCACCAACCTGCCAGCCAGG - Intergenic
1196825108 X:119734753-119734775 TGAGGCCAAAAGTTCCAGCCTGG - Intergenic