ID: 902260116

View in Genome Browser
Species Human (GRCh38)
Location 1:15218833-15218855
Sequence GGTGGGTTAATGCAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 6, 1: 12, 2: 23, 3: 44, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902260116_902260124 5 Left 902260116 1:15218833-15218855 CCCTCAATTTGCATTAACCCACC 0: 6
1: 12
2: 23
3: 44
4: 101
Right 902260124 1:15218861-15218883 ATTTGCATGTGACTAAAAGTGGG 0: 2
1: 2
2: 101
3: 240
4: 465
902260116_902260123 4 Left 902260116 1:15218833-15218855 CCCTCAATTTGCATTAACCCACC 0: 6
1: 12
2: 23
3: 44
4: 101
Right 902260123 1:15218860-15218882 AATTTGCATGTGACTAAAAGTGG 0: 2
1: 2
2: 89
3: 242
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902260116 Original CRISPR GGTGGGTTAATGCAAATTGA GGG (reversed) Intronic
902259939 1:15217318-15217340 AGTGGGTTAATGTAAATTGAAGG - Intronic
902260116 1:15218833-15218855 GGTGGGTTAATGCAAATTGAGGG - Intronic
905764938 1:40592498-40592520 GGTGGGTTAATGCAAATTGAGGG - Intergenic
906360111 1:45148897-45148919 GGTGTGTTGATACAAATTGAAGG - Intronic
906499873 1:46333819-46333841 AGCAGGCTAATGCAAATTGAGGG - Intergenic
907419500 1:54337329-54337351 GGTGGGTTATTGCAAAGCAAGGG - Intronic
909051987 1:70777196-70777218 GGCAGGTTAATGCAAATTGAGGG - Intergenic
910899360 1:92103108-92103130 TGTGAGTTATTGCAAATTGATGG + Intronic
910899364 1:92103164-92103186 TGTGAGTTATTGCAAATTGATGG + Intronic
912043835 1:105427862-105427884 GCTGGGTCAGTGAAAATTGAGGG + Intergenic
914988924 1:152481617-152481639 GGTGGGTTAAAGGAAATGGTGGG + Intergenic
915812012 1:158923132-158923154 GGTAGGTGACTGCAAAGTGAGGG + Intergenic
918682433 1:187372058-187372080 AGTGGGTTAATGCAAACTAAAGG - Intergenic
920624145 1:207579624-207579646 AGTGGATCAATGCAGATTGAGGG - Intronic
921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG + Intergenic
922968606 1:229715314-229715336 GACAGGTTAATGCAAATTGAGGG - Intergenic
923202459 1:231725491-231725513 GGTGAGCTAGTGCAAATTGAGGG - Intronic
923995897 1:239494091-239494113 GGCAGGTTAATTCAAATTGAGGG + Intronic
924229351 1:241950298-241950320 TGGGAGTTAATGCCAATTGAAGG - Intergenic
924273049 1:242354305-242354327 GGTGGATCAATGCAAATTCAGGG - Intronic
1063498354 10:6530549-6530571 GGGGGGTTGTTGCAAATAGAGGG + Intronic
1063925784 10:10975947-10975969 GGTGGGTCAATGGAAATTGAGGG + Intergenic
1063966826 10:11352514-11352536 GCCAGGTTAATGCAAACTGAGGG + Intergenic
1064461714 10:15541013-15541035 GGTGGGTGAATGCAAATTGAAGG - Intronic
1064710902 10:18123420-18123442 AGTGGGTTAATGCAAATGGAGGG - Intergenic
1064800470 10:19064955-19064977 AGCAGATTAATGCAAATTGAGGG + Intronic
1066711663 10:38242354-38242376 GGTGGATCAATGCAAATTCAGGG + Intergenic
1067960109 10:50838698-50838720 GGTGGATAAAAGCAAATTGAAGG + Intronic
1068220307 10:54036088-54036110 GGTGGGTTCATGAAATTTAAGGG + Intronic
1068512920 10:57989122-57989144 GCTGGGTTGCTGCAAATTCATGG - Intergenic
1068657272 10:59588586-59588608 GGCAGGTTAATGCAAACTGAAGG + Intergenic
1069685131 10:70313007-70313029 GGTGGGCTAATGGGCATTGAGGG + Intronic
1076200559 10:128554442-128554464 GGTGGGTTAATGTAAACTGAGGG + Intergenic
1076330323 10:129659586-129659608 GATGAGTTAGTGCAAATTGAGGG + Intronic
1077983113 11:7321763-7321785 GGCGGGTTAATGCAAATAGAGGG + Intronic
1080003984 11:27385272-27385294 GGTTGGTAAATGCAAAGTCAGGG + Exonic
1083700333 11:64473224-64473246 GGTGGTTCAATGTAAATTGAAGG - Intergenic
1083909886 11:65700480-65700502 GGTGAGTTAATGCAAATTGATGG + Intergenic
1083915722 11:65742396-65742418 CGTGAGTCAATTCAAATTGAGGG + Intergenic
1087984116 11:104656475-104656497 GATGGAATAATACAAATTGAGGG + Intergenic
1088380197 11:109184369-109184391 GGTGGGTCAATGGAAATTGATGG + Intergenic
1089438286 11:118491115-118491137 GGTTGGTAAATGCAAGTCGAGGG + Intronic
1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG + Intergenic
1090681911 11:129068849-129068871 GATGAGATACTGCAAATTGAGGG - Intronic
1092128403 12:6091445-6091467 GGTGGATGAATGGAAATTGGTGG - Intronic
1092753396 12:11739966-11739988 GATGGGTTTATGACAATTGAGGG + Intronic
1094475960 12:30840745-30840767 GATGGGTCAATGCAAATTGAGGG + Intergenic
1099839133 12:87943973-87943995 GGCAAGCTAATGCAAATTGATGG + Intergenic
1100949166 12:99826408-99826430 GGTGGGTCAATGAAAATGAATGG + Intronic
1101076320 12:101133197-101133219 TCTGGGTTAATGCAAAATGCAGG - Intergenic
1103468445 12:121160888-121160910 GGTGGGATACTGCAGATAGAAGG - Exonic
1103879007 12:124151694-124151716 GGCAGGTTAATGCAAATTGAGGG + Intronic
1104195615 12:126534536-126534558 GAGTGGTTAATGCAAATTGAAGG + Intergenic
1105796263 13:23856510-23856532 GGTGGGTTAATGCAAATTGGGGG + Intronic
1106678561 13:31986648-31986670 TGTGGGAGAATGCAAATTCAAGG + Intergenic
1108048450 13:46405722-46405744 GGTGGGCTAATGCAAATTTAGGG - Intronic
1108376819 13:49821748-49821770 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1109256964 13:60095431-60095453 GGTGGGTCAATGTAAATTAAGGG + Intronic
1109740275 13:66544653-66544675 AGTGGTTTAATGTAAATTGAAGG + Intronic
1110497054 13:76180349-76180371 GGCAGATTAATGCAAATTGAGGG - Intergenic
1111179600 13:84645782-84645804 GGTGGATCAATGCAAATTGAGGG + Intergenic
1112392207 13:98995838-98995860 GCTGAGTTAGTGCAAATTGAGGG + Intronic
1112583575 13:100697168-100697190 AGTGGGTTAATGCAAATTTGGGG + Intergenic
1112751486 13:102588330-102588352 GGTGGGTTAATGCAAACTGAGGG + Intergenic
1116259351 14:42602983-42603005 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1119547136 14:75480098-75480120 GGTGGTGTTATGCAAATAGAAGG - Intergenic
1119976256 14:79027515-79027537 TGCAGGTTAATACAAATTGAAGG + Intronic
1121513994 14:94536844-94536866 GGCAGTTTAGTGCAAATTGAGGG + Intergenic
1123859617 15:24450749-24450771 GGTGGATCAATGAAACTTGATGG + Intergenic
1132354648 15:101162474-101162496 GGTGGCTGGATGCAAGTTGAGGG + Intergenic
1135819434 16:25669390-25669412 GTTGGGTTTTTACAAATTGAAGG + Intergenic
1135863671 16:26080744-26080766 GTTGGGTTTATGCAAAATGGAGG - Intronic
1138777435 16:59740915-59740937 GGAAGGTTAATGCAAATTGAGGG + Intronic
1140300584 16:73753475-73753497 AGTGGGTTAAAGTAAATTGAGGG - Intergenic
1140614157 16:76639977-76639999 GGTGAGTCAATGCAAATTGATGG + Intergenic
1144303057 17:13941311-13941333 GGTGAGTCAATGCAAATTGAGGG + Intergenic
1146087972 17:29847875-29847897 GGCAGGTTAATGCAAATTGAGGG - Intronic
1147817968 17:43223964-43223986 GGTGGGTTAATGCCAACCTACGG - Intergenic
1148658177 17:49304361-49304383 TGTGGGTTAATGTCAAGTGAAGG - Intronic
1151905464 17:77045610-77045632 GGTTGGTTAATGCAGAGTGAGGG - Intergenic
1152975196 18:209548-209570 GGAGGTTTAATACAAATTGCAGG + Intronic
1155523942 18:26697562-26697584 GGTGGGTCAATGCAATTTGAGGG + Intergenic
1159184450 18:64950446-64950468 TGTAGGTTAATGCCAATTAAGGG + Intergenic
1159246991 18:65819231-65819253 AGTGGGTCAATGCAGATTGAGGG - Intronic
1159337061 18:67081955-67081977 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1159337071 18:67082028-67082050 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1160475983 18:79188354-79188376 GGTTGGGAAATACAAATTGATGG + Intronic
1160526650 18:79542500-79542522 GGTGGATAAATGGAAATGGATGG - Intergenic
1165134737 19:33660702-33660724 GGCAGGTTAATGCAAATCAAGGG - Intronic
1167677896 19:50899714-50899736 AATGGGTCAATGTAAATTGAGGG + Intergenic
928470861 2:31574121-31574143 GGTGGGAAAATGTAAACTGAGGG - Intronic
930863708 2:56102496-56102518 GGTGGGCCAATGCAAATTGAGGG - Intergenic
931202948 2:60118081-60118103 GATAAGTTACTGCAAATTGAGGG + Intergenic
931965432 2:67528670-67528692 TGCAGGTTAATGCAAATTGAGGG - Intergenic
933401984 2:81809913-81809935 GGTGGGTCATTGAAAAATGAGGG + Intergenic
933486887 2:82935444-82935466 GGTGGGTCAATGCAAATTGAGGG - Intergenic
935120315 2:100178394-100178416 GGTGGGCCAATGCAAATCAAGGG - Intergenic
936665367 2:114588774-114588796 AGTGGTTGAGTGCAAATTGAAGG + Intronic
941044885 2:160663469-160663491 GGTGGCTAAAAGCAAATTAATGG + Intergenic
942240271 2:173956948-173956970 GGTGTATTAATACAATTTGAGGG + Intronic
944173903 2:196808295-196808317 GATGGGTTAATGCAAACAGAAGG + Intronic
945036622 2:205709039-205709061 GGTGAGTTAATGCATATCAATGG - Intronic
1169035414 20:2447150-2447172 GGCAGGTTGATGCAAATTGAGGG - Intergenic
1169595176 20:7190293-7190315 GGTGAGTTAGTTAAAATTGAAGG + Intergenic
1170478789 20:16744449-16744471 GGAGGCTCAATACAAATTGAGGG + Intergenic
1172570709 20:35968167-35968189 GGCAGGCTAATGCAAATTAAGGG + Intronic
1173891977 20:46519781-46519803 AGTGGATCAATGCAAATTGAGGG - Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1177355760 21:20004701-20004723 GATGAGTCAATGCAAATTGAGGG - Intergenic
1178026795 21:28477634-28477656 GGTGAGGTAATGCAAATTGAGGG - Intergenic
1178042339 21:28653002-28653024 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1185242914 22:49755980-49756002 GATGGGCCAATGCAAATTGAGGG - Intergenic
953553845 3:43926295-43926317 GGTAGGAAAATGCAAATTGTAGG + Intergenic
954777443 3:53032853-53032875 GGGTGGTTAATGCAACCTGAGGG + Intronic
956495606 3:69822716-69822738 GGTGGGTGAATTCAAAATGTGGG - Intronic
957854151 3:85851875-85851897 GGTGAGTTAATGAAGAATGAAGG + Intronic
959572174 3:107896513-107896535 GGTGGTTTAATGGTAACTGAAGG - Intergenic
959770637 3:110090912-110090934 GGCAAGTCAATGCAAATTGAGGG + Intergenic
963148036 3:142014997-142015019 GGAAGGTTAAAGTAAATTGAAGG - Intronic
963254351 3:143130037-143130059 GGTAGGCGAATGCAAATTCACGG + Intergenic
963724270 3:148901948-148901970 GGTGGGTTAATGTTTTTTGAGGG - Intergenic
968191956 3:196675064-196675086 GATGGGCTAATGGAATTTGATGG - Intronic
971488893 4:27190524-27190546 GATGGATTAATGTAAATTGGAGG + Intergenic
971786290 4:31107237-31107259 GGTGAAATAATGCAAATTGAAGG + Intronic
974368883 4:60988336-60988358 GGTGGGTCATGGCAAAATGAAGG - Intergenic
974625584 4:64423787-64423809 TGTGGATTAATGAAAAATGAGGG - Intergenic
981342130 4:143633932-143633954 GATGGGTTAAAGAAAAATGAAGG + Intronic
982021765 4:151211832-151211854 GGTTGGTTCATGCAATTTAAGGG + Intronic
983297225 4:165881342-165881364 GGAGGGATAATGTTAATTGATGG - Intronic
986209494 5:5657344-5657366 GTGGGGTTATTGCAAATTGAGGG - Intergenic
988095575 5:26605238-26605260 GGTGAGTAAATACAAATGGAGGG - Intergenic
988936641 5:36090060-36090082 GGTGGCCCAATGCAAATTAAGGG + Intergenic
993564620 5:89457925-89457947 GGTGTGATGATGCAAATAGAAGG + Intergenic
996644271 5:125795553-125795575 AGTGGGTTAATTCAGATTGAAGG - Intergenic
997065445 5:130554185-130554207 GGTGGGTCAATGCAAATTGAGGG - Intergenic
997523224 5:134536585-134536607 GGGAGGTTTATGCAAAGTGAGGG + Intronic
998649562 5:144102819-144102841 GCTGGGTTAATGCAAAGACAGGG + Intergenic
1001347083 5:170913343-170913365 GGTGGGTGAATGCAAATGATGGG + Intronic
1001635027 5:173203709-173203731 GGTGGGTGCATGCCAACTGATGG - Intergenic
1001875589 5:175197610-175197632 GATGGGATAATGCAAACAGATGG + Intergenic
1003043807 6:2714335-2714357 GGTGAGTTAATGCAAATTGAGGG - Intronic
1003915580 6:10783610-10783632 GGTGGGGTAATGTAAATGGCTGG - Intronic
1005870040 6:29968139-29968161 GGTGGGTTAAAGGAAGTTAATGG - Intergenic
1009370477 6:62894377-62894399 TGTGGATTAATGCAAATTGAGGG + Intergenic
1010675912 6:78742751-78742773 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1010865953 6:80976977-80976999 GGCAGGTCAATGCAAATTGAGGG - Intergenic
1010866605 6:80983336-80983358 GGAAGGTCAATGCAAATTGAGGG - Intergenic
1014570810 6:123005401-123005423 TGTGGCTTAATGAAAACTGAGGG + Intronic
1015592870 6:134839191-134839213 GGGGGCGTAATGCAAGTTGAAGG + Intergenic
1016519576 6:144931465-144931487 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1019954338 7:4401434-4401456 GGTAGGTCAATGCAAGCTGAGGG + Intergenic
1020397611 7:7734748-7734770 AGGTGGTTAATGCAAATTAATGG - Intronic
1022799951 7:33766981-33767003 GGTGGGTGTATGGACATTGATGG + Intergenic
1023847003 7:44127952-44127974 GCTGGGTTAGTCCAAATTCAGGG - Intergenic
1024747670 7:52427160-52427182 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1029817934 7:103115836-103115858 AATGGGTTAATGCAAATTAAAGG + Intronic
1030776764 7:113543306-113543328 GACGAGTCAATGCAAATTGAGGG - Intergenic
1031532764 7:122896000-122896022 GGTGGTTAAAGGGAAATTGATGG - Intergenic
1034981099 7:155477310-155477332 AGTGCGTTTTTGCAAATTGAAGG + Intronic
1038241433 8:25811497-25811519 GGTGGGTTCATGGAGATTAAAGG - Intergenic
1038375207 8:27033165-27033187 GGTAGGTTAATATGAATTGAGGG + Intergenic
1039725037 8:40206393-40206415 GGCAGGTTAATGCAAATTGCAGG + Intergenic
1046197914 8:110887053-110887075 GGTGGGTTAATCCAGGTTGTTGG - Intergenic
1046630075 8:116615137-116615159 GGGGGCTTAATGGAAATGGAAGG - Intergenic
1047218579 8:122899801-122899823 GGCAGTTTAATGCAAATTGGAGG + Intronic
1055079495 9:72255227-72255249 GGTGGGTGGATGCAAATTGAGGG + Intronic
1056261980 9:84858077-84858099 GGTGACTGATTGCAAATTGAGGG - Intronic
1056512172 9:87316515-87316537 TGTGGGTAAATGCAGAGTGATGG + Intergenic
1056618664 9:88191446-88191468 GGTGAATTAATGCAAATTAAGGG + Intergenic
1059545300 9:115169719-115169741 ACTGGGTTATTGGAAATTGATGG + Intronic
1190364637 X:49680109-49680131 GGTCAGTCAATGCAAATTGAGGG + Intergenic
1190554768 X:51623082-51623104 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1190628398 X:52359929-52359951 GGCGGGTTAATGCAAATTTAGGG - Intergenic
1190682074 X:52834999-52835021 GGTAGGTTAATGCAAATTGAAGG + Intergenic
1190953318 X:55167454-55167476 GGCAGGTTAATGCAAGTTGAGGG - Intronic
1190998999 X:55639145-55639167 GGTGGGTTAATGCAAATTGAAGG + Intergenic
1192551887 X:72061106-72061128 GGTGTGTTTATGAAAATGGAAGG + Intergenic
1195268835 X:103211340-103211362 AGTGGGTTAATGCAAATTGAAGG - Intergenic
1195339321 X:103890350-103890372 GGTAGGTTTGTGCAAAATGAAGG - Intergenic
1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG + Intergenic
1195389222 X:104343690-104343712 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1195588031 X:106588357-106588379 CTTGGGTTAATCCACATTGAAGG - Intergenic
1198212236 X:134527098-134527120 GGAGGGTGAATGCAAAATGAGGG - Intergenic
1198846586 X:140918743-140918765 GGTGGGTTAATGCAAAATGAAGG - Intergenic
1200832614 Y:7702171-7702193 GGTGGGAAAATGCAGAATGAAGG + Intergenic
1201049744 Y:9920567-9920589 GATGGGAAAATGCAAAATGAAGG + Intergenic