ID: 902260880

View in Genome Browser
Species Human (GRCh38)
Location 1:15223910-15223932
Sequence GGGGAAGGGGAGCCACGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902260873_902260880 -2 Left 902260873 1:15223889-15223911 CCTCTGACTGGTTGCAGTTCTGG No data
Right 902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG No data
902260868_902260880 28 Left 902260868 1:15223859-15223881 CCACCTAACCTCGATTTTGATTT No data
Right 902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG No data
902260869_902260880 25 Left 902260869 1:15223862-15223884 CCTAACCTCGATTTTGATTTTTC No data
Right 902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG No data
902260870_902260880 20 Left 902260870 1:15223867-15223889 CCTCGATTTTGATTTTTCCTTTC No data
Right 902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG No data
902260872_902260880 3 Left 902260872 1:15223884-15223906 CCTTTCCTCTGACTGGTTGCAGT No data
Right 902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902260880 Original CRISPR GGGGAAGGGGAGCCACGAGC AGG Intergenic
No off target data available for this crispr