ID: 902253065

View in Genome Browser
Species Human (GRCh38)
Location 1:15168610-15168632
Sequence GGCAAGGTTGAAGAACTCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902253065_902253069 20 Left 902253065 1:15168610-15168632 CCATAGAGTTCTTCAACCTTGCC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 902253069 1:15168653-15168675 CTGCATCTGAGGAAGTCTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 206
902253065_902253068 9 Left 902253065 1:15168610-15168632 CCATAGAGTTCTTCAACCTTGCC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 902253068 1:15168642-15168664 GTACTGACTCACTGCATCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902253065 Original CRISPR GGCAAGGTTGAAGAACTCTA TGG (reversed) Exonic