ID: 902256729

View in Genome Browser
Species Human (GRCh38)
Location 1:15193953-15193975
Sequence TAGTTGGCTTAGCAGTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902256729 Original CRISPR TAGTTGGCTTAGCAGTAGAG TGG (reversed) Intronic
902256729 1:15193953-15193975 TAGTTGGCTTAGCAGTAGAGTGG - Intronic
911258403 1:95659147-95659169 GAGATGGCTTATGAGTAGAGAGG + Intergenic
913218379 1:116639432-116639454 TGGTTTGCTTAGGAGTAGGGAGG - Intronic
917610427 1:176683772-176683794 TAAGTGGCTTAGCCCTAGAGAGG - Intronic
917759954 1:178145824-178145846 TAGTTGGCTTAACTGAAGGGTGG - Intronic
918203500 1:182288872-182288894 AAGTTCACTTAGCAGAAGAGTGG - Intergenic
920636695 1:207711208-207711230 TAGCTGGCTTAGCAGCGGAGTGG + Intronic
1062777892 10:169655-169677 TGGTGGGCTTATCAGTAGACTGG + Intronic
1062891494 10:1064170-1064192 TGGATGGCTTAGCAGCAGAAAGG + Intronic
1065484472 10:26223929-26223951 TGGTTGGATTAGCAGCAGACTGG + Exonic
1069043913 10:63722800-63722822 CACTTGGCTTAGCAGTAGGGAGG + Intergenic
1072830626 10:98654500-98654522 TAGTAGGCTCATCAGTAGACTGG - Intronic
1075223815 10:120607328-120607350 TAGCTTGGTTAGGAGTAGAGTGG + Intergenic
1079121644 11:17689421-17689443 TAGATGTGTTAGGAGTAGAGAGG - Intergenic
1079689464 11:23403720-23403742 CAGTTGGCTGAGCAGCAAAGTGG + Intergenic
1084726104 11:70943244-70943266 GAGGTGGCTCAGCAGCAGAGAGG + Intronic
1093029764 12:14277455-14277477 TACTAGGCTTAGAAGTTGAGTGG - Intergenic
1093198093 12:16152850-16152872 TACCTGACTTAGCAGTACAGTGG + Intergenic
1094333155 12:29318660-29318682 TAGTTTGCTTTGCAGTAGGGGGG + Intronic
1098611349 12:72462347-72462369 TACTTTGCATAGGAGTAGAGAGG + Intronic
1100598464 12:96091843-96091865 GCATTGGCTTAGCAGTGGAGTGG - Intergenic
1102066813 12:109983885-109983907 TAGTTTCCTTATCAGTAAAGTGG - Intronic
1103937189 12:124482952-124482974 GAGTTGGCTCAGCACTAAAGGGG - Intronic
1106238635 13:27888422-27888444 TAGTTAAGTTAGCAGTAAAGTGG + Intergenic
1112317127 13:98372797-98372819 AAGTTTCCTTAGCAGAAGAGTGG - Intronic
1120621352 14:86768611-86768633 CATTTGGTTTAGCAGTAGGGAGG + Intergenic
1124932039 15:34129971-34129993 TATTAGGCTCAGCAGTGGAGGGG - Intergenic
1127802124 15:62485822-62485844 CAGTTGGCTTGGGAGTGGAGAGG + Intronic
1133703565 16:8332194-8332216 TGGCTAGCTTAGAAGTAGAGGGG - Intergenic
1138033344 16:53578717-53578739 TTGTTGAGTTAGCACTAGAGTGG + Intergenic
1140146068 16:72310277-72310299 TAGTTTCCTTTGCAGTACAGAGG - Intergenic
1140737629 16:77912221-77912243 CAGTTGCCTTATCAGTAAAGTGG + Intronic
1143339219 17:6195971-6195993 TATTGGTTTTAGCAGTAGAGTGG - Intergenic
1146242082 17:31239293-31239315 TAGTGGGCTTATCAGTAGTCTGG + Intronic
1147282312 17:39372074-39372096 TAAATGACTTAGCAGAAGAGAGG - Intronic
1154000442 18:10478130-10478152 TAGTTGGCTATGAAGCAGAGGGG - Intronic
1159279055 18:66260562-66260584 TGGCTGGCTTTGTAGTAGAGGGG - Intergenic
1164764784 19:30755965-30755987 TGGTTGGCGTAGCCGTTGAGAGG - Intergenic
925143598 2:1566508-1566530 TACTTGGTTTAGCAGTATAGTGG - Intergenic
925143667 2:1567068-1567090 TGGTTGGTTTAGCAGTATAGTGG - Intergenic
925143711 2:1567401-1567423 TAGTTGGTTTATCAGTATAGTGG - Intergenic
929914049 2:46118964-46118986 TAAATGGGTTAGAAGTAGAGGGG + Intronic
930533172 2:52615290-52615312 GAGGTGGCAGAGCAGTAGAGTGG + Intergenic
936466808 2:112760358-112760380 TAGTTTGCTTATCTGTAAAGTGG + Intronic
936796230 2:116207956-116207978 TTGTTGTCTTAGTGGTAGAGAGG + Intergenic
940517059 2:154696707-154696729 CAGTTGGTTTATAAGTAGAGAGG + Intergenic
940647301 2:156405086-156405108 TAGTTAGAATAGGAGTAGAGAGG + Intergenic
941613292 2:167688528-167688550 TAGGTGGCTTAACAATAGAATGG + Intergenic
941792938 2:169573168-169573190 TGTTTGGCATAGCCGTAGAGAGG - Intronic
947348166 2:229215165-229215187 TAGTTGGGTCTGCAGCAGAGGGG + Intronic
947570022 2:231226449-231226471 TAGTTGGCTTGGTAGCAGTGGGG + Intronic
1170977282 20:21176832-21176854 TGGTGGGCTTATCAGTAGATTGG + Intronic
1172239168 20:33400854-33400876 TAGCTGGCTTGGCAGCAGTGGGG - Intronic
1181932812 22:26416484-26416506 TAGTTGATTCAGCAGTGGAGTGG - Intergenic
1183247601 22:36705847-36705869 TAGGTGGCTTGGCAGTAGCTGGG - Intergenic
949832344 3:8229108-8229130 GAATGGGCTAAGCAGTAGAGTGG - Intergenic
950703867 3:14768210-14768232 TAGTTGGATCAGCAGTGCAGGGG + Intronic
953838572 3:46369209-46369231 TAGTTTTCTTAACTGTAGAGTGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958919614 3:100089993-100090015 TAGCTGGCTTTGCAGTTGCGGGG - Intronic
960474192 3:118104198-118104220 CAGAGGGCTTAGCAGAAGAGGGG + Intergenic
967989869 3:195122787-195122809 TTGGTGGCTCAGCAGCAGAGTGG + Intronic
971149907 4:24020960-24020982 CAGTTGGCTTAGCATTGGTGAGG + Intergenic
971628342 4:28954462-28954484 TAGTAAACTTAGCACTAGAGAGG - Intergenic
971920869 4:32937563-32937585 GAGTTGGCTTATCAGCATAGAGG + Intergenic
974005297 4:56550491-56550513 CAGGTGGCTGAGGAGTAGAGCGG + Intronic
983278738 4:165653081-165653103 AAGTTGGCTTAGCAGATAAGAGG - Intergenic
986437487 5:7748197-7748219 CAGATGGCTTAGCAGGAGGGCGG + Intronic
987594703 5:19982193-19982215 TATTTAGCTTAGCAATAGATGGG - Intronic
987783629 5:22470255-22470277 TAGTTGGCTTAAAAGAAGAATGG + Intronic
994735217 5:103545529-103545551 TGTTTGGCTGAGGAGTAGAGTGG + Intergenic
1003211477 6:4071857-4071879 TAGTTTATTTAGCAGGAGAGTGG - Intronic
1003257460 6:4487077-4487099 TATTTGGCTTTGCAGCAGAGAGG + Intergenic
1007383650 6:41505759-41505781 GAGGTGGCTCAGCAGTTGAGCGG + Intergenic
1010830697 6:80524825-80524847 TAGTTTTCTTATCAGTAAAGTGG + Intergenic
1011234017 6:85195401-85195423 TAATTAGGTTAGCAGCAGAGGGG + Intergenic
1012100231 6:95075351-95075373 TAATGGGCTCAGTAGTAGAGTGG - Intergenic
1016556583 6:145345630-145345652 TAGCTGGCTAAGCATTAGATAGG - Intergenic
1019195813 6:170282169-170282191 TACTTGGCTTTGCCTTAGAGCGG - Intergenic
1026112007 7:67465845-67465867 TACTTGGCTCAGCAGGATAGAGG + Intergenic
1027738522 7:81968044-81968066 TAGGTGGGTTAGTAGGAGAGTGG + Intronic
1028929770 7:96399557-96399579 TATTAGGCTGAGCAGTAGAAAGG + Intergenic
1030765766 7:113407927-113407949 TTCCTGGCTTAGCAGTTGAGTGG - Intergenic
1032100792 7:128975451-128975473 TAGTTTACTTAGCAGCAGGGAGG - Intronic
1032976241 7:137226582-137226604 CAGTTGGCTTTGATGTAGAGGGG + Intergenic
1034015374 7:147578250-147578272 AAGTTGGCTTTGCAGGAGATTGG + Intronic
1037929291 8:22868118-22868140 TAGCTGCCTTGTCAGTAGAGAGG + Intronic
1038324204 8:26560112-26560134 GAGTTGGTTTAGCAGAAGACAGG + Intronic
1038874704 8:31535429-31535451 TAATTGATTTAGCAGTAGAAGGG - Intergenic
1039202094 8:35106500-35106522 TAGTAGGGTTGGCAGTAGGGTGG + Intergenic
1049250153 8:141583904-141583926 AAGTGGGCTTGGCAGCAGAGCGG + Intergenic
1056604595 9:88076446-88076468 AGGTTGGCTTAGGAGTAGAGGGG - Intergenic
1056689731 9:88797741-88797763 GAGTAGGCTCAACAGTAGAGTGG - Intergenic
1057449083 9:95140574-95140596 AAGCTGTCTGAGCAGTAGAGGGG + Intronic
1057607359 9:96509004-96509026 TAGATGGCTCAGGAGTAGAAGGG - Intronic
1060189592 9:121583609-121583631 TTGTTGGCTAAACTGTAGAGGGG - Intronic
1061478033 9:130882132-130882154 CAGGTGGCTGAGCAGTAGGGAGG + Intronic
1061866059 9:133492270-133492292 TAGTTGGCTGAGTCCTAGAGCGG - Intergenic
1188854337 X:35173968-35173990 TGGTTTGCTTTACAGTAGAGAGG + Intergenic
1191218483 X:57959315-57959337 AAGTTGTCTCAGCACTAGAGAGG + Intergenic
1193149368 X:78108632-78108654 TAATTGCCTTAGCCTTAGAGAGG + Intronic
1201595127 Y:15659788-15659810 TTGTGTGCCTAGCAGTAGAGAGG + Intergenic