ID: 902260117

View in Genome Browser
Species Human (GRCh38)
Location 1:15218834-15218856
Sequence GGGTGGGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 8, 1: 12, 2: 24, 3: 40, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902260117_902260123 3 Left 902260117 1:15218834-15218856 CCTCAATTTGCATTAACCCACCC 0: 8
1: 12
2: 24
3: 40
4: 113
Right 902260123 1:15218860-15218882 AATTTGCATGTGACTAAAAGTGG 0: 2
1: 2
2: 89
3: 242
4: 471
902260117_902260124 4 Left 902260117 1:15218834-15218856 CCTCAATTTGCATTAACCCACCC 0: 8
1: 12
2: 24
3: 40
4: 113
Right 902260124 1:15218861-15218883 ATTTGCATGTGACTAAAAGTGGG 0: 2
1: 2
2: 101
3: 240
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902260117 Original CRISPR GGGTGGGTTAATGCAAATTG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
907419501 1:54337330-54337352 GGGTGGGTTATTGCAAAGCAAGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909773187 1:79451762-79451784 GTGTGGGATAATGCAAAGTTAGG - Intergenic
911974648 1:104476588-104476610 GGCTGGATTACTGAAAATTGAGG + Intergenic
912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG + Intergenic
914988923 1:152481616-152481638 TGGTGGGTTAAAGGAAATGGTGG + Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
919644833 1:200085058-200085080 GGGTGGGTTACTGCCAGTGGGGG + Intronic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
924518027 1:244782268-244782290 GGGTGAGAGAATGCAAACTGAGG - Intergenic
1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG + Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064003361 10:11681787-11681809 GGGTGGGTAAATCCAATCTGGGG - Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1069685130 10:70313006-70313028 GGGTGGGCTAATGGGCATTGAGG + Intronic
1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG + Exonic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG + Intronic
1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG + Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1078893065 11:15574813-15574835 AGGTGGGTTAAGGCCATTTGAGG + Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1087984115 11:104656474-104656496 GGATGGAATAATACAAATTGAGG + Intergenic
1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG + Intronic
1092753395 12:11739965-11739987 GGATGGGTTTATGACAATTGAGG + Intronic
1093276479 12:17134659-17134681 TGATGGACTAATGCAAATTGAGG - Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096591641 12:52663939-52663961 GGGTGGGTTGATGGTAATTTGGG - Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106552135 13:30781124-30781146 GGGTGGGTTGTTACAAAGTGAGG + Intergenic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1114067042 14:19069565-19069587 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
1114095223 14:19330463-19330485 GGGTGGGTCATTTCAAAGTGAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1121825769 14:97008400-97008422 GGGTGGGTGAATCCACTTTGGGG - Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1125278503 15:38019377-38019399 GGATGGGATAATACAAATTCTGG + Intergenic
1128630868 15:69265487-69265509 TGGTTGGTTAATTTAAATTGAGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1134422600 16:14108203-14108225 GGGTGGGTTAAAGAACATTCAGG + Intronic
1134901770 16:17944578-17944600 GGTTGGGTTTCTGCAAAATGTGG - Intergenic
1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146592493 17:34139754-34139776 GGGGGGATTGATGGAAATTGGGG + Intronic
1151638357 17:75369237-75369259 GGGTAAGTTGATGCAAAATGAGG - Intronic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159184449 18:64950445-64950467 GTGTAGGTTAATGCCAATTAAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159838540 18:73370017-73370039 GGGGGGGTTCATTCAAATTTGGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933401983 2:81809912-81809934 GGGTGGGTCATTGAAAAATGAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
936334174 2:111574740-111574762 GGGTGGGTTCAAGAGAATTGGGG - Intergenic
938309728 2:130281224-130281246 TGGTTGATTAATGCCAATTGTGG - Intergenic
938445191 2:131371144-131371166 TGGTTGATTAATGCCAATTGTGG + Intergenic
938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG + Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170039037 20:12020727-12020749 GGGTGGATTAATCTAAATAGGGG + Intergenic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173463599 20:43263375-43263397 GGAGGGGGTAATGCAAAGTGGGG - Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1174209902 20:48869470-48869492 GGGTGGGTTAAATCAAATATGGG - Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1174902615 20:54516292-54516314 GGGTTGTTTTATTCAAATTGGGG + Intronic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178513077 21:33223299-33223321 GGGTGGGTTAATCCGAAGTGGGG + Intergenic
1178734975 21:35141045-35141067 GGCTGGGATTATGCAAAATGGGG + Intronic
1180485519 22:15792149-15792171 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
951703124 3:25516147-25516169 AGGTGGGTTGATGCAATTTGGGG - Intronic
956495607 3:69822717-69822739 GGGTGGGTGAATTCAAAATGTGG - Intronic
957361933 3:79172126-79172148 GGGAGGCTTAGAGCAAATTGAGG - Intronic
957526105 3:81380360-81380382 GGTTGGGCCAATGCAACTTGTGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
961144960 3:124585829-124585851 GGGTGGGGTATTGTAAATGGGGG - Intronic
969921947 4:10548642-10548664 GGGTGGATTAAATCAACTTGGGG - Intronic
970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG + Intergenic
971276687 4:25205168-25205190 GGGTTGGTTACTACAGATTGTGG - Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG + Intronic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
982371892 4:154642715-154642737 GAGTGGGTCAATATAAATTGAGG - Intronic
983680324 4:170345887-170345909 AGGTGGGTAAATGCTATTTGTGG - Intergenic
984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
991318187 5:65336445-65336467 GTATGGGTTCATGCAAAGTGGGG - Intronic
993128577 5:83866941-83866963 GGGTGGTTTAATACAATATGTGG - Intergenic
994283257 5:97932031-97932053 TGGTGTGTTAATGCAAAAGGAGG - Intergenic
997023511 5:130030154-130030176 AGGTGAGATAATTCAAATTGTGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007264456 6:40586473-40586495 GGGTGGGGTAAAGCCAAGTGCGG - Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1016687133 6:146894686-146894708 GGGTGGATGAATGCAATCTGTGG + Intergenic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1023002599 7:35826539-35826561 GGGTGTGTTAAGGTAATTTGAGG + Intronic
1023507302 7:40913396-40913418 GGGTGGACTAATGGAAATTTGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1032801812 7:135322841-135322863 GGGTGTGTTAATTCAAATGCAGG - Intergenic
1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG + Intergenic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1039790610 8:40872760-40872782 GGGATGGTTGATGCCAATTGGGG + Intronic
1047809663 8:128394700-128394722 TTGTGGCTTAATGCAAATGGAGG - Intergenic
1048030401 8:130626211-130626233 GGGTGGGGAAAGGCAATTTGAGG - Intergenic
1051383804 9:16485500-16485522 GACTGGGTTAATGCAAAGTTGGG - Intronic
1052043235 9:23765211-23765233 GTGTGGCTTAATTGAAATTGAGG + Intronic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055247767 9:74267137-74267159 AGGTGGTTTAAGGCACATTGGGG - Intergenic
1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG + Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1062059910 9:134489702-134489724 GGGTGGGTTGCTGCGGATTGTGG + Intergenic
1186419929 X:9417534-9417556 GGATGGGTCAAGGCAAACTGGGG - Intergenic
1189185596 X:39052235-39052257 GGCTGGGTTGCTGCAAATAGAGG + Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1190989848 X:55535951-55535973 GGGTGGGTTCATGCTACTGGGGG + Intergenic
1192986865 X:76408975-76408997 GTGTGGGTTAATACATATTCTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198212237 X:134527099-134527121 TGGAGGGTGAATGCAAAATGAGG - Intergenic
1200246109 X:154526664-154526686 GGGTGGGCAAAGGCAACTTGGGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic