ID: 902261278

View in Genome Browser
Species Human (GRCh38)
Location 1:15226597-15226619
Sequence CATCCACTCCTCTTCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902261278_902261287 25 Left 902261278 1:15226597-15226619 CCCACCATGAAGAGGAGTGGATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 902261287 1:15226645-15226667 TGGATGACAGTTTGCCCTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 205
902261278_902261289 29 Left 902261278 1:15226597-15226619 CCCACCATGAAGAGGAGTGGATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 902261289 1:15226649-15226671 TGACAGTTTGCCCTCTGGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 170
902261278_902261286 24 Left 902261278 1:15226597-15226619 CCCACCATGAAGAGGAGTGGATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 902261286 1:15226644-15226666 GTGGATGACAGTTTGCCCTCTGG 0: 1
1: 0
2: 2
3: 8
4: 113
902261278_902261288 26 Left 902261278 1:15226597-15226619 CCCACCATGAAGAGGAGTGGATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 902261288 1:15226646-15226668 GGATGACAGTTTGCCCTCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 116
902261278_902261284 5 Left 902261278 1:15226597-15226619 CCCACCATGAAGAGGAGTGGATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 902261284 1:15226625-15226647 CCGAGCTTTTGCCATCTGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902261278 Original CRISPR CATCCACTCCTCTTCATGGT GGG (reversed) Intergenic
900749030 1:4382373-4382395 AATCAACTCCACTTCATGGAGGG + Intergenic
900754532 1:4424543-4424565 TGGCCACTCCTCTTCCTGGTTGG + Intergenic
901027486 1:6286283-6286305 CATCCACACCTCTCCTAGGTGGG - Intronic
902261278 1:15226597-15226619 CATCCACTCCTCTTCATGGTGGG - Intergenic
902335313 1:15751163-15751185 CCTCCACCCCTCTCCCTGGTGGG - Intergenic
902975391 1:20084705-20084727 ATTCCACTCCCCGTCATGGTGGG - Intronic
909457321 1:75864966-75864988 CATCAACTCCTATTCAGTGTTGG - Intronic
910654413 1:89605415-89605437 CCGTCCCTCCTCTTCATGGTAGG - Intergenic
913070620 1:115295178-115295200 CTCCAACTCCTCTTCGTGGTTGG - Intronic
913210609 1:116579468-116579490 CAGCCACTCCTCCACATGGCAGG + Exonic
914935999 1:151980813-151980835 CATCAACTCATCTTCACAGTGGG - Intergenic
915823969 1:159056245-159056267 CAGCCCCTCCTCTTCCTGGGTGG - Intergenic
916252604 1:162753571-162753593 CATCCACTCCTCTTCTCAGTGGG + Intronic
917683424 1:177391601-177391623 CTTCCCCTCCTCTTCCTTGTTGG - Intergenic
922337929 1:224632830-224632852 CATCCTTTCCTCTTATTGGTTGG + Intronic
923456197 1:234167746-234167768 CATCCCCACCACCTCATGGTAGG + Intronic
1064334156 10:14423330-14423352 CAGCCCCTCCTCTTCCTGGGTGG + Intronic
1068981429 10:63066497-63066519 AAACCACTCCTCTCCATGGCAGG + Intergenic
1070397208 10:76021643-76021665 GATTCACAGCTCTTCATGGTAGG - Intronic
1074154557 10:110786914-110786936 CATCCACCCCCCTTTATGGAGGG - Intronic
1075022271 10:118960611-118960633 AAACCAGTCCGCTTCATGGTGGG - Intergenic
1077421153 11:2450639-2450661 CCTCCACACCCCTTCCTGGTGGG + Intronic
1078139644 11:8682890-8682912 CATCCACTCCCTACCATGGTCGG + Intronic
1078315591 11:10290575-10290597 CATCTACTCCTCTCCCTGCTGGG - Intronic
1079388387 11:20000468-20000490 CCTCCACACCCCTTCCTGGTCGG - Intronic
1081237841 11:40667444-40667466 AATCCACTCCTCTTGAATGTAGG + Intronic
1083048800 11:59758626-59758648 CTTGCACTGCTCTTCCTGGTGGG + Intronic
1084764164 11:71297003-71297025 CCTCCACTTCTTTTCATGGCTGG - Intergenic
1084959326 11:72708024-72708046 CATGCCCTGCTCTTCAGGGTGGG + Intronic
1085250512 11:75140612-75140634 CATGGCCTCCTCTGCATGGTCGG - Intronic
1086137948 11:83461711-83461733 CCTCAAATCCTTTTCATGGTAGG + Intronic
1089452258 11:118607028-118607050 CATTTACAGCTCTTCATGGTGGG + Intronic
1089742911 11:120597290-120597312 CATCATCTCCTCATCATGGTGGG - Intronic
1090170445 11:124597870-124597892 CATCCCCTCCTCTTGAGTGTGGG - Intergenic
1092895978 12:13010722-13010744 CATGCTCCCCTCTTCAGGGTGGG + Intergenic
1093424657 12:19014643-19014665 CATCCACAACTCTTCGTGGCAGG + Intergenic
1099084807 12:78232490-78232512 CATCTCCTCCTCTTCAGGGGAGG - Intergenic
1104438107 12:128772168-128772190 CATTCACTCCTCTTGATTATGGG + Intergenic
1110598437 13:77343677-77343699 CAGCCAGTCCTCTTCAGGCTTGG + Intergenic
1111821308 13:93218836-93218858 CAACCATTCCCCTTCATGATTGG - Intergenic
1112532522 13:100218615-100218637 AATCCACTCCTCTTCAATTTGGG + Intronic
1113562251 13:111291185-111291207 CATCCCCGCCTCTGCATGGAGGG + Intronic
1113789806 13:113022314-113022336 CATCCGCTCCTCTTCCTAGCTGG + Intronic
1113800277 13:113082855-113082877 CATCCCCTCCTCATCCTGCTGGG + Intronic
1114536765 14:23427856-23427878 CATGCACTCCTCTTCCAGGATGG + Exonic
1119688519 14:76652497-76652519 GATCCACTCTTCTTCCTGGCTGG - Intergenic
1119976755 14:79033171-79033193 CTACCACTCCTCTGCATGGCAGG + Intronic
1122099243 14:99394223-99394245 CAGCCCCTCCTGTTCATGGCTGG + Intergenic
1122580919 14:102771084-102771106 CATCTGCCCCTGTTCATGGTGGG + Intergenic
1126353110 15:47765694-47765716 CTTCTACTTCTCTGCATGGTTGG - Intronic
1126398233 15:48242216-48242238 CAGCCACACCTCCTCCTGGTTGG + Intronic
1129001755 15:72341404-72341426 CAACCTCTCCTCTCCTTGGTAGG - Exonic
1129040637 15:72683506-72683528 ATTCCAGTCCTCTTCATGGGCGG - Intronic
1129122424 15:73408775-73408797 CATGCACTGCTGTTCTTGGTGGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134693870 16:16208751-16208773 CATCCACTCCTTTTCAAGCCGGG + Exonic
1134977968 16:18585892-18585914 CATCCACTCCTTTTCAAGCCGGG - Intergenic
1138926297 16:61595322-61595344 CGTCCTCTCCTCTTCATTATAGG - Intergenic
1143250802 17:5521731-5521753 CATCCCCTCCTCTTTAAAGTGGG + Exonic
1143922790 17:10344071-10344093 CATGCACTCCTCTTCCAGGATGG + Exonic
1143929735 17:10409550-10409572 CATGCACTCCTCTTCCAGGATGG + Exonic
1143933565 17:10457691-10457713 CATGCACTCCTCTTCTAGGATGG + Exonic
1143938147 17:10508634-10508656 CATGCACTCCTCTTCCAGGATGG + Exonic
1143940645 17:10537504-10537526 CATGCACTCCTCTTCCAGGATGG + Exonic
1143952257 17:10642685-10642707 CATGCACTCCTCTTCCAGGATGG + Exonic
1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG + Intronic
1147214190 17:38889971-38889993 CTTGCTCTCCTCTGCATGGTCGG + Intronic
1147485534 17:40809064-40809086 TATCCACTTCTCTACATTGTGGG - Intergenic
1150157809 17:62868793-62868815 AATCCACTCCCCTTCAGTGTGGG + Intergenic
1152862881 17:82705929-82705951 CATCCTCTCCACTGCATGCTGGG - Intergenic
1155070714 18:22313596-22313618 TATTCCCTCCTCTTTATGGTCGG + Intergenic
1155416520 18:25605125-25605147 CAGCCCCTTCTGTTCATGGTGGG - Intergenic
1155775294 18:29753475-29753497 AATCCTATCCTGTTCATGGTGGG - Intergenic
1156016744 18:32555326-32555348 TCTGCACTCCTCTTCATGCTTGG - Intergenic
1156470528 18:37374851-37374873 CCTCCAATCCTCTAAATGGTGGG + Intronic
1156929041 18:42618635-42618657 CATCTACTCTTCTCCATTGTGGG + Intergenic
1157898680 18:51492625-51492647 CATCGACTCCTTCTCATGCTTGG + Intergenic
1157916190 18:51665837-51665859 GATTCACTCCTCTTCATTGAGGG - Intergenic
1158692143 18:59670342-59670364 AATTCATTCCTCTTCAAGGTGGG + Intronic
1161350824 19:3790557-3790579 CATCCAGGGCTCTTCATGTTTGG + Intronic
1161578057 19:5065766-5065788 CATCCCCTCCTCTGCACGGCCGG + Intronic
1161909166 19:7179849-7179871 CATAGACTCCACTTCTTGGTGGG - Intronic
1163463725 19:17454704-17454726 CCTCCACCCCTCTTCATCATGGG + Intronic
1163523091 19:17803636-17803658 CCTGCACTCCTGTTCAAGGTGGG - Intronic
1163980677 19:20896828-20896850 CATCCACTCACCATCATAGTGGG + Intergenic
925456709 2:4022310-4022332 CATCAACTACGCTTCATGTTAGG - Intergenic
926852776 2:17219069-17219091 CATTCACTCCTTTTCATGTCAGG + Intergenic
928641266 2:33302409-33302431 CATCCACTTCTCTCAAAGGTGGG - Intronic
928976887 2:37096925-37096947 TTTCCCCTCCTCTTCATGCTTGG - Exonic
929803746 2:45126865-45126887 CATCCTATCCTCTTCCTGCTAGG + Intergenic
930916734 2:56700330-56700352 CATCCTTTCCTCTTCAAGGTGGG + Intergenic
931741283 2:65247682-65247704 CAACCCCTCCTCTTCTTCGTCGG - Intronic
932722060 2:74145729-74145751 CATCCACTGCCCTGGATGGTGGG + Intronic
935135758 2:100300028-100300050 CATACACTCTTCTTCATAATTGG + Intronic
935652616 2:105395381-105395403 CACCCACTCTTCTTCATGGCAGG + Intronic
936513569 2:113167708-113167730 CAACCATTCCTCTGCCTGGTTGG - Intronic
940363333 2:152819268-152819290 CATCCCTTCTTCTCCATGGTAGG - Intergenic
941628646 2:167859516-167859538 CAACCACTCCTCTTTCAGGTCGG + Intergenic
944065893 2:195618541-195618563 CATTACCTCCGCTTCATGGTAGG + Intronic
944597582 2:201275501-201275523 GATCTGCTCCTCCTCATGGTAGG + Intronic
1170210486 20:13842140-13842162 CATTGACTCCTCTTCCTGCTTGG + Intergenic
1171445095 20:25197053-25197075 CTTCCACTCATCCTCCTGGTGGG - Intronic
1173100550 20:40084066-40084088 CAGACACTCCTCTTCTGGGTTGG - Intergenic
1173618301 20:44417208-44417230 CATCTTCTCATCTTCAAGGTTGG - Intronic
1173787535 20:45805349-45805371 CACCCACACCTCTTTAAGGTAGG + Exonic
1174340220 20:49890803-49890825 CAGCCACCCCTCTTCACAGTGGG + Exonic
1176117271 20:63438556-63438578 CCTCCACTCCTCAACAAGGTGGG + Intronic
1178899531 21:36588078-36588100 TATCCCCTTCTCTTCCTGGTGGG + Intergenic
1179632714 21:42688611-42688633 CCTCCACTGCTCTTTGTGGTTGG + Intronic
1184773254 22:46610161-46610183 CATCCAGTCCTCTTAAGGGAAGG - Intronic
1185265511 22:49900580-49900602 AATCCCGACCTCTTCATGGTGGG + Exonic
949954523 3:9256669-9256691 CATCCACTCCTCCCCAGGGGAGG + Intronic
950590990 3:13935650-13935672 CCTCCCCTCCTCTTCCTGGCAGG - Intergenic
950923978 3:16721926-16721948 CAACCACTTCTCTTATTGGTGGG - Intergenic
953422397 3:42764689-42764711 CAGCCACTCCTCTACCTGGGAGG + Intronic
954193576 3:48982591-48982613 CATCCATTCCCTTTCATGTTGGG + Intronic
955767532 3:62360462-62360484 CTTCCACTCCTCCCCATGGGTGG - Intergenic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
956845828 3:73181827-73181849 TTTCCCCTCCTCTTCATGCTTGG + Intergenic
959002385 3:100979589-100979611 CAAACATTCCTTTTCATGGTTGG - Intronic
959627083 3:108464776-108464798 CATACACTCTTCTTCAAGGATGG + Exonic
960934615 3:122890454-122890476 CCTCCACAACTCTTCATGCTGGG - Intergenic
961083885 3:124050011-124050033 CCTCCACTTCTCTTCAGAGTGGG + Intergenic
962494049 3:135921838-135921860 CATCAACTCCTTCTCATGCTTGG + Intergenic
965655250 3:170976570-170976592 CTTCCAGTCCTCTTTAGGGTTGG + Intergenic
965839459 3:172887187-172887209 CAGCCACTCCTCTGCTTGGGAGG + Intergenic
966600942 3:181774443-181774465 CTTTCACTCCTGTCCATGGTGGG + Intergenic
967109644 3:186282253-186282275 CAGGCACTCCTCTTTGTGGTGGG - Intronic
969997358 4:11326611-11326633 CAGTCACTCCTCTGCATGGCTGG - Intergenic
970294846 4:14618171-14618193 CTTCCACTCTTCTTCATACTTGG - Intergenic
971198145 4:24488813-24488835 CATCCAGTCCTCTTTAAGGATGG + Intergenic
974140665 4:57882315-57882337 GATCTACTCATTTTCATGGTTGG - Intergenic
974165428 4:58195593-58195615 CAGCCCCTCCTCTTCCTGGGTGG + Intergenic
974509907 4:62825622-62825644 TATCCTCTTTTCTTCATGGTAGG + Intergenic
974675040 4:65078549-65078571 CATCCTTTCCTCTTCCTTGTTGG + Intergenic
975508146 4:75162117-75162139 CTCCCACTCCTCTTCACTGTGGG - Intergenic
977084422 4:92575919-92575941 GATCCACTCCTTCTCATGGGAGG - Intronic
978599493 4:110413032-110413054 CATCAACTCCTTCTCATGGTTGG + Intronic
984337285 4:178408789-178408811 CTTCCATGCCTTTTCATGGTTGG - Intergenic
987167263 5:15213760-15213782 CAGCCACTCCACTTCAGGGAAGG + Intergenic
990242357 5:53828030-53828052 TATCCTCACCTCTGCATGGTGGG - Intergenic
997374474 5:133387335-133387357 CATGCACTCCTTTTCCTAGTTGG - Intronic
998264290 5:140655981-140656003 CATTCACTCACCTCCATGGTGGG - Exonic
999184394 5:149695054-149695076 CATCCACTGCTATTCAGAGTGGG + Intergenic
999719728 5:154390712-154390734 CATTCACTGTTCTCCATGGTGGG - Intronic
1003308959 6:4952244-4952266 CATCCACTCTTCTTCCTTGCAGG + Exonic
1003968999 6:11280477-11280499 CACCCAGTCCTCCCCATGGTGGG - Intronic
1006332943 6:33405229-33405251 CATCCTGTCCACTTCCTGGTGGG - Exonic
1007267620 6:40609148-40609170 CATCCACTACTGTTCAAGGAAGG - Intergenic
1011524477 6:88248502-88248524 CAGCCACTCTTCTTCTAGGTGGG + Intergenic
1012975948 6:105781103-105781125 CATTTCCTCATCTTCATGGTGGG + Intergenic
1014294640 6:119603646-119603668 CACCCACTCCTCTTCCTCCTGGG - Intergenic
1017261432 6:152392076-152392098 CATCCACACCAATTCAGGGTGGG + Intronic
1019110379 6:169705197-169705219 CATCATTTCTTCTTCATGGTGGG + Exonic
1019746832 7:2705530-2705552 AATCCACTCCTCCCCATCGTGGG + Intronic
1022906420 7:34862095-34862117 TATTCACTTCTCTTGATGGTGGG + Intronic
1023326972 7:39070927-39070949 CATCCACTCCTCTAAGTGATGGG - Intronic
1023729823 7:43180279-43180301 CTCCCACTCCTTTTAATGGTTGG + Intronic
1029306548 7:99624088-99624110 CCTCCACTCCTCCTCAGGGAAGG - Exonic
1029940661 7:104477439-104477461 TATCCTCCCCTCTTAATGGTAGG - Intronic
1030130016 7:106191526-106191548 CTTTCAGTCTTCTTCATGGTCGG + Intergenic
1031063225 7:117075519-117075541 CATCCACTCCTCTGGATGTCAGG + Intronic
1031650111 7:124278144-124278166 CATCCACTCTTGTTGAGGGTAGG + Intergenic
1032071578 7:128811010-128811032 CATACAATTCTCTTCAGGGTTGG + Intronic
1038654138 8:29433236-29433258 TATCCACACCTCTTCAAGTTGGG + Intergenic
1039613780 8:38938820-38938842 CAGCCACGCCTCTTCATGAGAGG + Intronic
1039846840 8:41331487-41331509 CATCCTCTCCACTTCACGGAGGG - Intergenic
1041621006 8:59969424-59969446 CAGTCACTCCTCTCCATGGTAGG + Intergenic
1044873384 8:96641905-96641927 AATCCATTCCTCCTCATGGGTGG - Intergenic
1053302354 9:36961001-36961023 CCTCCTCTCCTCCTCATGGTGGG + Intronic
1057500408 9:95593324-95593346 CAGCCACTGCTCTTCCTGCTGGG - Intergenic
1061215001 9:129216604-129216626 CATCCGCTCCTCTCCCAGGTTGG + Intergenic
1190581796 X:51897413-51897435 TATCCCCTCCTTTCCATGGTTGG + Intronic
1190949536 X:55129741-55129763 CATCCTCTCCTTTTCAGGATTGG + Intronic
1195515961 X:105776307-105776329 CATCTAGTCCTCTTAAAGGTGGG + Intergenic
1201677324 Y:16601351-16601373 TATCCAAACCTCGTCATGGTGGG + Intergenic