ID: 902255521

View in Genome Browser
Species Human (GRCh38)
Location 1:15186571-15186593
Sequence CACTTAAGACATCTGTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902255518_902255521 -10 Left 902255518 1:15186558-15186580 CCTCTCCCAGCTTCACTTAAGAC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 902255521 1:15186571-15186593 CACTTAAGACATCTGTAGAATGG 0: 1
1: 0
2: 2
3: 20
4: 227
902255517_902255521 21 Left 902255517 1:15186527-15186549 CCGATAGGGGAAATGGGCAAAGT 0: 1
1: 0
2: 2
3: 17
4: 175
Right 902255521 1:15186571-15186593 CACTTAAGACATCTGTAGAATGG 0: 1
1: 0
2: 2
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902255521 Original CRISPR CACTTAAGACATCTGTAGAA TGG Intronic
902255521 1:15186571-15186593 CACTTAAGACATCTGTAGAATGG + Intronic
903278871 1:22238815-22238837 CAGTTTACACATCTGTACAATGG - Intergenic
904647791 1:31981177-31981199 CAGTTACGTCATCTGTAAAATGG - Intergenic
904853655 1:33478766-33478788 GACTTTGGACATGTGTAGAAGGG + Intronic
904896839 1:33824062-33824084 CAGTTTTCACATCTGTAGAATGG - Intronic
904943183 1:34178945-34178967 CACTTAATCCATCTGTAAAATGG - Intronic
906533453 1:46537587-46537609 CATTTAAGAAATCTGTTTAAAGG - Intergenic
906930317 1:50163346-50163368 CAGTTTCCACATCTGTAGAAGGG + Intronic
910172155 1:84388943-84388965 ATTTTAAGACATGTGTAGAAAGG - Intronic
910453127 1:87367392-87367414 CTCTGAACACATCTGTAAAATGG + Intergenic
911793701 1:102050875-102050897 CACTTCAAAGATCTGCAGAATGG + Intergenic
912524338 1:110269882-110269904 CATGTAACACATCTTTAGAACGG - Intronic
913036944 1:114977380-114977402 CAAATAATACCTCTGTAGAAAGG + Intronic
916244794 1:162676767-162676789 CACTTCCGTCATCTGTGGAAGGG - Intronic
916530382 1:165651109-165651131 CACCAAAGACATCTGCAGAGTGG + Intronic
916584847 1:166141626-166141648 CACTTTACTCATCTGTAAAATGG - Intronic
918246030 1:182660225-182660247 CACTTTCCTCATCTGTAGAAGGG - Intronic
918675520 1:187280146-187280168 CAGTTCAGCCATATGTAGAAAGG - Intergenic
919532601 1:198742819-198742841 CAGTTAAGTCATCTGTAAAATGG + Intronic
921304633 1:213783419-213783441 CACTGGTGACATCTGCAGAAAGG + Intergenic
922363999 1:224846829-224846851 GACTTAAGAAATCGGTAGCAAGG - Intergenic
924316196 1:242800018-242800040 CAGTTGAGTCATCTGTAAAATGG - Intergenic
924376062 1:243410544-243410566 AACTTCAGACATCAGTAAAAAGG + Intronic
924785864 1:247198884-247198906 CATTTAAAACCTCTATAGAATGG + Intergenic
924903193 1:248424042-248424064 GACTTAAAACGTCAGTAGAAAGG + Intergenic
1064469459 10:15621085-15621107 CCCTTAAGGCATTTATAGAAAGG - Intronic
1064991264 10:21258984-21259006 CACTTTCGTCATCTGTAAAATGG - Intergenic
1065457433 10:25922021-25922043 TACTTTAGTCATCTGTAAAATGG + Intergenic
1066305156 10:34133173-34133195 CACTTAAGCCATCTGCAGACAGG + Intronic
1068304694 10:55192276-55192298 AACATAAGCCATCTGGAGAATGG - Intronic
1068396136 10:56465113-56465135 CACTGAACAGATCTTTAGAAAGG + Intergenic
1069847612 10:71383679-71383701 CATTTAATTCATCTGTAAAATGG - Intergenic
1070047937 10:72857992-72858014 AACTTATGACAACTGAAGAATGG + Intronic
1070643809 10:78187543-78187565 CAGTTTATGCATCTGTAGAATGG - Intergenic
1071674239 10:87639738-87639760 CTCTTCAGACAAATGTAGAAAGG + Intergenic
1072950688 10:99844438-99844460 CACTTGTGACATCGGTAGCATGG + Exonic
1074536862 10:114334289-114334311 CTCTGAAGACTTCTGAAGAAAGG - Intronic
1074626139 10:115188814-115188836 CACTTAATACATCTGTTTTATGG - Intronic
1075214549 10:120520685-120520707 CAGTTTCCACATCTGTAGAAGGG - Intronic
1075509955 10:123064063-123064085 CACTTGAGATGTCTGTAGAAAGG + Intergenic
1078067470 11:8087837-8087859 CAGTGAAGACTTCTGAAGAAAGG - Intronic
1079615630 11:22489162-22489184 CATCTAAGACTTCTCTAGAATGG - Intergenic
1080801170 11:35611649-35611671 CACTTAACTCATCTGTAGAATGG - Intergenic
1081635550 11:44719129-44719151 CACTTTACTCATCTGTAAAATGG + Intergenic
1081903009 11:46645973-46645995 CACTTAAGACTTCTGAGGTAAGG + Exonic
1082000028 11:47389216-47389238 CACTTCCGTCATCTGCAGAATGG - Intergenic
1082654596 11:55838128-55838150 CAGTAAAGACATCTATTGAATGG - Intergenic
1084032025 11:66486821-66486843 CAGTTTTGTCATCTGTAGAATGG + Intronic
1085424313 11:76390354-76390376 CAGTTAATTCATCTGTAAAAGGG + Intronic
1085695499 11:78701248-78701270 CAGTTTCCACATCTGTAGAATGG - Intronic
1085716079 11:78874765-78874787 CACTCAGATCATCTGTAGAATGG - Intronic
1085736008 11:79039627-79039649 CACTTAAGACATCTATAATAAGG + Intronic
1086726605 11:90193235-90193257 CAATTAAGACTTTTGTAAAAGGG + Intergenic
1087445721 11:98250129-98250151 CACTTAAGTCTTCCCTAGAATGG - Intergenic
1088519541 11:110680185-110680207 CACTTTATCCATCTGTAAAATGG - Intronic
1093960123 12:25263474-25263496 CACTTATGATTTCTGAAGAAGGG - Intergenic
1095841531 12:46699109-46699131 CACTTAAGACATCTATAATTAGG - Intergenic
1097397736 12:59096356-59096378 AAATTAAGACATCTGGAGAAAGG + Intergenic
1098517381 12:71393053-71393075 CAGTTAACACATCTGTAAAGTGG + Intronic
1099351796 12:81580276-81580298 CACTTTTTACATCTGTAAAATGG - Intronic
1101356653 12:103984836-103984858 GACTTAAGAGATCAGTTGAAAGG + Exonic
1101812801 12:108122247-108122269 CAGTTTACTCATCTGTAGAATGG - Intergenic
1102219541 12:111185416-111185438 CACTTTTGCCATCTGTAAAATGG + Intronic
1104293568 12:127491407-127491429 CCATAAAGACTTCTGTAGAATGG - Intergenic
1109007210 13:56893539-56893561 CACTTCAGACATCTCTACAGAGG + Intergenic
1110981638 13:81907630-81907652 GACAGAAGACATCTATAGAAAGG - Intergenic
1111159995 13:84382554-84382576 CACTTGAGACATCTCTACAGAGG - Intergenic
1112707171 13:102083524-102083546 GACTTGAGACATCAGTAGAAAGG - Intronic
1113412915 13:110106126-110106148 TAGTTTAGGCATCTGTAGAATGG - Intergenic
1114652143 14:24291996-24292018 CAGTTTTGCCATCTGTAGAATGG + Intronic
1115715260 14:36096533-36096555 CCCATTAGACATCTATAGAAGGG - Intergenic
1117326597 14:54674614-54674636 ATTTAAAGACATCTGTAGAAAGG - Intronic
1118408596 14:65452308-65452330 CACCTAAGACAACTAAAGAATGG + Intronic
1121995716 14:98601434-98601456 GACCTAGGACCTCTGTAGAAGGG - Intergenic
1124652944 15:31486297-31486319 CACTTATGCCATCAGTAAAATGG + Intronic
1124875330 15:33586668-33586690 CAGTTATGTCATCTGTAAAATGG + Intronic
1126802153 15:52308788-52308810 AACTTAAGGCAGCTCTAGAAGGG + Exonic
1127019432 15:54729483-54729505 AACTTAAGACTTCTATAGAGGGG + Intergenic
1127474274 15:59317909-59317931 CAGTTTCCACATCTGTAGAATGG - Intronic
1129170416 15:73804173-73804195 CACTTTTGACATCTGCAGAATGG + Intergenic
1129745747 15:78019556-78019578 CTTTTAAGACACCAGTAGAAAGG - Intronic
1131088736 15:89601818-89601840 CACTGAAAAAATCTGTAGGAAGG - Exonic
1131381461 15:91967629-91967651 CAATTAATCCATCTGTAAAACGG - Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132245410 15:100292664-100292686 CAGTTTGCACATCTGTAGAATGG - Intronic
1134592803 16:15469910-15469932 CACTTAAGTCATCTGCAAATAGG + Intronic
1135064068 16:19294630-19294652 CACTAAAGAAGTCTGCAGAAGGG - Intronic
1135465981 16:22685283-22685305 CAGTTATACCATCTGTAGAATGG + Intergenic
1135498205 16:22970882-22970904 CACTTAAGATATCAGTAACAGGG + Intergenic
1135544588 16:23357113-23357135 CACTTCAGGCCTCTGTGGAAAGG + Intronic
1138104326 16:54279533-54279555 CACTTTTGACATCTGTGCAATGG - Intergenic
1139001483 16:62515864-62515886 CACTCAAAACATCTCTACAAGGG + Intergenic
1139216769 16:65133254-65133276 CAGTTTCCACATCTGTAGAATGG + Intergenic
1139537365 16:67585344-67585366 CACTGAAGACATGTGTAAGACGG - Intronic
1139674078 16:68510969-68510991 CAGTTTACGCATCTGTAGAATGG - Intergenic
1140949737 16:79805432-79805454 CATTTAACTCATCTGTAAAATGG - Intergenic
1141786278 16:86202934-86202956 CACTTACCCCATCTGTAAAATGG - Intergenic
1143930496 17:10418448-10418470 CACTTTACTCATCTGTAAAATGG + Intronic
1145776415 17:27532161-27532183 CATTTCAGACATCTGAAGATGGG + Intronic
1146899085 17:36569922-36569944 CCGTTAAGATATCTGTAAAATGG - Intronic
1146995314 17:37315317-37315339 GACATAAGACATCTGTAAAATGG - Intronic
1149349512 17:55772878-55772900 CACTTTTGTCATCTGTAGTATGG + Intronic
1150493416 17:65589699-65589721 AACTGAAAACATCTGTAGTATGG - Intronic
1153703789 18:7724163-7724185 CACTTAGTACATTTGTTGAATGG + Intronic
1156775608 18:40784420-40784442 CACAAAAGACATGTTTAGAAGGG + Intergenic
1156992488 18:43426273-43426295 CACTGAAGGCAGATGTAGAAAGG + Intergenic
1157099577 18:44717045-44717067 CATTTGAGTCATCTGTAAAATGG - Intronic
1159506394 18:69342525-69342547 CACTGGAGACATCTTTATAAAGG + Intergenic
1159789526 18:72760649-72760671 CAGTTACCACATCTGTAAAATGG + Intronic
1159979673 18:74762840-74762862 TAATTCAGACATCTATAGAAAGG - Intronic
1160298610 18:77658912-77658934 CACTTGAGCCATCTGGAGGAGGG - Intergenic
1160298618 18:77658959-77658981 CACTTGAGCCATCTGGAGGAGGG - Intergenic
1160915350 19:1493785-1493807 CACTTAATAAATGTGCAGAAAGG + Intronic
1161249382 19:3271996-3272018 CAATGTTGACATCTGTAGAAAGG + Intronic
1161629006 19:5342147-5342169 CACTTTCCCCATCTGTAGAATGG + Intergenic
1163124166 19:15235614-15235636 CACTTTAGACATTTGTAGAAGGG - Exonic
1168508805 19:56958286-56958308 TACTCAAGACATCTGTAGACAGG + Intergenic
925783448 2:7405265-7405287 CAGTTATCACATCTGTGGAATGG + Intergenic
926359362 2:12071046-12071068 GAGTGAAGACAGCTGTAGAAAGG + Intergenic
928494001 2:31813268-31813290 CACTTAAGCCATCCGTGGATGGG - Intergenic
928875210 2:36030453-36030475 TACATAAGACATATGCAGAAAGG + Intergenic
929587503 2:43125713-43125735 CAGTTTAGTCATCTGTAAAATGG - Intergenic
930239612 2:48922421-48922443 CATTTAAGACCTCATTAGAATGG + Intergenic
930360690 2:50374874-50374896 AACTTAAGAAATCTGTCAAAAGG - Intronic
932469536 2:71944852-71944874 CAGTTCAGCCATCTGTAGAATGG - Intergenic
936380403 2:111980278-111980300 AACTTAGGGCACCTGTAGAATGG - Intronic
936410781 2:112256121-112256143 CATTTAAGGGACCTGTAGAAAGG + Intergenic
937485083 2:122307333-122307355 CAACTGTGACATCTGTAGAAAGG - Intergenic
938734259 2:134172142-134172164 CACTTAATTCTTATGTAGAAAGG + Intronic
938998208 2:136703166-136703188 CACATAAGAGCTGTGTAGAAAGG - Intergenic
939392890 2:141591560-141591582 CACTGAAGACAACTGCAGAGTGG + Intronic
939586969 2:144017623-144017645 CAATTATGTCATCTGTAAAATGG + Intronic
939780782 2:146445064-146445086 CACATAACACAACTATAGAATGG + Intergenic
944904258 2:204246724-204246746 CAATTAAGGCCTCTGAAGAAAGG + Intergenic
945105072 2:206303753-206303775 CACTTAGAATATCTGGAGAATGG - Intronic
946759185 2:222976325-222976347 CACTTTACTCATCTGTAAAATGG - Intergenic
947922204 2:233886987-233887009 CAGTTATGTCATCTGTAAAATGG + Intergenic
1168942186 20:1722022-1722044 AACTTAACTGATCTGTAGAAGGG + Intergenic
1171164966 20:22961736-22961758 CACATAAGAATTCTTTAGAATGG + Intergenic
1171265128 20:23765616-23765638 CAGTTAACTCATCTGTACAATGG - Intergenic
1171287210 20:23951165-23951187 CAGTTAACTCATCTGTACAATGG - Intergenic
1172753440 20:37267383-37267405 CAGTTACTACATCTGTACAATGG + Intergenic
1173228877 20:41178751-41178773 CACTTAAGCCTTGGGTAGAATGG - Exonic
1173630632 20:44511949-44511971 CAGTTACTACATCTGTAAAAAGG + Intronic
1173762589 20:45576790-45576812 AACTTAAAACATAAGTAGAATGG - Intronic
1175032995 20:55973819-55973841 CACTGAGGACCTCTGTGGAATGG + Intergenic
1175592341 20:60203240-60203262 CACTTTTCACATCTGTAAAATGG - Intergenic
1177732521 21:25046452-25046474 CACTTAAAATATCTGTTAAAAGG + Intergenic
1179555148 21:42169340-42169362 CAATTAATACATCTCTAGACAGG - Intergenic
1181755217 22:25019270-25019292 CAGTTTACTCATCTGTAGAATGG + Intronic
1181993169 22:26853683-26853705 CACTTTACTCATCTGTAAAATGG + Intergenic
1182309660 22:29395522-29395544 CACTGAGGACATCTGCAGCAAGG - Intronic
1183786936 22:40034896-40034918 CACTTAGGACAGATGAAGAAAGG - Exonic
1184872591 22:47250373-47250395 CACTGCTCACATCTGTAGAAAGG - Intergenic
949343438 3:3053385-3053407 CACTTCAGTCATCTGTAAAAGGG - Intronic
949426782 3:3926144-3926166 CAATTTACACATCTATAGAATGG - Intronic
949615152 3:5745525-5745547 CATTTAAGAAATCTGTAAACTGG + Intergenic
950366145 3:12485468-12485490 CACTTTCCACATCTGTACAATGG + Intronic
950911579 3:16600509-16600531 AACGTAAGACATTTTTAGAAAGG - Intronic
952647300 3:35676179-35676201 CAATAAAAACATCTGAAGAAAGG - Intronic
955346354 3:58164781-58164803 CACTTTCCACATCTGTAAAATGG - Intronic
955838551 3:63086071-63086093 CACTTAATTCATCTGTAAATGGG + Intergenic
956883434 3:73534486-73534508 CACTTAAGAGTTCTGGTGAAAGG + Intronic
957172881 3:76761646-76761668 CTCTTAAGAGATTTGCAGAAAGG + Intronic
957392491 3:79595050-79595072 AAATTAAGACCTCTGTGGAAAGG - Intronic
959998267 3:112701925-112701947 CACTTAAAAGAACTGCAGAATGG + Intergenic
960088401 3:113614556-113614578 AACTTATGACATGGGTAGAAAGG - Intronic
960520663 3:118651366-118651388 CCCTTAAAACTTCTGTAGAAAGG - Intergenic
960617739 3:119611901-119611923 CACTTTCTACATCTGTAAAATGG + Intronic
961481957 3:127186915-127186937 AAATTAAAAGATCTGTAGAATGG - Intergenic
963572182 3:147011832-147011854 AACTGAAAACATCTGTATAATGG - Intergenic
965679802 3:171238056-171238078 CACAGAAGACATCTGTTGGAGGG - Intronic
965679918 3:171239618-171239640 CACAGAAGACATCTGTTGGAGGG - Intronic
967349345 3:188494818-188494840 CACTTAAATCCTCTGTAAAATGG + Intronic
970300577 4:14677682-14677704 CAATTTAAACATCTATAGAATGG + Intergenic
970411878 4:15816814-15816836 GATTTAGGACATCTGGAGAAGGG + Intronic
970923385 4:21421578-21421600 CACACAAGAAAACTGTAGAATGG + Intronic
972380314 4:38513400-38513422 CACTTTCGTCATCTGTAAAATGG + Intergenic
972848735 4:43022472-43022494 TATTTATGTCATCTGTAGAATGG - Intronic
973671836 4:53227407-53227429 CATATAAGCCATCTATAGAAGGG + Intronic
974709865 4:65576553-65576575 CACTTTAGAGAACTTTAGAATGG + Intronic
974900483 4:67990715-67990737 CAGTTAAGGGATCTGCAGAATGG - Intergenic
975814845 4:78206765-78206787 CAGTTAAGTCATCTATAAAATGG - Intronic
975885744 4:78962643-78962665 TACTTAAAACATCAGAAGAAAGG - Intergenic
977320878 4:95514556-95514578 CACTAAAGAGATATATAGAAAGG - Intronic
982345891 4:154357911-154357933 CACCTGAGAAATCTGAAGAAAGG - Intronic
982447326 4:155508279-155508301 CCCTTAAGACATCTGTCACAGGG + Intergenic
982450279 4:155544489-155544511 CACTGAATACAGCTGTAGAGAGG + Intergenic
986677308 5:10197372-10197394 CACATAAGACATGTGTATTAGGG - Intergenic
990627641 5:57632473-57632495 CACATAGGACATCTAAAGAAAGG + Intergenic
994787981 5:104188058-104188080 CAGGTAAGTCATCTGTACAATGG - Intergenic
995027418 5:107439874-107439896 CACTTAATACAATTGTTGAAGGG - Intronic
995301492 5:110590015-110590037 CCATTAAGACATGTGTAGGATGG + Intronic
997840307 5:137233601-137233623 CACTTAAGACATGTATAGCAGGG - Intronic
997913676 5:137902149-137902171 GACATTAGACATCTGGAGAAGGG + Intronic
998055146 5:139068914-139068936 CACTAAAGACATTTGTTAAATGG + Intronic
998611343 5:143692801-143692823 AACTCAAGACATGTCTAGAAGGG + Intergenic
998680248 5:144459187-144459209 CACTTTTGTCATCTGTAAAATGG + Intronic
1000046048 5:157522831-157522853 CACTGGAGCCATCTGTAGACTGG - Intronic
1002454952 5:179340650-179340672 CAGTTTATTCATCTGTAGAAGGG + Intronic
1003348136 6:5290161-5290183 GACTTAAGACTTTTGTTGAAGGG - Intronic
1005392040 6:25343811-25343833 CACTTGAGACAGCTGAAGGAGGG - Intronic
1006438404 6:34038866-34038888 CAGTTAGGACATCTGGAAAATGG + Intronic
1008271117 6:49491388-49491410 CAGTAAAGACATATGTACAAGGG - Intronic
1008698154 6:54066024-54066046 CACCTAAGATAAATGTAGAAGGG - Intronic
1012894449 6:104932797-104932819 GATTTAAGAGATCTGTGGAATGG + Intergenic
1013822435 6:114171614-114171636 CACTTCATTCATCTGTAAAATGG - Intronic
1014625484 6:123719626-123719648 CACTTAAGTCATCAGCAGAATGG + Intergenic
1015332637 6:131998300-131998322 CACTAAAGATATTTGAAGAAGGG - Intergenic
1015382629 6:132587515-132587537 CACTTAAGAACACAGTAGAAAGG + Intergenic
1016514972 6:144883582-144883604 CACCCAGGACATCTGTTGAAGGG + Intergenic
1019363963 7:621768-621790 GAGTTAAGCCATCTGTAAAATGG + Intronic
1020005303 7:4780809-4780831 CATTGAAGACATCTTTTGAAAGG + Intronic
1022842861 7:34181359-34181381 CACTTGAGACATCAGCAGAATGG - Intergenic
1026640156 7:72117278-72117300 CACTTAAGAAGTCAGAAGAAAGG + Intronic
1027738410 7:81965684-81965706 CAGTTAACACATTTTTAGAAAGG + Intronic
1027822933 7:83070921-83070943 CATTTAAGAGATGAGTAGAATGG - Intronic
1028551512 7:92072887-92072909 CAGTTTACACATCTGTAAAATGG - Intronic
1030380047 7:108801103-108801125 CAATTAAACCATCTGTAAAAGGG + Intergenic
1030630626 7:111892112-111892134 CATTTGAGACATCCTTAGAAAGG + Intronic
1031034336 7:116771375-116771397 CAGTTATGCCATTTGTAGAATGG + Intronic
1034835761 7:154350558-154350580 CACTAAAGACATTTGAAGACGGG + Intronic
1035412059 7:158652549-158652571 CACTTAACACATGTATAAAATGG + Intronic
1036528544 8:9557808-9557830 CACTTTTGTCATCTGTAAAATGG - Intronic
1038163421 8:25061966-25061988 CAGTTAACTCATCTGTAAAATGG - Intergenic
1042533463 8:69836434-69836456 CACTTATCACATCTGTAAAATGG - Intergenic
1042585340 8:70331466-70331488 AACTGAAGAGATCTGTAAAAAGG - Intronic
1044074728 8:87805892-87805914 AACTCAAGATATCTGTAGATGGG + Intergenic
1046245102 8:111549286-111549308 AACTTAAGAAATATGTAGAAAGG - Intergenic
1048963398 8:139598012-139598034 CAGGTTGGACATCTGTAGAATGG - Intergenic
1050757829 9:9029817-9029839 TACTTAAGACTTCGGTAAAATGG + Intronic
1051471592 9:17448730-17448752 CACTTAAAACATCTTTAAATTGG + Intronic
1057195560 9:93114206-93114228 CATTAAAGGCATCTGTAGCAAGG - Intergenic
1059645266 9:116259687-116259709 CAATTAACACATCTGCACAAAGG - Intronic
1059927341 9:119223427-119223449 CACATAAGACTTCTGGAGAAAGG - Intronic
1060156674 9:121325205-121325227 TACTTAACACATATGTATAAGGG - Intronic
1060161146 9:121366019-121366041 CACTTAAGAGATTTGTATGAAGG - Intronic
1061906864 9:133703439-133703461 CACTTTCCTCATCTGTAGAAAGG - Intronic
1061994746 9:134177730-134177752 CAGTTTCCACATCTGTAGAATGG + Intergenic
1062440437 9:136567206-136567228 CACTCAAGTCTTCAGTAGAAAGG - Intergenic
1186561332 X:10616849-10616871 AACTTAAAACATCTGTTGAAAGG + Intronic
1188677298 X:32957455-32957477 AACTTAAGACATATGTATAGAGG + Intronic
1189422130 X:40865433-40865455 CCCTTAAGACATCTGCAAATAGG - Intergenic
1193334239 X:80268981-80269003 CTCTGAAAAGATCTGTAGAAAGG + Intergenic
1194305232 X:92237418-92237440 CATTTAACTCATCTGTAAAATGG + Intronic
1194625467 X:96221667-96221689 CACCTGAGGCATCTGCAGAAAGG - Intergenic
1194686628 X:96925782-96925804 GACTAAAAACATATGTAGAAGGG - Intronic
1196186236 X:112747811-112747833 CTCTTTACTCATCTGTAGAATGG + Intergenic
1197830046 X:130631922-130631944 CACTTTCCTCATCTGTAGAATGG - Intronic
1199115418 X:143986238-143986260 CAATTAAGACCTTTATAGAAAGG + Intergenic