ID: 902259891

View in Genome Browser
Species Human (GRCh38)
Location 1:15216877-15216899
Sequence CTGTGGGATTGGAGAGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 540}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902259883_902259891 -6 Left 902259883 1:15216860-15216882 CCCATCAAATGTTGTGGCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG 0: 1
1: 0
2: 1
3: 49
4: 540
902259885_902259891 -7 Left 902259885 1:15216861-15216883 CCATCAAATGTTGTGGCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 146
Right 902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG 0: 1
1: 0
2: 1
3: 49
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902259891 Original CRISPR CTGTGGGATTGGAGAGGGGT AGG Intronic
901490731 1:9595138-9595160 CTGGGGGACTGGGGAGGGGTGGG - Intronic
901796199 1:11681013-11681035 CTGGGGGAGGGGAGAGGGGGCGG - Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903378651 1:22882246-22882268 CTGTGGGATCAGAGAGGGAAGGG - Intronic
903591558 1:24459953-24459975 CTGTGGTATGGGAGTGGGGTGGG - Intronic
903995288 1:27301538-27301560 TTCTGGGATTGGAGAGGCCTGGG + Intronic
904326465 1:29729758-29729780 CTGTGGGGTGAGAGAGGTGTGGG + Intergenic
904598368 1:31660698-31660720 CTGTCGGATGGGAGGGGGCTGGG + Intronic
905224674 1:36471544-36471566 CTGTGGTGTTGCAGAGGGGCAGG + Exonic
905423336 1:37863170-37863192 CTGCAGGATGGGAGAGGGCTGGG - Intronic
905662131 1:39735749-39735771 AGGTGGGAATGGAGAGGGGCTGG + Intronic
905866836 1:41381372-41381394 GTGTGGGAGTGGGGAGGGATGGG + Intronic
906542677 1:46599973-46599995 TTGTGGGAGGGGAGAGGAGTTGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907855686 1:58301220-58301242 ATGTGGGGGTGGAGAGGGGGGGG + Intronic
909648424 1:77943432-77943454 TATTGGGATTGGAGCGGGGTGGG + Intronic
910718575 1:90259131-90259153 GTGTGGGATGGTAGAGGTGTGGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912858642 1:113193539-113193561 CTGTGGGAGAGAAAAGGGGTGGG - Intergenic
913472617 1:119204453-119204475 CTGTGGGAATAGAGTAGGGTTGG - Intergenic
914676182 1:149909124-149909146 GTGTGGGCTGGGAGAGAGGTGGG - Intronic
915066952 1:153232622-153232644 CTGCAGGATTGGAGTGGGGCAGG - Intergenic
915562834 1:156697461-156697483 GTGCGGGATTGGAGAGGTGAGGG - Intergenic
916006372 1:160664901-160664923 CAGAGGAAGTGGAGAGGGGTTGG - Intergenic
916208752 1:162341129-162341151 CTATGGGATTAGACAGGGGTAGG - Intronic
916555555 1:165891488-165891510 CTGTGGGATTGTAGAGGTTGGGG + Intronic
916872138 1:168927232-168927254 CTGTTGGGGTGGGGAGGGGTGGG - Intergenic
916882225 1:169030365-169030387 CTGTGGAATTGGGGAGATGTTGG + Intergenic
917459205 1:175214573-175214595 CTGTGGCAGGGGACAGGGGTGGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
919973877 1:202598586-202598608 CTGGGGGCTTGCAGAGTGGTCGG - Intronic
920081434 1:203376538-203376560 CTATGGGATTGAAGAGAGTTAGG + Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
921055768 1:211541403-211541425 CTGAGGGATTGTCGAAGGGTGGG - Intergenic
921153303 1:212418614-212418636 TTGTGGGATAGGATAGGGGTGGG + Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
921285408 1:213604835-213604857 CTGTGGGTCTGGGGAAGGGTGGG + Intergenic
922184649 1:223263506-223263528 CTGGGGGATTTGCGATGGGTGGG + Intronic
922189735 1:223307611-223307633 CGGGGGGATTGGAGATGGGGAGG + Intronic
922589387 1:226762787-226762809 CTGTGGGAAGGGATATGGGTGGG + Intergenic
922696136 1:227731973-227731995 CTGTGGGTTCAGGGAGGGGTTGG - Exonic
922718420 1:227888413-227888435 CTGTTGGGTAGGAGAAGGGTCGG + Intergenic
922965410 1:229686868-229686890 CTGTGACATAGGAGAGGGGTGGG + Intergenic
923092648 1:230751848-230751870 CTGTGGGGTGGGGGAGGGGAGGG + Intronic
923098201 1:230792337-230792359 CTCTGGGACTGCAGAGGGGGAGG - Intronic
923109454 1:230879584-230879606 CAGGGTGATTGGAGAGGGGGAGG - Intergenic
923738639 1:236635498-236635520 CTGTTGGAATGGAGAGGGTATGG + Intergenic
1063428331 10:5966609-5966631 CTGAGGGCTTGGAGAGGGGTGGG - Intronic
1064218138 10:13417592-13417614 CTGTGGGATAGCACAGGGGCAGG + Intergenic
1065815848 10:29481729-29481751 CTGTAGGGTGGGAGGGGGGTTGG + Intronic
1067058648 10:43066549-43066571 CTGTAGGATGGGAGAGGGACAGG - Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068627523 10:59265286-59265308 CTGAGGGATGGCAGAGGGATAGG + Intronic
1069710300 10:70483561-70483583 CCATGGGAGGGGAGAGGGGTGGG + Intronic
1070565831 10:77603299-77603321 CTGAGGGGGTGGAGATGGGTGGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1072174328 10:92901890-92901912 CTGGGGGGTTGGTGGGGGGTGGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073141994 10:101254226-101254248 CTAGGGGATGGGGGAGGGGTGGG + Intergenic
1073245829 10:102089258-102089280 TTGAGGGAGTGGATAGGGGTAGG + Intergenic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1074179925 10:111050919-111050941 CTGTGGGAATGGACAGGCATTGG + Intergenic
1074476936 10:113781835-113781857 CTGTGGGGTTGAAGAGAGGCAGG - Intronic
1074527676 10:114276219-114276241 TGGTGGGAGTGGGGAGGGGTGGG - Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075700965 10:124469181-124469203 AAGTGTGATTGGAGTGGGGTGGG + Intronic
1075815443 10:125261305-125261327 GTTTGGGATTGGAGGGGAGTTGG + Intergenic
1076150222 10:128155862-128155884 CTCTGGGATTGGAGAAGGGAAGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076495594 10:130895532-130895554 CTGTGGGACAGGAGAGGTGGGGG + Intergenic
1076640220 10:131910819-131910841 CTCGGGGAGTGGTGAGGGGTGGG + Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1076844539 10:133062798-133062820 CAGTGGGATTGGGGAGGGAGGGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077144822 11:1040148-1040170 CTGTGGGTTTGGGGAGTGTTTGG + Intergenic
1077253478 11:1570993-1571015 CTGTGGGATGGAGGAGGGGGTGG - Intronic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077423911 11:2465643-2465665 GGGTGGAATTGGAGAGGGGAGGG + Intronic
1077831662 11:5878964-5878986 CTTGGGAATAGGAGAGGGGTAGG + Intronic
1077894814 11:6446290-6446312 CTGTAGGGTTGGAGCAGGGTGGG - Intergenic
1078518700 11:12046720-12046742 CTGGAGGGTGGGAGAGGGGTTGG + Intergenic
1078893636 11:15579271-15579293 CATTAGGATTGGAGTGGGGTTGG - Intergenic
1079168926 11:18073476-18073498 CTGTGGGATTACAGAAGGGTAGG - Intronic
1079224679 11:18595247-18595269 CTGGGGGCTTGGACAGGGGTGGG + Intergenic
1079807898 11:24957895-24957917 TTGTGGGGTTGGGGAGGGGAGGG - Intronic
1079947021 11:26756839-26756861 CTGTGGGGTTGAGGAGAGGTTGG - Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1082009162 11:47438699-47438721 CTGGGGGGGTGGACAGGGGTGGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083265290 11:61543947-61543969 CAGTGGTCTTGGGGAGGGGTTGG + Intronic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083742062 11:64716359-64716381 CTGTGGGAAAGGCGAGGGGCAGG + Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1085127470 11:74011384-74011406 CTGTGGTGCTGGGGAGGGGTGGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085826968 11:79858127-79858149 CTTTGGGGGTGGAGAAGGGTGGG + Intergenic
1085850851 11:80117928-80117950 ATGTGGCATTGGAGAGGAGCTGG - Intergenic
1086068751 11:82775864-82775886 CTGGGTGATGGGTGAGGGGTTGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087576556 11:99996998-99997020 ATGTGAGATTTGGGAGGGGTCGG - Intronic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089541991 11:119194836-119194858 CTGGGGGATTGGAGAGTTGGAGG - Intronic
1089760195 11:120717443-120717465 CTTAGGGATTGGAGAAGGATGGG + Intronic
1089878408 11:121748218-121748240 CTGTGGGATTGCAAAAGGGATGG - Intergenic
1090109250 11:123887052-123887074 ATATGGGATTGGTGAAGGGTGGG - Intergenic
1091404641 12:201621-201643 GTGTGGGGTTGGAGTGGGGCGGG + Intronic
1091587628 12:1825229-1825251 CTGAGGGATGGGAGAGGGTGAGG + Intronic
1093165979 12:15804735-15804757 CTGTGGGGTTGTTGAGGGGAAGG - Intronic
1094813512 12:34163544-34163566 CTGTGTGATGGGGGTGGGGTGGG + Intergenic
1095397409 12:41776601-41776623 CTGGGGGAGTGGAGAAGGGCTGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095915330 12:47472380-47472402 CTGGCGGATTGGCCAGGGGTTGG - Intergenic
1096243586 12:49972458-49972480 CTGTGGGGTTGCAGAGGGGCGGG - Intronic
1096403107 12:51323824-51323846 CTGGCAGATTGGAGAGAGGTCGG - Intronic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097128287 12:56790563-56790585 CTGTGGGAAGGGAGAGGGAGAGG + Intergenic
1097282396 12:57852950-57852972 CTAGGGGATTGGAGAGGTGGGGG - Intergenic
1097317130 12:58183501-58183523 CTGGGGGATTGAAGAGGGATAGG + Intergenic
1098390906 12:69969022-69969044 AGGTGGGATTTGAGAGTGGTGGG - Intergenic
1099983445 12:89634159-89634181 TTCTGGGATTGGAGAAGGGAAGG - Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101308641 12:103555878-103555900 GTGTGGAAGTGGAGTGGGGTGGG - Intergenic
1101818837 12:108167385-108167407 TTGAGAGATTGGAGTGGGGTGGG - Intronic
1101846160 12:108364808-108364830 CTGTGGGAGTTAAGAGAGGTAGG - Intergenic
1102074289 12:110047833-110047855 CTCTGGGAAAGAAGAGGGGTGGG + Intronic
1102563330 12:113778433-113778455 GTGTGTGGTGGGAGAGGGGTGGG + Intergenic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1103899859 12:124297824-124297846 CTGTGGGGTGGGCGATGGGTGGG - Intronic
1104313538 12:127675986-127676008 CTTTGAGATTGGAGAGGGCAAGG - Intergenic
1104805190 12:131585454-131585476 TTGTGGGATGGGGGAGGGGGAGG + Intergenic
1104823415 12:131692215-131692237 CTCCGGGGTTGGAGAGGGGAGGG + Intergenic
1104859539 12:131917172-131917194 CTGTGGGATGGGGGTCGGGTGGG + Intronic
1106295312 13:28408290-28408312 GTGTGGGATGGGGGAGGTGTGGG - Intronic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1107350962 13:39514332-39514354 CTCTGGATGTGGAGAGGGGTTGG - Intronic
1107463529 13:40628486-40628508 CTTTGGGACTGGGGAGGGGAAGG - Intronic
1108256073 13:48612153-48612175 CTGTGGGATAGGGGAAGGGGTGG + Intergenic
1108473518 13:50790641-50790663 CTGTGGGATGCGAGGGGTGTGGG + Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108703133 13:52960468-52960490 CTGAGGGGTTTGAGGGGGGTGGG + Intergenic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1112201067 13:97275143-97275165 ATGTGGACTTGGAGATGGGTAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113253878 13:108485998-108486020 GCCTGGGATTGGGGAGGGGTTGG - Intergenic
1114230913 14:20781820-20781842 CTGTTGCATTGGAGAGGACTTGG - Exonic
1114234502 14:20812657-20812679 CTGTGGGGTGGGGGTGGGGTGGG - Intergenic
1114269340 14:21091603-21091625 CTATGGGATGGGTGTGGGGTGGG - Intronic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114486738 14:23067405-23067427 CTGTGCAATTGGTGGGGGGTTGG + Intronic
1114683123 14:24503728-24503750 TTGTGGGGTTGGGGGGGGGTAGG + Intronic
1115478782 14:33841567-33841589 CTGCTGGAATGGAGAGGGGCAGG - Intergenic
1115519022 14:34214334-34214356 CTATGGGATTGGAGAAAGCTTGG - Intronic
1116214778 14:41999995-42000017 CTGTGTGAATGGGGAAGGGTGGG + Intergenic
1116986561 14:51226121-51226143 CTGATGGATAGGACAGGGGTTGG - Intergenic
1117944923 14:61009529-61009551 CTGTGGGGTGGGGGAGGGGGAGG - Intronic
1118315405 14:64722892-64722914 CTGTGGGATAGGGGAGGAGCAGG + Intronic
1118487118 14:66224712-66224734 TTGTGGTATGGGAGAGGGGCAGG + Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119208485 14:72812246-72812268 CTGTGGGATGGGAGAGGCTGGGG - Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1119458810 14:74780739-74780761 CTGGGGGACTGGGGAGGGGTTGG + Intronic
1119636554 14:76278071-76278093 AGATGAGATTGGAGAGGGGTAGG + Intergenic
1119937154 14:78602598-78602620 CTGCGGGACTGGAGAGGTCTTGG - Intronic
1121225722 14:92320495-92320517 CTGTGGGGTTGGGGAGGGGGCGG + Intergenic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121742183 14:96261912-96261934 TTGTGGGATCGCAGAGGGCTGGG + Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1121981666 14:98459926-98459948 ATGTGGGAGTGAAGTGGGGTAGG - Intergenic
1122484152 14:102066650-102066672 CTGTGGTAGTGCAGAGGGGTTGG - Intergenic
1123938951 15:25207495-25207517 GTGTGTGCTTGGAGAGGGGCAGG + Intergenic
1124207112 15:27730521-27730543 CCTTGGGAATGGGGAGGGGTGGG - Intergenic
1124624171 15:31298836-31298858 CTGTGGGATGGGCAAGGAGTGGG - Intergenic
1124633446 15:31350251-31350273 CTTTGGGATTGGGGAGGGAGGGG + Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128499258 15:68215893-68215915 CAGTGGGACAGGAAAGGGGTAGG + Intronic
1129158691 15:73734808-73734830 CTGTGGAATGGGAGATGGGTGGG + Intergenic
1129482715 15:75840776-75840798 CTCTGTGATTGGTTAGGGGTGGG + Intergenic
1129660484 15:77550322-77550344 GTGTGGCTTTGGGGAGGGGTGGG + Intergenic
1130128788 15:81118466-81118488 TTGTGGGACCGGAGCGGGGTGGG + Intronic
1131158747 15:90090840-90090862 CTGGGGCTTTGGAGAGAGGTTGG + Intronic
1131278419 15:91001618-91001640 CTGTGGGTGGGGAGAAGGGTGGG - Intronic
1132789640 16:1678438-1678460 GTGTGGGGTTGGGGTGGGGTTGG + Intronic
1132827059 16:1910359-1910381 CTGTGAGCTCGGAGAGGCGTAGG - Intergenic
1132958011 16:2606641-2606663 GTGGGGGTCTGGAGAGGGGTTGG + Intergenic
1133225800 16:4339849-4339871 CTGCGGCTTTGGAGAGTGGTGGG + Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1134537188 16:15035426-15035448 CTGCGGGAGAGGAGAGGGCTGGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1136221681 16:28833351-28833373 CTGAGTGAGTGGAGCGGGGTGGG + Exonic
1138367055 16:56488723-56488745 CTGGAGGTTGGGAGAGGGGTGGG + Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139559176 16:67730772-67730794 CAGCAGGCTTGGAGAGGGGTAGG + Intronic
1141039204 16:80656801-80656823 CAGTGGGGTGGGAGAGGGGAGGG + Intronic
1141678277 16:85529175-85529197 GTGTGGGACTGGAGTGGGGGTGG + Intergenic
1141804245 16:86332274-86332296 CTCTGGGTTGGGAGAGGGGCTGG - Intergenic
1142228427 16:88888489-88888511 GGGTGGGGTTGGGGAGGGGTGGG + Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1143768176 17:9151115-9151137 CTGGGGGAAGGGACAGGGGTGGG - Intronic
1143847411 17:9783010-9783032 CTGTGGTATTGGAGAGATGGAGG + Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144462376 17:15468464-15468486 CTCTGGGATTGGAGAGGTGGTGG - Intronic
1144754275 17:17669810-17669832 CTGTGGGATGGGGGTGGGGAGGG - Intergenic
1147371782 17:39997583-39997605 CTGGGGGGCTGGGGAGGGGTAGG + Exonic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1148158996 17:45439421-45439443 CTGTGGGTGTGGGGAAGGGTGGG + Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148554186 17:48568041-48568063 CTGTGCAATTGGAAAGGGATGGG - Intronic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148807712 17:50272579-50272601 CTGTGAGCTTGGAGAAGGGAAGG - Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149751752 17:59153420-59153442 GTGTGGGGTTGGAGAAGTGTAGG - Intronic
1150227475 17:63531761-63531783 CTGTTAGACTGGAGAGTGGTCGG + Intronic
1150390349 17:64786511-64786533 CTGTGGGTGTGGCGAAGGGTAGG + Intergenic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151379752 17:73717570-73717592 CTGTGGGATCGGTGGGGGGAGGG - Intergenic
1151478118 17:74355114-74355136 CTGGGTGATGGGAGAGGAGTTGG + Intronic
1152102671 17:78311784-78311806 TTGTGGGATTGGAAAGTGGAAGG - Intergenic
1152150784 17:78599670-78599692 CTGTGAGATTGGAGGTGGGGGGG - Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152933074 17:83120124-83120146 CTGGGGGGTTGGGGAGGGATTGG + Intergenic
1153693862 18:7620420-7620442 CTGTGGCAGAGAAGAGGGGTCGG - Intronic
1154432306 18:14317641-14317663 TTCATGGATTGGAGAGGGGTTGG + Intergenic
1155439910 18:25851580-25851602 CTTTGGGGTTGGAGAGGTCTGGG - Intergenic
1155853073 18:30796739-30796761 CTGTGGCAGTGTGGAGGGGTGGG - Intergenic
1156601621 18:38614248-38614270 ATCTGGGGTTGGAGATGGGTAGG - Intergenic
1157416891 18:47510862-47510884 TTGGGGGATTGGAGAGGGACAGG + Intergenic
1157482017 18:48061010-48061032 GGGTGGGATTGGACAGTGGTAGG + Intronic
1159078393 18:63707433-63707455 CAGTGGGATTGAAGATGGGCAGG - Intronic
1159543492 18:69811310-69811332 CTGATGGATTGGGGAGAGGTTGG + Intronic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1160514724 18:79472048-79472070 CTGTGGCATCGGAGAGGTGTTGG + Intronic
1160565520 18:79784557-79784579 CAGTGGGAGGGAAGAGGGGTTGG - Intergenic
1160669174 19:348637-348659 CTGTAGGATTGGAGGCGGCTTGG + Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161329806 19:3681129-3681151 ATGTGGGATGGGAGTGGGGGCGG + Intronic
1161522109 19:4730383-4730405 CTGAGTGATTGGATATGGGTGGG - Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162954621 19:14091072-14091094 CGGGGGGAGTGGAGAGGGGGCGG + Intergenic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165132645 19:33642195-33642217 CTCTGGGACTGCAGATGGGTGGG + Intronic
1165186302 19:34025370-34025392 CTTTGGGTTTGGAGATGGGAGGG - Intergenic
1165307964 19:35013697-35013719 CGGTGGGTTGGAAGAGGGGTGGG + Intronic
1165404118 19:35619590-35619612 CTGTGGGGAAGGGGAGGGGTGGG - Intronic
1165938526 19:39403515-39403537 CTGTGGGTTTGGGGAGGTGGAGG + Intergenic
1166147486 19:40847608-40847630 GTGTGTGATTGGAAAGGGTTGGG + Intronic
1166151632 19:40879493-40879515 GTGTGTGATTGGAAAGGGTTGGG + Intronic
1166170515 19:41024992-41025014 GTGTGTGATTGGAAAGGGTTGGG + Intergenic
1166178548 19:41091152-41091174 GTGTGTGATTGGAAAGGGTTGGG - Intronic
1166366676 19:42281476-42281498 CTGTGGAGTTGGTTAGGGGTTGG + Intronic
1166657492 19:44622959-44622981 CTGTGGGGTTGGACTGGGGGTGG - Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167470590 19:49673602-49673624 CTGTGAGATTAGAGACGGGAAGG - Intronic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168041965 19:53765894-53765916 CTTTCGGAATGGAGTGGGGTGGG + Intergenic
1168364620 19:55775546-55775568 TTGTGGTTTTGGAGAGGGGGGGG - Intergenic
925411031 2:3640431-3640453 CTGTGGGATGTGACAGGGGTGGG - Intronic
925411039 2:3640460-3640482 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411086 2:3640607-3640629 CTGTGGGATGCGACGGGGGTGGG - Intronic
925411095 2:3640636-3640658 CTGTGGGATGTGACGGGGGTGGG - Intronic
925411142 2:3640783-3640805 CTGTGGGATGTGACGGGGGTGGG - Intronic
925942931 2:8837415-8837437 CCGCGGGATTGGGGAGGAGTCGG - Intronic
926307828 2:11651969-11651991 ATGTGGCAGTGGAGAGGGCTTGG + Intergenic
926392585 2:12408779-12408801 CTGTAGGATTGTATATGGGTGGG + Intergenic
926803856 2:16686358-16686380 CTGAGGGATTGTAGAAGGGATGG + Intergenic
927431605 2:23031150-23031172 TTTTGGGATTGGGGTGGGGTGGG - Intergenic
928992917 2:37254734-37254756 CTCTAGCATTGGAGCGGGGTGGG - Intronic
929426249 2:41847269-41847291 GTGGGGAATTGGAGAGGGGGTGG + Intergenic
929552710 2:42904570-42904592 CTGGGGGCTTGGAGTGGGGCAGG + Intergenic
929587777 2:43126997-43127019 ATGTGGGATGGGAGCGGGGTGGG + Intergenic
930218920 2:48726016-48726038 CTGTGGTGGGGGAGAGGGGTGGG - Intronic
930347002 2:50196119-50196141 CTGTGGGGGTGGTCAGGGGTAGG - Intronic
931547523 2:63406128-63406150 GTGCTGGATTGGGGAGGGGTGGG + Intronic
932453669 2:71832269-71832291 CAGTGGCATTGCAGAGGGGCAGG - Intergenic
936655165 2:114476691-114476713 CTGTGGGACTGGTGATGGCTTGG + Intronic
939629487 2:144516248-144516270 CTGGGGGAGGGGAGAGGGCTGGG - Intronic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
940109727 2:150138225-150138247 GTGTGGGATGGAAGTGGGGTGGG + Intergenic
940176181 2:150879883-150879905 CTGTGGGATTTTAGGGGGTTGGG - Intergenic
942955359 2:181766775-181766797 TTGTGGGGTTGGGGAGGGGGAGG - Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943484836 2:188465834-188465856 CTGAGGGATGGCGGAGGGGTGGG + Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945712905 2:213322756-213322778 ATGTAGGATTGGTAAGGGGTGGG + Intronic
945876327 2:215281805-215281827 CTGGGGCATTTGAGAGGGGCTGG - Intergenic
946137274 2:217657554-217657576 CTGTGGGCTTGGCGAGAGCTGGG - Intronic
946407551 2:219499807-219499829 GTGTGGGATTTGTGAGGTGTTGG + Intronic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
947532822 2:230923599-230923621 CTGGGGGGTTGGAGTGGGGCTGG + Intronic
948030647 2:234814710-234814732 CAGTGGGGTGGGACAGGGGTGGG + Intergenic
948569086 2:238906133-238906155 CTGGGGGTTGGGAGAGGGCTGGG + Intronic
949018460 2:241726766-241726788 CTGTGAAACTGGAGATGGGTGGG + Exonic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168831409 20:847054-847076 CGGTGGGCGTGGAGAGGGGGTGG + Intronic
1169016286 20:2295415-2295437 CTTTGTGAGTTGAGAGGGGTGGG + Intergenic
1170958832 20:21006923-21006945 CTGAGAAATTTGAGAGGGGTTGG + Intergenic
1171411010 20:24949184-24949206 CTGTGGGATGGGGCAGGGGCGGG - Intergenic
1171415680 20:24979168-24979190 CTGAGGCATTGGATGGGGGTGGG - Intronic
1172613409 20:36267689-36267711 CTGTGGGAGGGGAGCTGGGTGGG - Intronic
1172930597 20:38583734-38583756 CGGAGGGGTTGGAGTGGGGTAGG - Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173231304 20:41201049-41201071 CTGTGGGATTTCTGAGGGATAGG + Intronic
1173705555 20:45107925-45107947 CTGAGGTCTTGGAGAGGGGAAGG - Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174069935 20:47892575-47892597 CAGTGAGATAGGAGAGGGGCAGG - Intergenic
1174182268 20:48682328-48682350 GTGATGGATTGGATAGGGGTCGG - Intronic
1174689852 20:52493118-52493140 CTGTGTGTTTGGGGACGGGTAGG + Intergenic
1175198504 20:57262934-57262956 CAGTAGGGTTGGAGAGGGTTGGG - Intronic
1175345930 20:58275834-58275856 CTGGGAGATTGGAGAGGAATGGG + Intergenic
1175523471 20:59618007-59618029 CTGCGGGCTTGTGGAGGGGTTGG + Intronic
1179921966 21:44512333-44512355 CTGTGGGGGTGGGGTGGGGTGGG + Intronic
1179935708 21:44602341-44602363 CTGAGGGATGGGAGAGGTGAGGG + Intronic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182146208 22:27998442-27998464 CAGTGGGGTTGGGGAGGGGAGGG - Intronic
1182740427 22:32563539-32563561 TTCCGGGATTGGAGAGTGGTTGG + Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1183597154 22:38819437-38819459 CTGTGGGCTGGGAAAGGGGTCGG + Exonic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1183945726 22:41324738-41324760 ATGTGGGATTGGGCAGGGGAGGG + Intronic
1184406734 22:44304737-44304759 CTGTGGGAGTGGAGAGTGACGGG + Intronic
1184559743 22:45255278-45255300 CTGTGGGAGTGAAGAAGGGGAGG + Intergenic
1184648103 22:45907018-45907040 CTCCGGGCTGGGAGAGGGGTGGG + Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184796373 22:46735720-46735742 CTGGGGGAATGGGGAGGGCTGGG + Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
1184846326 22:47090078-47090100 CTGTGGGGTCCCAGAGGGGTGGG + Intronic
1185042287 22:48511257-48511279 CTGTGGGATTCCAGACTGGTTGG - Intronic
1185237803 22:49724913-49724935 CTGTGGGACCGGCCAGGGGTGGG - Intergenic
1185360403 22:50403473-50403495 CTGTGGGATGTCAGAGGGGCTGG - Intronic
949919529 3:8990331-8990353 CCGTGGGAGTGGAGACTGGTTGG - Intronic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950443498 3:13023185-13023207 CTGTAGGGATGGAGTGGGGTGGG + Intronic
950569616 3:13791967-13791989 CTGTGGGCCTGAAGAGGGGCTGG + Intergenic
950675826 3:14553882-14553904 GTGAAGGAGTGGAGAGGGGTCGG + Intergenic
950774371 3:15336959-15336981 CTGTGGGATTGAACCAGGGTTGG - Intronic
950948590 3:16976226-16976248 ATGTGTGTGTGGAGAGGGGTTGG + Intronic
951052067 3:18105056-18105078 GTGTGTGCTGGGAGAGGGGTAGG + Intronic
952720011 3:36522817-36522839 CTTGGGGATTGGAGAGAGGCTGG + Intronic
952936612 3:38403599-38403621 GTGTGGGATAGGGGAGGGATAGG - Intronic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953669990 3:44954187-44954209 GAGTGGGATTCAAGAGGGGTCGG + Intronic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
954225046 3:49175894-49175916 CTGTGGGATGAGAGAGGCATGGG + Exonic
955479142 3:59371521-59371543 CTATGGCTTTGGAGAGGGGTGGG - Intergenic
956181102 3:66518888-66518910 CTGTGGTATTGTCTAGGGGTGGG + Intergenic
956286966 3:67620782-67620804 CTCTGGGGTAGGAAAGGGGTTGG + Intronic
956644000 3:71438884-71438906 CAGTGGGGTTGGGGAGGGCTGGG - Intronic
956674656 3:71722778-71722800 GTGTGGGTATGGGGAGGGGTTGG + Intronic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957670272 3:83292240-83292262 TTGTGGGGTAGGAGAGGGGAGGG + Intergenic
957824495 3:85423069-85423091 ATGGGGAATTGGAGAGGGGATGG + Intronic
960552550 3:118992547-118992569 CTTGGGGATTGGAGTGAGGTTGG - Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960844983 3:121996842-121996864 CTGTAAGAGTGGAGAGGGGATGG - Intronic
961061562 3:123833072-123833094 CTGTGGGACTGTAATGGGGTGGG - Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961451014 3:127002327-127002349 CTGTCGGCTGGGAGAGGGGGAGG - Intronic
961668693 3:128510666-128510688 ATGTGGGAATGGTGAAGGGTGGG - Intergenic
961726829 3:128936248-128936270 CTGTGTGCTTGGTCAGGGGTAGG + Intronic
961824551 3:129592250-129592272 CTGCAGGATTGCTGAGGGGTGGG - Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962600598 3:136988191-136988213 GTCTTGGATTGGAAAGGGGTGGG - Intronic
963030694 3:140972310-140972332 TTGGGGAATTGGATAGGGGTGGG + Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
964250656 3:154712213-154712235 TGGTGGGATTGAAGGGGGGTTGG + Intergenic
966413438 3:179666136-179666158 CTGTGGGATGTGAAAGAGGTTGG + Intronic
967893823 3:194381986-194382008 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893866 3:194382088-194382110 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893887 3:194382139-194382161 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893909 3:194382190-194382212 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893931 3:194382241-194382263 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968276899 3:197446967-197446989 CTGTGGCATAGGAGATGGGCTGG + Intergenic
968529198 4:1081322-1081344 CTGGGGGCTTGGAGAGGGGGTGG + Intronic
969112360 4:4851973-4851995 CTGAGGGACTGGGGAGGGGAGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969333285 4:6492329-6492351 CTGTGGGGTTGGCCATGGGTAGG - Intronic
969348212 4:6582219-6582241 CAGTGGGAAGGGAGTGGGGTTGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969504511 4:7576481-7576503 CTGTGGGACTGAGAAGGGGTTGG + Intronic
969578117 4:8048242-8048264 TTGTGCGATTGGAGTTGGGTAGG - Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
970203502 4:13632969-13632991 CTGGAGGATTGGGTAGGGGTGGG - Intergenic
971047825 4:22825766-22825788 GGGTGGGAGTGGAAAGGGGTTGG - Intergenic
971721790 4:30255003-30255025 CTGTGGGATTGGAGTGGTAGAGG + Intergenic
971929113 4:33055592-33055614 TTGTGGGGTTGGGGTGGGGTGGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
974368567 4:60985323-60985345 CTGAGGGAGGGGTGAGGGGTGGG - Intergenic
975650155 4:76584938-76584960 ATGTGGGATAGGAATGGGGTGGG - Intronic
975718362 4:77227284-77227306 CTGTGGGAGGGGATAGGGGGTGG + Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976380366 4:84391856-84391878 CTGTGGGTTTCCAGAGGGATTGG - Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978443592 4:108759710-108759732 TAGTGGGAATGGGGAGGGGTGGG + Intronic
979669388 4:123346314-123346336 CTGGGGGGGTGGAGAGGGGTTGG + Intergenic
981306156 4:143248837-143248859 CTTAGGGATGGGAGACGGGTTGG + Intergenic
982338689 4:154270461-154270483 CTGTGGGCTAGGAAAGGGCTTGG + Intronic
983472916 4:168178527-168178549 ATGTGGGATTGGGGTAGGGTAGG - Intronic
983647699 4:170008578-170008600 CTATGGGCTTGGAGTTGGGTAGG + Intronic
983902947 4:173155948-173155970 CTGTGGGTTTGCTGAGGGGTGGG - Intergenic
989158155 5:38364505-38364527 CTGTGGGGTGAGAGATGGGTCGG + Intronic
989304089 5:39931641-39931663 CTGTGGTATTTGAGAGGTATGGG - Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992874072 5:81034796-81034818 TTGTGGGGTGGGAGGGGGGTAGG + Intronic
993063414 5:83068905-83068927 ATGTGTGGTGGGAGAGGGGTAGG + Intronic
994321791 5:98403448-98403470 CTCTGGGGTTGGGGAGGTGTGGG - Intergenic
995404116 5:111774586-111774608 CTGTGGGTTTGGAGATGGAGGGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996402079 5:123073521-123073543 TTATGGGATTGGAGTGGAGTGGG - Intergenic
997387960 5:133488743-133488765 CTGTGGGATGGGAGTGGGTATGG + Intronic
997852186 5:137343112-137343134 CTGTGGGAGTGGATAAGTGTCGG - Intronic
998405312 5:141870916-141870938 CAGTGGGATTGATGTGGGGTGGG - Intronic
998643782 5:144040772-144040794 CTGGGTGATTGGAGTAGGGTGGG + Intergenic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999760731 5:154699014-154699036 CTGTGGGATTGCAGAGCGAGGGG + Intergenic
1000434004 5:161185539-161185561 CTGTGGGACTCCAGAGGGTTTGG + Intergenic
1000444530 5:161303747-161303769 TTGTGGGCTTTGAGAGGGGCAGG - Intronic
1001257467 5:170195102-170195124 CTGTGGAATTGGAGCCGGGAGGG - Intergenic
1001524279 5:172417612-172417634 CTTTGGGATTAGACAGGGCTGGG - Intronic
1001771698 5:174301808-174301830 GTGGGGGATGGGAGGGGGGTGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1002923664 6:1592305-1592327 GTGTGTGTGTGGAGAGGGGTAGG - Intergenic
1003545155 6:7052348-7052370 CTGTGAGGGTGGAGAGGGGGCGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1006316574 6:33295287-33295309 CTGAGGCATTGGACTGGGGTGGG - Intronic
1006936614 6:37723277-37723299 CTGTGGGAAGGGTGAGGGTTGGG - Intergenic
1008341403 6:50368862-50368884 CTGAAGGATGGGAGTGGGGTGGG - Intergenic
1010324537 6:74549894-74549916 CTCTGCCATTGGAAAGGGGTAGG - Intergenic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1012809727 6:103942020-103942042 CTTTGGGCTTGGAGATGGGAAGG - Intergenic
1014254516 6:119147803-119147825 CTGTGTGATTGGTTAGGGGTAGG - Intronic
1014376477 6:120681087-120681109 CTCTGGCAATGGAGAGTGGTTGG + Intergenic
1016459370 6:144266135-144266157 CTGCTGGATGGGGGAGGGGTGGG - Intergenic
1017117751 6:150995146-150995168 CTTAGGGATGGGGGAGGGGTGGG + Intronic
1017652631 6:156597347-156597369 CTGGGGGACAGGGGAGGGGTTGG - Intergenic
1017759020 6:157553628-157553650 CTGGGGGGTGGGAGAGGGCTGGG + Intronic
1018027444 6:159817220-159817242 CCCTGGGACTGGAGAGGTGTTGG - Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019263152 7:93633-93655 CTGTGGGATGAGGGTGGGGTTGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019509829 7:1412299-1412321 CACTGAGGTTGGAGAGGGGTGGG - Intergenic
1019925247 7:4187189-4187211 CTGAGGGAGTGGGGAGGGCTGGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020224160 7:6266717-6266739 GTGTGGGATGGGAGAGGTGTAGG - Intronic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1021586713 7:22216389-22216411 CCTAGGGAATGGAGAGGGGTGGG - Intronic
1022302279 7:29112971-29112993 ATGTGGGATTGGCCAGGGGCAGG - Intronic
1022528102 7:31051341-31051363 CTGTGGGATGGGGGCTGGGTGGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022869894 7:34465877-34465899 AGGTGGGAGTGAAGAGGGGTTGG - Intergenic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024818238 7:53295884-53295906 CTGGGGCACTGGAGAGTGGTGGG + Intergenic
1025960080 7:66212346-66212368 CACTGGGATTGGTGATGGGTAGG + Intronic
1026569766 7:71519210-71519232 ATGCAGGATTCGAGAGGGGTAGG + Intronic
1026679477 7:72454691-72454713 CTGGAAGAGTGGAGAGGGGTAGG - Intergenic
1026796542 7:73369473-73369495 CTCTGGGCCTGGAGAGGCGTGGG - Intergenic
1028440090 7:90849571-90849593 CTTGGGGATTGGAGAGGGTGGGG + Intronic
1029440469 7:100584361-100584383 CTGTGAGCTTGGGGGGGGGTCGG - Intronic
1029638400 7:101801872-101801894 CAGTGGGATCTGAGATGGGTAGG + Intergenic
1029641982 7:101826718-101826740 CTGTGTGCTTGGGGAGGTGTGGG + Intronic
1030629314 7:111878597-111878619 CCGGGGGATGGGGGAGGGGTGGG - Intronic
1031280626 7:119795828-119795850 TTGTGGGATAGGGGAGGGGGAGG - Intergenic
1032139528 7:129314716-129314738 ATTTGGGATGGGAGTGGGGTGGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033080531 7:138292776-138292798 TCATGGGATTGAAGAGGGGTAGG + Intergenic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034556377 7:151852841-151852863 CTGTGAGATAGGAGAGAGGCGGG - Intronic
1035039543 7:155917497-155917519 CTGTGTGTTTGGTGAGGGCTTGG + Intergenic
1035138959 7:156738109-156738131 CTGGGGGATGGAAGAGGGGTTGG - Intronic
1035222458 7:157414269-157414291 CCGTGGGATGGGGGCGGGGTGGG - Intronic
1035291217 7:157840540-157840562 GTGTGGGAGTGGAGAGGGTACGG + Intronic
1035402696 7:158577553-158577575 CTGTGGCATTCGGGAGGGCTGGG - Intronic
1036134519 8:6148019-6148041 CCTTGGGAAAGGAGAGGGGTTGG + Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036358993 8:8064694-8064716 CTGTGGGGTTGGAGCATGGTGGG - Intergenic
1036381591 8:8239441-8239463 CTGGGGGATGGCAGAGGGGGAGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036990248 8:13584325-13584347 CTGTGGGCCTGGACAGGGGTGGG + Intergenic
1037389130 8:18374476-18374498 CTCTGGGAGTAGAGAGGGCTAGG - Intergenic
1037894716 8:22644231-22644253 CTGTGGGCTTAAAGGGGGGTGGG + Intronic
1038201187 8:25414302-25414324 CTGTAGGATTGGAAAGGGAGTGG + Exonic
1039516994 8:38142471-38142493 CATTGGGATGGGAGGGGGGTAGG - Intronic
1039552347 8:38452103-38452125 CTGAGGGATTGGGGAGGGCCTGG - Intronic
1039904868 8:41779180-41779202 CTCAGGGATAGGAGAGGGATGGG - Intronic
1040414434 8:47183796-47183818 CTGAAGGATGGGAGAGGGTTGGG - Intergenic
1040596995 8:48847985-48848007 CTGTGGGTCTGGGGAGGGGTGGG + Intergenic
1041023873 8:53664983-53665005 CTGTGGGGGTGGGGTGGGGTAGG - Intergenic
1041807013 8:61862547-61862569 ATGTAAGATTGGAGTGGGGTTGG - Intergenic
1042571707 8:70172202-70172224 CTTTGGGATTACAGAGTGGTGGG - Intronic
1043204528 8:77420407-77420429 AGGTGGGACTGGGGAGGGGTGGG + Intergenic
1043343602 8:79272595-79272617 TTGTGGGGTTGGGGAGGGGGCGG - Intergenic
1044530236 8:93299331-93299353 CGGTGGGAGTGGGGAGTGGTAGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1047305715 8:123651741-123651763 CGGGGGGATTGGAGAAGGGCAGG - Exonic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048926891 8:139279427-139279449 CTGTGGGATTTATCAGGGGTAGG + Intergenic
1049039682 8:140103070-140103092 CTGTGGGAGTGGGGAGCGGCAGG - Intronic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049412901 8:142481385-142481407 CAGGGTGATTGGGGAGGGGTTGG - Intronic
1049420244 8:142513235-142513257 CTGTGAGATGGGAGGGCGGTTGG + Intronic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1051196196 9:14565103-14565125 CTGTGGGGTTGGGGTGGGCTGGG + Intergenic
1051991286 9:23154995-23155017 CAGGGGGATGGGAGAGGGGTTGG + Intergenic
1052665333 9:31487838-31487860 CTGGGAAATTGGGGAGGGGTGGG - Intergenic
1052980717 9:34447023-34447045 CTGTGTGATTGGAGAAGGTAGGG - Intronic
1052995220 9:34548242-34548264 CTGGGGGTCTGGATAGGGGTGGG + Intergenic
1053345700 9:37376780-37376802 CTGTGGGACTGGTTAGGGGTGGG + Intergenic
1054805284 9:69391578-69391600 CTTTGGGAAAAGAGAGGGGTGGG - Intronic
1054849423 9:69831560-69831582 CTGTGAGATAGGAGTGGGGAGGG + Intronic
1056167992 9:83956971-83956993 CTGCGGGAAAGGAGAGGGGTGGG - Intronic
1057172568 9:92971959-92971981 CTGTGGGGTTGGTGTGGGGGAGG - Intronic
1058305906 9:103439761-103439783 CTTTGGAATTTTAGAGGGGTGGG + Intergenic
1058758042 9:108102054-108102076 ATCTGGGAGTGGAGAGGGTTGGG + Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059705459 9:116819213-116819235 CTGTGTGTTTGGGGTGGGGTGGG - Intronic
1059958398 9:119541996-119542018 CCTTGGGATTGGAGATGGGTAGG + Intergenic
1060006713 9:120006661-120006683 TTCAGGGGTTGGAGAGGGGTTGG - Intergenic
1061451763 9:130670749-130670771 GTGTGGGGTTGGTGAGGGGATGG - Intronic
1061970115 9:134040334-134040356 CCCTGGGATTGGAGGGGGCTTGG + Intronic
1062141397 9:134961049-134961071 GTGTGTGATGGGAGAGGGGAGGG + Intergenic
1062270077 9:135704321-135704343 CTGGGGCACTGGAGTGGGGTGGG - Intronic
1062325817 9:136012072-136012094 CTGTGGCCTTGGGGAGGGGCGGG - Intronic
1062498703 9:136843288-136843310 CTCTGGGATCACAGAGGGGTTGG + Intronic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1062695486 9:137873698-137873720 CTCTGAGGTTGGAGAGGGATGGG + Intergenic
1203740325 Un_GL000216v2:172068-172090 GTGTGGGAGTGGGGAGGGGGTGG - Intergenic
1187790710 X:22947043-22947065 CAGTGAGATTGGAAGGGGGTTGG + Intergenic
1188292314 X:28405012-28405034 CTGTGAGAATGGGGAGTGGTAGG - Intergenic
1189021975 X:37350036-37350058 CTGGGGGATGGGAGAGCGGGGGG + Intronic
1190688973 X:52897815-52897837 CTGTGCGATGGGAGAGGAGGTGG - Exonic
1190697010 X:52957977-52957999 CTGTGCGATGGGAGAGGAGGTGG + Intronic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1193280460 X:79642276-79642298 CTGAAGGATTGGAAAGGGGTGGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193772180 X:85600893-85600915 CTGTGGGTATGGGTAGGGGTAGG + Intergenic
1193907301 X:87259608-87259630 CTGTTGGATTGTAGGGGGCTAGG + Intergenic
1194602550 X:95940510-95940532 CTGTTGCTTTTGAGAGGGGTGGG - Intergenic
1194999218 X:100625703-100625725 TTTAGGTATTGGAGAGGGGTAGG + Intergenic
1195156101 X:102125864-102125886 CAGTAGGATTGGGGAGGGGGCGG + Intronic
1195158015 X:102142273-102142295 CAGTAGGATTGGGGAGGGGGCGG - Intronic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1196795706 X:119500653-119500675 TTGCAGGACTGGAGAGGGGTTGG + Intergenic
1197704313 X:129622965-129622987 CTGGGGCAGGGGAGAGGGGTTGG - Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198767568 X:140094433-140094455 CTGGGGGGTTGGGGAGGGGAGGG + Intergenic
1199239016 X:145525539-145525561 CTGGGGGATTAGGGAGGGATGGG - Intergenic
1200344553 X:155435569-155435591 CTGTGGGCAGGGGGAGGGGTGGG + Intergenic
1200877351 Y:8171923-8171945 CTCTGGGATTTCAGAAGGGTAGG + Intergenic
1201363116 Y:13175009-13175031 ATGAGGGAATGGAGAAGGGTAGG + Intergenic
1201600108 Y:15718989-15719011 TTGTGGGGTTGGGGAGGGGGAGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic