ID: 902253065

View in Genome Browser
Species Human (GRCh38)
Location 1:15168610-15168632
Sequence GGCAAGGTTGAAGAACTCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902253065_902253069 20 Left 902253065 1:15168610-15168632 CCATAGAGTTCTTCAACCTTGCC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 902253069 1:15168653-15168675 CTGCATCTGAGGAAGTCTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 206
902253065_902253068 9 Left 902253065 1:15168610-15168632 CCATAGAGTTCTTCAACCTTGCC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 902253068 1:15168642-15168664 GTACTGACTCACTGCATCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902253065 Original CRISPR GGCAAGGTTGAAGAACTCTA TGG (reversed) Exonic
902253065 1:15168610-15168632 GGCAAGGTTGAAGAACTCTATGG - Exonic
902571494 1:17349882-17349904 GGCAAGTTTGAAGAACAGGAAGG - Intronic
906841483 1:49144290-49144312 GGCTATGTTGGAGGACTCTAGGG + Intronic
909679111 1:78271405-78271427 GACAAGGTTGAAAAACTATTAGG - Intergenic
910966223 1:92810762-92810784 GGCAAACTTGAAGAACTTGAAGG - Intergenic
911638514 1:100263014-100263036 GACAAAGTTAAAGAATTCTAAGG - Intergenic
911819523 1:102399850-102399872 GGCAAGGTTGATGAATTAAATGG - Intergenic
912354021 1:109041213-109041235 CGCAAGGTTGTGGAACTCAAAGG - Intronic
918124639 1:181572218-181572240 TGCAAGGTTGGAGAATTCTTTGG + Intronic
921399905 1:214710152-214710174 GGTCAGGTTTAAGAACTCTTTGG + Intergenic
921521585 1:216162237-216162259 GGCAAGATTAGAGAACTCAACGG - Intronic
922430161 1:225543876-225543898 GGTAAGGTAGAAAAATTCTAAGG - Intronic
923219619 1:231881333-231881355 GGCAAGATTGCAGAGCTCTAGGG + Intronic
924326545 1:242900497-242900519 GCCAAGCTTGAAGAAATCTCAGG + Intergenic
1063599800 10:7470072-7470094 GGCCTTGTTGTAGAACTCTAAGG - Intergenic
1067370023 10:45673937-45673959 GGCAAGGGTGAGAAACGCTAAGG - Intergenic
1071778792 10:88819393-88819415 AGGAAGGTTGAAAAATTCTATGG - Intronic
1074578192 10:114690608-114690630 GGCAATGTTGAAGAACACCGTGG + Intergenic
1075203971 10:120430889-120430911 TGCAAAGTTGTAGAACTCTCTGG + Intergenic
1079816668 11:25068775-25068797 GGTACGGTTCAAGAACTCTGAGG - Intronic
1085727484 11:78966892-78966914 GCCAAGTTTGCAGAGCTCTAGGG + Intronic
1087872943 11:103321111-103321133 GGTATGACTGAAGAACTCTAAGG - Exonic
1088390632 11:109310860-109310882 GTCAAGGTTGAGAAACTCTGGGG - Intergenic
1089817733 11:121191315-121191337 GGCAAGGTTGAAGGACACAGTGG - Exonic
1091892072 12:4065509-4065531 AGCAAGGTTGTAGAACACAAGGG - Intergenic
1100181509 12:92091307-92091329 GGCAAGATTGAAGAAGTGGAAGG - Intronic
1100855364 12:98752794-98752816 GGCAAGGTTGAAGTGCTCCCAGG - Intronic
1102517354 12:113458697-113458719 GCCAAGGTTCAGGAAATCTAGGG - Intergenic
1103057870 12:117835800-117835822 GCCAAGGTTGAGAAACCCTAGGG + Intronic
1103278446 12:119733771-119733793 GCCAAGGTTGAGGAACCCTGGGG + Intronic
1107242027 13:38247719-38247741 GAAAAGGTTTAAAAACTCTATGG - Intergenic
1108298812 13:49053554-49053576 GGAAAGGTGGAATAACTCAAGGG + Intronic
1108779239 13:53808327-53808349 GGGAAGGTTGAAGAACATTAGGG + Intergenic
1114598289 14:23933070-23933092 GGCAAGGTTGAGCCACTCTGTGG + Intergenic
1115919566 14:38357341-38357363 GGAAAGGTGGAAGGACTTTATGG - Intergenic
1116228187 14:42180613-42180635 GACAAGTTTGAAGAACTTCAGGG + Intergenic
1117725770 14:58672169-58672191 GGAAAGGTTGAAGAAGAGTAGGG - Intergenic
1119285901 14:73454073-73454095 GGAACGGTTGAAGAACTATTGGG + Intronic
1130205368 15:81870492-81870514 GGGGAGGGTGAAGAAGTCTAGGG - Intergenic
1140682579 16:77400005-77400027 TTCAAGGATCAAGAACTCTATGG + Intronic
1147267701 17:39244748-39244770 GCAAAGGTTCAAGAACTCTGCGG - Intergenic
1147283740 17:39384133-39384155 GGTAAGGTGGAAGATCACTAGGG + Intronic
1147721255 17:42540876-42540898 GGCAAGGCTGTTGAACACTATGG + Intronic
1149338762 17:55664990-55665012 GGAAAAGTTGAAGACCTCTTTGG - Intergenic
1149344896 17:55724880-55724902 GACAAGGTTGAAGAAAGCTTTGG - Intronic
1150520010 17:65856242-65856264 GGTAAGATTGAAGAACTCCCTGG + Intronic
1156899606 18:42285773-42285795 GGCTAGGTTTAAGAACTGTGGGG + Intergenic
1159644309 18:70899120-70899142 GGCTTGTTTGAATAACTCTATGG + Intergenic
1161486530 19:4538741-4538763 GGTCAGGTTGAAGAATTCCACGG + Exonic
1162863266 19:13524502-13524524 GGCATGCTTGAAGAACATTAAGG + Intronic
1165882039 19:39051175-39051197 GTCAGTGTTGAAGGACTCTAGGG - Intergenic
1167420388 19:49399276-49399298 GGTAAGCTTGAAAAAGTCTAGGG - Intronic
925329879 2:3050323-3050345 GGCAAGTTTGTAGAACTTTCTGG - Intergenic
928461482 2:31477289-31477311 TTCAAGTTTGAAGAACTCTTAGG + Intergenic
928810777 2:35222334-35222356 GGCAAAGTTGAAGAGTTTTATGG + Intergenic
931838519 2:66125548-66125570 GGCCAAGTTCAAGAACTCTGAGG - Intergenic
935149713 2:100422788-100422810 GGTAAAGTTGTAGAACTGTAGGG + Intergenic
938214271 2:129496304-129496326 GGCAATGTTGAAGAACACGGTGG - Intergenic
938401423 2:130995387-130995409 GGCAAGGTTGACTATCTCAATGG - Intronic
940042603 2:149376259-149376281 GGCAAGATTGAAGAGCTTTCTGG + Intronic
941130304 2:161640311-161640333 GACAATGTTGAAAAACTCTGTGG - Intronic
941437941 2:165494800-165494822 GGGAAGTTTGAAGAAGTCAACGG + Exonic
944230740 2:197389508-197389530 GCCAAGGTTGAGAAACCCTAGGG + Intergenic
945298287 2:208192562-208192584 GTCAAGGTTGAAGTTCTCCAAGG - Intergenic
945930606 2:215851352-215851374 TGCAAGGTTGAAATGCTCTATGG - Intergenic
948474470 2:238208099-238208121 GGAAAGGTTGAAGAAATGAATGG - Intergenic
1169867127 20:10214105-10214127 TCCAAGGGTGAAGAACTCTGAGG - Intergenic
1170488533 20:16845667-16845689 GAAATGGTTGAAAAACTCTAAGG + Intergenic
1175698710 20:61122028-61122050 GGCAGGGTTGAAGAGCACTGTGG + Intergenic
1178464108 21:32831086-32831108 GGCAATCTTGAAGAACACTTCGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
951089994 3:18561258-18561280 TGTAAGGCTGCAGAACTCTATGG + Intergenic
951395385 3:22159189-22159211 GGGAAGTTTGAAGAACTTGAAGG - Intronic
953731374 3:45451898-45451920 AGCAAGGTTAAAGATCTCTAAGG - Intronic
955596520 3:60596340-60596362 GCCAAGGTTGGAGAACTTCAAGG - Intronic
958921498 3:100111156-100111178 GGCCAGAAGGAAGAACTCTAGGG + Intronic
959030965 3:101299413-101299435 AGCAAGGGTGAAGAACTGGATGG - Intronic
959292639 3:104494025-104494047 GGCAAGATTAATGAACTTTATGG + Intergenic
961312441 3:126012093-126012115 GGCAAGTCTGAAGAACTGAAAGG - Intronic
962116025 3:132508648-132508670 GTCAAGGTTGAAAAACTATTGGG + Intronic
962456913 3:135573275-135573297 GGAAGGGATGGAGAACTCTATGG - Intergenic
963272340 3:143298283-143298305 GGCTAGGTTGCAGATCTATATGG - Intronic
966901091 3:184486022-184486044 GGCAAGGTTGAAAAACTGTTGGG - Intronic
972762721 4:42122565-42122587 CGCAAAGTTAAAGAACTTTAAGG + Intronic
973112670 4:46414601-46414623 AGCCAGTTTGAAGACCTCTACGG - Intronic
973616605 4:52685133-52685155 AGAAAAGTTGAAGAACTTTAAGG - Intergenic
977011861 4:91645636-91645658 GGCAAGACTGAAGAACCATATGG - Intergenic
977229789 4:94438126-94438148 GCCAAGGTGGAAGAACTGGAAGG + Intergenic
980864970 4:138543329-138543351 AGCAAGGGTGAAGAACTGAACGG + Intergenic
981217081 4:142182752-142182774 GGCAGGATTGAAGGACTCTTAGG - Intronic
981724747 4:147835218-147835240 TGCAGGGTTGAAAAACTCTTGGG - Intronic
981731923 4:147908599-147908621 GGCAACCTTTAAGAACTGTAAGG - Intronic
989726399 5:44591514-44591536 GACAAAGTTGGAGAACTATAAGG - Intergenic
990639683 5:57768624-57768646 GGAAATCTTGAAGGACTCTAGGG + Intergenic
993077344 5:83250557-83250579 TGCAAGTTTGATGAAATCTAAGG + Intronic
995794214 5:115924749-115924771 GGCTTGGTTGCAGAATTCTAGGG - Intergenic
996620458 5:125495648-125495670 GGCAATCTTGAAGAACAATAAGG + Intergenic
998234370 5:140385592-140385614 GGGGAGGTTGAAAACCTCTAGGG + Intergenic
1000654370 5:163858373-163858395 TGCAAAGTTAAAGCACTCTAGGG + Intergenic
1001132606 5:169077132-169077154 GACAAGGATGAAGACCTTTATGG + Intronic
1001249772 5:170138093-170138115 GGCAGGGTTGGAGAACACTCAGG + Intergenic
1001500194 5:172225820-172225842 GGCAATGTTCTAGAACTCCAAGG + Intronic
1001870701 5:175152368-175152390 GACATGGTTCAAGAACTCAATGG + Intergenic
1002528477 5:179829036-179829058 GGGAGGGTTGAAAACCTCTAGGG + Intronic
1003196247 6:3917811-3917833 GGAAAGGTGGAACAACTCAAAGG + Intergenic
1004998792 6:21220012-21220034 GGCAAAGTTGAAGAAATAAAAGG - Intronic
1008438026 6:51498890-51498912 GGCAAGGCTGAAGGACAATAAGG - Intergenic
1008485242 6:52028304-52028326 GGCGAGGCTGATGAACTATACGG - Exonic
1009928203 6:70145546-70145568 GGCAAGGTTGAAAAACTGTCAGG + Intronic
1009975903 6:70670469-70670491 GGTAAGGTTGAAGTACATTATGG + Intronic
1011735253 6:90303676-90303698 GGCAAGAATGCAGAACTCTGGGG + Intergenic
1012525170 6:100168874-100168896 GGCAAGCATGAAGTACACTAAGG - Intergenic
1012828199 6:104173183-104173205 GGGAATGTTGATGAACTCGAAGG - Intergenic
1015425346 6:133059208-133059230 GACAAGGATGAAGACCTATATGG + Intergenic
1016297189 6:142586034-142586056 TGCAAGGCTTAAGAAATCTAAGG - Intergenic
1018319543 6:162592699-162592721 GTCAAGGTTGAAGAGAACTAGGG - Intronic
1018476091 6:164143429-164143451 GGCAAGGTTGCTGAATTCAAGGG - Intergenic
1020490187 7:8773028-8773050 GGCAAGGTTGAAAAACTGTTTGG - Intergenic
1021096921 7:16546300-16546322 AGCAAGGTTGAAAAACCGTAGGG - Intronic
1021350005 7:19580785-19580807 GGCAATGTTGTAGGACTCTATGG + Intergenic
1022434674 7:30371585-30371607 TCCAAGATTGAAGAACTCCAGGG + Intronic
1022660322 7:32360933-32360955 GGCACGGTTGAAGAGCTTTATGG + Intergenic
1023663559 7:42495215-42495237 GACATGGTGGAAGAACTCCAGGG - Intergenic
1027717023 7:81685364-81685386 TGCATGCTTGGAGAACTCTAGGG - Intergenic
1028725644 7:94084594-94084616 GTCATGGTGGAAGAACCCTATGG + Intergenic
1031424028 7:121584322-121584344 AGCAAGGTTGAAGGACACAATGG + Intergenic
1033232499 7:139612049-139612071 GGAAAATTTGAAGAACTCTCTGG + Intronic
1034826185 7:154265809-154265831 GGCCAGGGTGAAAAAGTCTAAGG - Intronic
1037575825 8:20201701-20201723 GGCAAGGCTGATGCACCCTAAGG - Intronic
1040122414 8:43698028-43698050 CACAAAGTTGAACAACTCTAAGG + Intergenic
1040887893 8:52284979-52285001 GGAAATGTTGAACAACTATAAGG + Intronic
1041007170 8:53506926-53506948 GCCAAAGTAGAAGAACTCTCTGG - Intergenic
1041629113 8:60064675-60064697 GGGAAGGATAAAGAACTCTAAGG - Intergenic
1042076663 8:65003203-65003225 GACAAGGATGAAGAACTTTATGG - Intergenic
1043752305 8:83953153-83953175 GTCATGGTTGAGGAAATCTAAGG - Intergenic
1044135764 8:88584073-88584095 AGCAAGGGTGCAGAACTCGATGG - Intergenic
1045698794 8:104841844-104841866 GGAAAGGTTGAAAAACTATTAGG - Intronic
1046809397 8:118516181-118516203 GGAAAGGTTGAAGAAGTCAGTGG - Intronic
1048382128 8:133874517-133874539 GACATGGATGAAGAACTGTAGGG - Intergenic
1055167150 9:73210837-73210859 GGCAAGGTTAAAAAAATCTTGGG + Intergenic
1056340614 9:85627726-85627748 GACAAGAATGAAGACCTCTATGG + Intronic
1057374595 9:94508280-94508302 GACAAGGATGAAGACCTTTATGG + Intergenic
1186291535 X:8105402-8105424 GACAAGGATGATTAACTCTAAGG - Intergenic
1196422180 X:115534191-115534213 GGGAAAGTTTAAGAACTTTATGG + Intergenic
1196964193 X:121037857-121037879 GACAAGGATGAAGACCTTTATGG + Intergenic
1197010902 X:121561999-121562021 GGCAGGGTTGAAGTAATCTGAGG + Intergenic
1197256197 X:124265884-124265906 AGCAATCTTGAAGAACTCAATGG - Intronic
1198025341 X:132700280-132700302 GGCAAGGTTGAGAAAATCAATGG + Intronic
1198822626 X:140665303-140665325 GGCAGGGTTCATGAACTCTCGGG - Intergenic
1199448467 X:147953826-147953848 GGAAAGGTAGAATCACTCTAAGG + Intergenic
1200421172 Y:2970085-2970107 GGCAAAGTTGAAGAAGCATAAGG + Intronic