ID: 902263695

View in Genome Browser
Species Human (GRCh38)
Location 1:15246626-15246648
Sequence ATGTTTGCAGAGATAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902263693_902263695 24 Left 902263693 1:15246579-15246601 CCAGGTGTATTCTGGGATCAGCG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG 0: 1
1: 0
2: 2
3: 39
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902263695 Original CRISPR ATGTTTGCAGAGATAGAGAA AGG Intergenic
901013820 1:6216300-6216322 ATTTCTGCAGAGGTAGAGTATGG - Intronic
901161313 1:7178258-7178280 ATAGTGGCAGAGATAGAGCATGG - Intronic
901453009 1:9347507-9347529 ATGTTTGTAGGTACAGAGAAAGG - Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
902584362 1:17429196-17429218 GTTTCTGCAGAGACAGAGAAAGG + Exonic
903113550 1:21159260-21159282 ATTTTTGGAGAGATAGGGATAGG - Intronic
903730022 1:25486516-25486538 GTGTTTGCAGATATAGAGCGAGG + Intronic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904301301 1:29556551-29556573 GTGTTTGCGGAAACAGAGAAGGG + Intergenic
905442545 1:38004680-38004702 TTGGATGCAGAGACAGAGAAAGG - Intronic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906403569 1:45523169-45523191 ATGTTTGAAGAAAAAGGGAATGG - Intergenic
906853327 1:49277493-49277515 AAGTTTGCAAAGATAGTGAGTGG - Intronic
907395947 1:54189971-54189993 ATGTGTGCATGGAAAGAGAAAGG - Intronic
907659942 1:56382618-56382640 ATGTGTGGAGTCATAGAGAAAGG - Intergenic
907893302 1:58657335-58657357 ATGTTTACAGAAGTGGAGAAAGG - Exonic
908097832 1:60758946-60758968 ATATTTGGAGAGAGAGAAAAAGG - Intergenic
908125406 1:61025625-61025647 ATGTTTCCAGAAAGAGAGAGAGG - Intronic
908480127 1:64531363-64531385 AGGCTTGAAGAGATTGAGAAGGG + Intronic
908956639 1:69637966-69637988 AGTTTTGCAAAGAGAGAGAAAGG + Intronic
910326798 1:86018447-86018469 CTCTTTAAAGAGATAGAGAAAGG + Intronic
911045578 1:93624775-93624797 ATTTTTGGAGAGACAGGGAAGGG - Intronic
911385368 1:97168805-97168827 ATGCTTGCTCATATAGAGAAGGG + Intronic
911418372 1:97606474-97606496 ATGTTTCCAGTCATAGAAAAAGG + Intronic
912065515 1:105736309-105736331 AAGTTTGCAGAGACAAATAAAGG + Intergenic
913070095 1:115290691-115290713 AGGCTTTAAGAGATAGAGAAGGG - Intronic
915752583 1:158225875-158225897 ATATTATCAGAGATAGAAAAAGG - Intergenic
916317551 1:163467024-163467046 AAGTTTGCAGAGCTAGTAAATGG + Intergenic
917852863 1:179080311-179080333 ATGGTTGCACAAATAGAAAATGG + Intergenic
919836890 1:201581070-201581092 AAGTTAGCAGAGGTAGGGAATGG + Intergenic
919998150 1:202773238-202773260 TTGTTTGCAAGGATAGAAAATGG - Exonic
920606934 1:207398035-207398057 ATGTTTGCTGGAGTAGAGAAGGG - Intergenic
921362758 1:214345155-214345177 GTGATTGAAGAGTTAGAGAATGG - Intergenic
921610013 1:217201320-217201342 ATGTTTGTAAACATAAAGAAAGG - Intergenic
923423109 1:233839898-233839920 ATCTATGCAGAGAGAAAGAAAGG + Intergenic
923730608 1:236546187-236546209 TTTTTTGCAGAGACAGTGAAAGG + Intronic
923991902 1:239447394-239447416 ATGTGGGGAGAGAGAGAGAATGG + Intronic
924623216 1:245680115-245680137 ATCTTTGGAGGGAAAGAGAAAGG - Intronic
1063483575 10:6398650-6398672 ATGCTGGGAGAGAGAGAGAAAGG + Intergenic
1063516465 10:6701012-6701034 ATGTTTTAAGAGAAAAAGAAAGG + Intergenic
1063597301 10:7447674-7447696 ATATATACAGAGAGAGAGAAAGG + Intergenic
1063782752 10:9345052-9345074 ATGTTGGGGGAGAGAGAGAAGGG + Intergenic
1065173831 10:23057799-23057821 GTGTCTGCAGAGATAAAGACAGG + Intergenic
1066377799 10:34873527-34873549 AAGTTTTCAGGGATAAAGAAGGG + Intergenic
1066646272 10:37613406-37613428 ATGTTAACTGAGATAAAGAAGGG - Intergenic
1068195578 10:53711561-53711583 ATGATAGCATAGATAGAGCAGGG + Intergenic
1068492539 10:57742091-57742113 GTGTATGCAGAGATAGGGAAAGG - Intergenic
1068548843 10:58384290-58384312 ATGTTTTCATAGTTACAGAAAGG + Intergenic
1069170838 10:65226800-65226822 GTGTGCGCAGAGAGAGAGAAGGG + Intergenic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070462026 10:76679779-76679801 AATTCTGAAGAGATAGAGAACGG - Intergenic
1071193566 10:83130377-83130399 CTGTTTGCAGGGACAGAGAGAGG - Intergenic
1071400814 10:85268678-85268700 ATTTTTGCTGAGATGGAAAAAGG - Intergenic
1073314505 10:102569504-102569526 CTGCTTGGAGAGATAGAGAAGGG - Intronic
1073622078 10:105060330-105060352 ATGCTTGGAGAGAGAGAGATTGG + Intronic
1073676332 10:105650884-105650906 ATGTTTGCAGAGAGTTAGAATGG + Intergenic
1073802478 10:107057469-107057491 TTGTTTGCAGAGGTAGAAATTGG - Intronic
1074698487 10:116072340-116072362 ATGTTTGCAGGGAAAGGGACAGG + Intronic
1074950518 10:118329819-118329841 ATGTTTGCATTCATAGTGAAAGG + Intronic
1074952692 10:118355203-118355225 ATGATTGCATAGCTAGCGAATGG + Intergenic
1076223933 10:128758270-128758292 ATGTGAGGAGAGATAGAGAGAGG - Intergenic
1077208579 11:1356190-1356212 TTGTTTGCAGAGGCAGGGAAAGG - Intergenic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1079525341 11:21380388-21380410 ATGTTTCCAGAAATTAAGAATGG + Intronic
1080089238 11:28325069-28325091 ATCTTTGCAGACAGAGAGAGGGG - Intronic
1080985307 11:37456261-37456283 ATGTTTTCAAAGAAACAGAAAGG + Intergenic
1081215874 11:40397168-40397190 ATGTTTCCAGAGATTGGGTAGGG - Intronic
1081400871 11:42641339-42641361 ATGTTTGTAGATAGAGGGAAGGG - Intergenic
1082737519 11:56873241-56873263 TTGGTTGAAGAGATAGAGAAAGG - Intergenic
1083182064 11:60993208-60993230 ATGTTTGCAGAGCCGGGGAAGGG + Intronic
1083913332 11:65723330-65723352 ATCTTTGCAGAAACAGACAAGGG + Intergenic
1085299408 11:75449611-75449633 CTGTTTGCAGGGAGAGGGAAGGG + Intronic
1085907331 11:80779571-80779593 ACGTTTGCAGACACAGAGAAAGG + Intergenic
1086600397 11:88626156-88626178 AAGGTTACAGAGATAGAAAATGG + Intronic
1087544297 11:99564757-99564779 ATGTGTGCAGAGATAGCAATTGG + Intronic
1087929292 11:103957791-103957813 GTGTTTGCAGATAGAGAGAGGGG + Intronic
1088258595 11:107924315-107924337 ATATTTGCAGTCCTAGAGAAAGG - Intronic
1088319830 11:108544051-108544073 ATGTTTTCAGAAACAGAAAAGGG - Intronic
1088758252 11:112905317-112905339 ATGATTTCAGAGATAGATCATGG - Intergenic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089319701 11:117617113-117617135 ATGTTTGCAGAGAAGAAGATGGG + Intronic
1089917863 11:122176452-122176474 ATGATGGCAGAGTTAGAGAGCGG - Intergenic
1090023364 11:123147018-123147040 AGGTTAACAGGGATAGAGAAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090855607 11:130607431-130607453 TTGTTTGCAGCAATAGGGAAGGG + Intergenic
1091157747 11:133389327-133389349 AAGTTTGCAGAGAAACAGGAGGG + Intronic
1091522176 12:1256504-1256526 ATGTTTTAAGAGATATACAATGG - Intronic
1094141183 12:27183258-27183280 GTGTTCGAAGAGTTAGAGAATGG + Intergenic
1095880298 12:47129010-47129032 ATGATAGCAGAGATGGAGAAAGG - Intronic
1096246039 12:49987230-49987252 TTGCTTGCAGAGATAGAAGAAGG - Intronic
1096933827 12:55246540-55246562 ATATTTGCAGTGACAGAGGAGGG - Intergenic
1098295925 12:69004155-69004177 ATATCTGCAGAGCTAAAGAAAGG + Intergenic
1098558292 12:71843853-71843875 ATGTTTTGAGATATAGAGAATGG - Intronic
1098802369 12:74977835-74977857 ATATTTTCTGTGATAGAGAATGG + Intergenic
1100012411 12:89969433-89969455 ATTTTTGGAGAGGAAGAGAAAGG + Intergenic
1100344997 12:93720665-93720687 AGGTTATCAGAGATAGAGAGAGG - Intronic
1102169994 12:110835076-110835098 ACGTTTGCAGAGTTAGTAAAGGG + Intergenic
1102219767 12:111186551-111186573 ATGGTTGCTGAGAGAGAGAAGGG + Intronic
1102223643 12:111212121-111212143 GTGTTTGCAGCAATAGACAAAGG - Intronic
1102260642 12:111441202-111441224 TTTTTTGTAGAGATAGAGATAGG - Intronic
1102721897 12:115023680-115023702 GTGTTTGCAGAGATATGGAGAGG + Intergenic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1103131946 12:118476966-118476988 ATGTGTGCACACATAGAAAAGGG - Intergenic
1103941441 12:124503425-124503447 ATGCATGCATGGATAGAGAAAGG + Intronic
1104308325 12:127630739-127630761 ATGCTTACACAGACAGAGAAGGG - Intergenic
1105445538 13:20452427-20452449 ATGTTATCAGAGAAAAAGAAGGG + Intronic
1105745384 13:23373194-23373216 ATGTCGGCAGGCATAGAGAAAGG + Intronic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1106803553 13:33282140-33282162 ATTGTTGTAGAGAGAGAGAATGG - Intronic
1107036310 13:35905907-35905929 AAGTTTGCCGAGATATATAATGG - Intronic
1107857152 13:44627804-44627826 AAGTTTGCTGTGATGGAGAAGGG - Intergenic
1108754833 13:53487158-53487180 ATATTTGGATAGACAGAGAATGG + Intergenic
1109058987 13:57588523-57588545 ATGTTTTAAGTGATAGAGATTGG - Intergenic
1109180034 13:59202537-59202559 ATGTTGGCAATGATAGAGAATGG + Intergenic
1109471324 13:62808728-62808750 ATGCTTGAAGACATAGAAAATGG + Intergenic
1109694998 13:65943219-65943241 ACCTTTCCAGAAATAGAGAATGG + Intergenic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1110702665 13:78567126-78567148 ATGTTTGCAAAGATAATGACGGG - Intergenic
1110993319 13:82071498-82071520 ATGTTTTTAGAGACAGGGAAAGG - Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1111573953 13:90126014-90126036 ATCTATGCAGATACAGAGAAAGG - Intergenic
1111720461 13:91937287-91937309 ATGTTTGATGAGAGAGAAAAAGG + Intronic
1111904426 13:94238805-94238827 ATGCTTGTAGAGGTAAAGAAAGG + Intronic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1113242575 13:108354838-108354860 ATGTCTGGAGAGCTAGAGAGAGG + Intergenic
1113340475 13:109418978-109419000 ATGTTTGCAAAGAATGATAAGGG - Intergenic
1115150476 14:30278770-30278792 AAGGTTGCAGAGAAAAAGAAAGG + Intergenic
1115376460 14:32682323-32682345 ATCTGTGCAGTGAGAGAGAAGGG + Intronic
1115380592 14:32734120-32734142 AGGTTTGCAGTGAGAGAGTAGGG + Intronic
1115707746 14:36015438-36015460 ATCTTTGCAGACAGACAGAAGGG - Intergenic
1115798167 14:36961892-36961914 ATGTTTTCAGACATACAGACAGG - Intronic
1116300568 14:43176045-43176067 CTGTTCACAGAGAAAGAGAATGG - Intergenic
1117251137 14:53939852-53939874 AGATTTTAAGAGATAGAGAAAGG - Intergenic
1117451731 14:55857720-55857742 ATGTGTGGAGAGAGAGAGAGTGG + Intergenic
1117705256 14:58460046-58460068 AAGTTTACAGAAAGAGAGAAAGG + Exonic
1117791899 14:59350289-59350311 GAGGTTGCAGATATAGAGAAGGG - Intronic
1119962555 14:78876241-78876263 ATGTTTTCAAAGGCAGAGAAGGG + Intronic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1125083949 15:35707880-35707902 TTCTTTGCAGAGGTAGAGCAAGG - Intergenic
1126414958 15:48407902-48407924 AGGGTTGGAGAGATAGAAAAGGG - Intergenic
1126840225 15:52710430-52710452 AGGTTGGCAGAGACAGAGCAGGG - Intergenic
1127210944 15:56773936-56773958 ATGTTTCCTTAGATAGAGAGGGG - Intronic
1127690557 15:61391917-61391939 ATTTTTGATGAGATGGAGAAGGG - Intergenic
1127921321 15:63496658-63496680 ATGTTTGGAAAGAGAGAGCAAGG - Intergenic
1131146577 15:90017746-90017768 TTGTTTGCAGAATTCGAGAATGG + Intronic
1131274335 15:90968354-90968376 ATTGCTGCAGGGATAGAGAATGG - Intronic
1131668910 15:94598713-94598735 ATCTTTGCAGAGATAAAGAATGG + Intergenic
1132149193 15:99447599-99447621 ATGCTTGCAGAGACAGAGGAAGG + Intergenic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134370215 16:13616602-13616624 ATGTTTACACAAAGAGAGAAAGG + Intergenic
1135261382 16:20983847-20983869 ATTTTTGTAGAGATAGGGGACGG - Intronic
1135353784 16:21752527-21752549 AAGTTTGGAAAGAGAGAGAAAGG - Intronic
1135452273 16:22568665-22568687 AAGTTTGGAAAGAGAGAGAAAGG - Intergenic
1135962014 16:27002994-27003016 ATGTTTGCAAAGATATAAAAAGG + Intergenic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1136502773 16:30681463-30681485 TTGTTTCTAGAGGTAGAGAACGG + Intergenic
1136855770 16:33655993-33656015 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1139524361 16:67504826-67504848 AAGTTTACTGAGAGAGAGAAGGG - Intergenic
1140317618 16:73914285-73914307 AGGTTTGCATTGATAAAGAAGGG - Intergenic
1140550395 16:75859388-75859410 ATGATAGCAGAGCTTGAGAAGGG + Intergenic
1203117355 16_KI270728v1_random:1504474-1504496 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1143864722 17:9915857-9915879 GTGTTTGCTGTGGTAGAGAAAGG + Exonic
1143997543 17:11020442-11020464 GTTTTTGAAGAGTTAGAGAAAGG - Intergenic
1144745136 17:17609060-17609082 GTGCTTGCAGAGATGAAGAAGGG + Intergenic
1147605735 17:41772785-41772807 ACCTTTGCAGAGAGAGAGAGGGG - Intronic
1148188278 17:45660417-45660439 TTGTTTGCAGAGACAGAACAGGG - Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1149618885 17:58026581-58026603 AGGTTTACAGAGAGAGACAAAGG + Intergenic
1150605570 17:66687769-66687791 AGGATTTCAGAGGTAGAGAAGGG + Intronic
1151486982 17:74407268-74407290 ATGATTGTAGAGTGAGAGAATGG + Intergenic
1153114171 18:1634227-1634249 ATGTTTGTAAACATAAAGAAAGG - Intergenic
1153477422 18:5512291-5512313 ATGCTAGAAGACATAGAGAATGG + Intronic
1154063235 18:11083129-11083151 AGGTATGCAAAGGTAGAGAACGG - Intronic
1155378588 18:25190462-25190484 ATCTTTGCATAGGAAGAGAAAGG - Intronic
1155713641 18:28912517-28912539 CTGTTTGCACAGAAAGAGAGAGG - Intergenic
1156100830 18:33593068-33593090 ATTGTTGAAAAGATAGAGAAAGG + Intronic
1157799454 18:50607266-50607288 ATTTTTGCAGAAAAAGAAAATGG + Intronic
1157799804 18:50610006-50610028 ATTTTTGCAGAAAAAGAAAATGG + Intronic
1158014287 18:52765816-52765838 AAGTTTGCAGAACTAGTGAATGG - Intronic
1158911270 18:62065246-62065268 ATTATTACAGAGGTAGAGAAAGG + Intronic
1159168414 18:64731472-64731494 AGGTTTTCAGGAATAGAGAAAGG - Intergenic
1159252446 18:65897293-65897315 TTGTTTGAAAAGTTAGAGAATGG + Intergenic
1159384660 18:67707833-67707855 ATGTTTGCAGAAAATAAGAAGGG + Intergenic
1159624740 18:70679305-70679327 ATTTTTGAAGAGTGAGAGAAAGG + Intergenic
1159722542 18:71910229-71910251 ATGTGTACATAGATAGATAAGGG - Intergenic
1160225243 18:77006858-77006880 GTGTTTGCACAGAGAGAGAGAGG + Intronic
1161088838 19:2349016-2349038 GTGTGTGGAGAGAGAGAGAACGG - Intronic
1161088881 19:2349732-2349754 ATGTGTGTGGAGAGAGAGAACGG - Intronic
1161088915 19:2350497-2350519 GTGTGTGGAGAGAGAGAGAATGG - Intronic
1161203853 19:3029972-3029994 TTTTTTGCAGAGATGGAGTAGGG + Intronic
1162014682 19:7838765-7838787 ATGTTTTCAGGGAGAGAGAGGGG + Intronic
1165072336 19:33262630-33262652 ATGTGTGCAGATACAGAGAGGGG - Intergenic
1166070812 19:40386529-40386551 CTTTTTGTAGAGATAGAGATGGG + Intronic
925221482 2:2144857-2144879 AGGTTTGCAGAGCAAGAGAAAGG - Intronic
926583834 2:14663178-14663200 AATTTTGAAGAGATAGTGAATGG - Intergenic
927280059 2:21296974-21296996 TTGTTTCCAGAAAAAGAGAAAGG + Intergenic
927308488 2:21600949-21600971 TTGATTGAAGAGAGAGAGAAAGG - Intergenic
927463252 2:23317772-23317794 GTGTTTGAAGAGTTTGAGAAGGG - Intergenic
927467648 2:23349313-23349335 ATGTGTGCATATATACAGAAGGG + Intergenic
928191941 2:29178752-29178774 ATATATGCAGAGAAAGAGATAGG - Intronic
928243118 2:29603719-29603741 ATGTTTCCAGAGAGACTGAATGG - Intronic
928274640 2:29889193-29889215 ATGTTTCCAGGGATATACAATGG + Intronic
928527371 2:32155383-32155405 ATGTTTCCAGTGCAAGAGAAGGG + Exonic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929297940 2:40269875-40269897 AAGTAAGCAGAGATATAGAAAGG + Intronic
929319098 2:40519157-40519179 ATGTTACTAGAGATAAAGAAAGG - Intronic
929376628 2:41295053-41295075 TTATTTGCAGTGGTAGAGAATGG - Intergenic
930498864 2:52185105-52185127 ATATTTGGAAAGATAGATAATGG + Intergenic
930510645 2:52340148-52340170 ATGTTGGAAGAAATAGAGAAAGG - Intergenic
931812296 2:65866571-65866593 ATGTCTGCAAGGATAGAGATGGG - Intergenic
931867783 2:66431084-66431106 ATCTTTCCAGAGATAGAGAACGG - Intergenic
933347775 2:81111264-81111286 ATTTTTGCAGTGATTGTGAATGG - Intergenic
933565609 2:83946847-83946869 ATGTAGGCAGTGAGAGAGAAAGG - Intergenic
934772343 2:96915024-96915046 GTGTTTGCTGAGATGGAAAATGG + Intronic
935694259 2:105757459-105757481 ATGGGTGCAGAGATGTAGAAAGG + Intronic
936052634 2:109236415-109236437 AAGTTTGAGGAGAAAGAGAATGG - Intronic
936275947 2:111097404-111097426 ATGTTTGCAGTCAGAGAGATAGG - Intronic
936956452 2:118027348-118027370 TTATTTGCTGAGATAAAGAAGGG + Intergenic
938136436 2:128761938-128761960 CTCTTTGCAGTGATAGTGAATGG + Intergenic
941072760 2:160972785-160972807 CTGTGTGAAGAGATAGAAAATGG - Intergenic
941422630 2:165301767-165301789 TTGTTTGCAGAGTCAGAGTAGGG - Intronic
941649347 2:168076937-168076959 ATGCTTGCAGAAATAGCTAAAGG + Intronic
941854480 2:170216853-170216875 ATTTTTGCAGTGATATAGACAGG + Intronic
942802703 2:179893740-179893762 ATTTATGCAGAGAAAGAGAAAGG - Intergenic
943889606 2:193270322-193270344 TTGATTGCACAGAAAGAGAATGG - Intergenic
944611449 2:201412882-201412904 ATGTCTGGAGATATAGGGAAAGG + Intronic
944721056 2:202423576-202423598 ATTTTTGTAGAGACAGAAAAGGG - Intronic
945874577 2:215265121-215265143 ATGTTTACAATGATAGAGCAGGG + Intergenic
946436190 2:219657025-219657047 AGTGTTGCAGAAATAGAGAACGG + Intergenic
946843916 2:223842585-223842607 TTGTTGGCAGAAATAGAGTAAGG - Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
947319949 2:228905934-228905956 TTTTTTGCAGAAATAGAAAATGG - Intronic
947716485 2:232341805-232341827 AGGTTTCCAGAGACAGAGAGGGG - Intronic
948088308 2:235268534-235268556 ATGTCTGCAGACACAGAGAGGGG - Intergenic
1168750139 20:276365-276387 AGGCTGGCAGAGATAGTGAAGGG + Intronic
1169195749 20:3681324-3681346 TTGTTTGGTGAGATAGAGAAGGG - Intronic
1169393223 20:5206916-5206938 ATGTTTGCAGCAATAAATAATGG - Intergenic
1169821217 20:9712493-9712515 TTCTTTGCAGAAATAGAAAAAGG + Intronic
1170011105 20:11725052-11725074 ATGTGTGCTGAGAGACAGAAGGG - Intergenic
1170243041 20:14191559-14191581 ATATTTTGAGAAATAGAGAAGGG + Intronic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1170438207 20:16351654-16351676 CTGGTGGCAGAGATAGAGATGGG - Intronic
1170677339 20:18494885-18494907 ATATTTGTAGACATATAGAAGGG + Intronic
1174328981 20:49802723-49802745 ATGTCTGCTGAGTTAGAAAAGGG + Intergenic
1176092389 20:63325045-63325067 GGGTCTGCAGAGCTAGAGAATGG - Intronic
1177353854 21:19981497-19981519 ATGTTTGCAGGAATTTAGAAAGG - Intergenic
1177519568 21:22201094-22201116 ATCTGTGCAGAGCGAGAGAAAGG + Intergenic
1177714808 21:24825419-24825441 ATGTATGCAGACTTAGATAATGG - Intergenic
1177821362 21:26034245-26034267 ATGCTTGCAGGGAGAGAGAGGGG - Intronic
1177871255 21:26575406-26575428 GTGTTTGCAGAGCTGAAGAATGG + Intergenic
1179117756 21:38509660-38509682 ATGTTTCCAGAGAATGGGAATGG - Intronic
1180695758 22:17750496-17750518 ATGTTTATAGAGAGAGAGAATGG + Intronic
1182428619 22:30287700-30287722 ATGTGTGCAAAGACTGAGAAAGG + Intronic
1183977199 22:41519231-41519253 GTGTTTGCAGAGCCAGAGGAAGG + Intronic
1184259714 22:43307638-43307660 AACTTTGCAGAGGTAGAGACAGG + Intronic
949236994 3:1821362-1821384 AATTTTCCAGTGATAGAGAAAGG + Intergenic
949472417 3:4410423-4410445 TTGTTTGGAGAGAAAGAGAAAGG - Intronic
950758390 3:15197576-15197598 AGGTTTGCAAAGTTAGAAAATGG + Intergenic
951359840 3:21712213-21712235 AGGATTGCAGAGATACATAATGG - Intronic
952071624 3:29643905-29643927 AGGTTTTCAGAGAAAGAAAATGG - Intronic
952423103 3:33148881-33148903 ATGTTGGAAGAGATACGGAAGGG - Intergenic
952930829 3:38360007-38360029 AGGTTTGGAGAGGTAGAGGAGGG - Intronic
954503690 3:51047431-51047453 ATTAGAGCAGAGATAGAGAATGG + Intronic
954859385 3:53674954-53674976 ATGTATGCTGAGTTAGTGAAAGG + Intronic
954895075 3:53968172-53968194 ATGATTACAAATATAGAGAAGGG - Intergenic
958886166 3:99729766-99729788 ATGCTTGGAGAGCTAGAGGAAGG - Intronic
958988100 3:100806744-100806766 ATGGTTTCAGAGTTAGAGAGTGG + Intronic
959158590 3:102696444-102696466 ATGTTTTCACAGCAAGAGAATGG - Intergenic
959459520 3:106608014-106608036 TTGTTTGCAGTGAAAAAGAAAGG + Intergenic
960254199 3:115493953-115493975 ATGTTTGAAAAGATATAAAAAGG - Intergenic
960691671 3:120352639-120352661 ACGTTAGCTAAGATAGAGAAGGG - Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961427442 3:126859125-126859147 ATGTTTGCAGGAATAAAGAAGGG + Intronic
961806653 3:129494221-129494243 TTTTTTGCAGAGATAGAGTCTGG + Intronic
962383148 3:134912861-134912883 ATATTTGCAGACATAGGAAAGGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963210695 3:142686503-142686525 AAGTTTGTAGAGATGGATAATGG - Intronic
963412363 3:144946280-144946302 TTGTTTGCAAAGACATAGAAAGG - Intergenic
963832071 3:150018873-150018895 ATCTTTGCAAAGTTAGAAAAGGG + Intronic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
965152280 3:164993290-164993312 ATGTTATCAGAAATAAAGAAGGG + Intronic
965313315 3:167159039-167159061 ATGTATGCAGATATGGAGATGGG - Intergenic
965810352 3:172585372-172585394 ATGTTAGCAAAGAAGGAGAAAGG - Intergenic
965870760 3:173261754-173261776 ATGTTTGCATTGATAAAGTAAGG + Intergenic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
968268517 3:197381307-197381329 CTTTTGGCAGAGATAGTGAATGG - Intergenic
969204104 4:5629533-5629555 ATATTTCCACAGATAGAAAAAGG - Intronic
970929855 4:21496892-21496914 ATTTTTGCACAGACAGAGCAGGG - Intronic
971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG + Intergenic
972940516 4:44189588-44189610 ATGTTTGTAGAAAGAGAAAATGG - Intronic
973120500 4:46515875-46515897 GGGTCTGCAGAGTTAGAGAAAGG - Intergenic
973346795 4:49064771-49064793 ATGTTTGGGAAGATAGAGAAGGG + Intergenic
973539918 4:51925507-51925529 ATGTTGGCAGGGGTGGAGAAAGG + Intergenic
974921908 4:68252329-68252351 AGGTTTACAGAGCTAGTGAAAGG - Intergenic
976100513 4:81557802-81557824 ATGTTTTCAGAGCCAGGGAAGGG - Intronic
976290058 4:83408741-83408763 GTGTTTGCAGAGATCCAGATGGG + Intronic
976303077 4:83534025-83534047 ATCTTTGCAGTGATGGAGGAGGG - Intergenic
976335221 4:83877807-83877829 ATTTTGGAAGAGATACAGAAAGG - Intergenic
977125477 4:93161186-93161208 ATATTTGCAATGACAGAGAAAGG + Intronic
977184015 4:93914742-93914764 ATATTGACAGAGAGAGAGAATGG - Intergenic
979007069 4:115312811-115312833 AAGGTTGCAGAGAAAGAGGAAGG + Intergenic
979630992 4:122902786-122902808 ATGTGTGTAGGGAAAGAGAAAGG + Intronic
979800472 4:124902373-124902395 ATGTTTGCAGACAGAGAGATTGG - Intergenic
980530940 4:134053339-134053361 TTGTTTACTGAGATAGAGCAAGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981757947 4:148161900-148161922 ATATTTGGAGAGAAAGACAATGG + Intronic
982046533 4:151452907-151452929 ATGTCTGCAGACATAGGAAAAGG - Intronic
982366167 4:154581506-154581528 ATGATTGCAGAGGTTGAAAATGG + Intergenic
982539256 4:156647071-156647093 ATGTTTGAAGTGAGAGAGGAAGG - Intergenic
982627851 4:157790248-157790270 ATTTTAGCAGGGATAGAGGAAGG - Intergenic
982783949 4:159521432-159521454 GAGTTAGCAGAGATAGAGAGAGG + Intergenic
982827850 4:160022686-160022708 ATCTTTGCAGAGCTAGAGCAGGG + Intergenic
982830795 4:160056646-160056668 ATATTTTGAGAGACAGAGAAAGG + Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
983541374 4:168914601-168914623 TGGTAGGCAGAGATAGAGAAAGG + Intronic
983562818 4:169117943-169117965 ATGATGGCTGAGACAGAGAAAGG + Intronic
984137186 4:175955346-175955368 ATGTTTACAAAAATAGAAAATGG + Intronic
984535538 4:180970122-180970144 ATATTTGTATAAATAGAGAATGG - Intergenic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
986135135 5:4969786-4969808 ATGGGGGGAGAGATAGAGAAAGG + Intergenic
986630141 5:9763919-9763941 ATGTTTGTAGAAATTCAGAAAGG + Intergenic
987075652 5:14379727-14379749 TTGTTGGCAGAGAAAGATAATGG + Intronic
987461837 5:18222086-18222108 ATGTTTTGAGAGAGAGAGAGAGG + Intergenic
987540176 5:19244977-19244999 ATCTTTGCAGTGATTGTGAATGG - Intergenic
987779370 5:22413903-22413925 ATGTATAAAGAGAGAGAGAAAGG - Intronic
987854702 5:23405157-23405179 ATATATGAAGAGAGAGAGAAAGG + Intergenic
988207964 5:28164748-28164770 GTGACTGCAGAGTTAGAGAATGG + Intergenic
988314734 5:29610146-29610168 AAGTTTGCTGAGATGGCGAATGG - Intergenic
989175330 5:38519316-38519338 ATGTTTAAAGAGATAAAAAATGG - Intronic
990995797 5:61731263-61731285 TTCTTTGCAGAGAGAGAGAGGGG + Intronic
991528666 5:67591909-67591931 ATGCTGGCAGAGACAGAGAATGG + Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992624852 5:78627639-78627661 ATGTTTGCAGAGAGGGAGTGAGG - Intronic
992930124 5:81634797-81634819 AAGCATGGAGAGATAGAGAAGGG - Intronic
992958040 5:81930504-81930526 ATGTTATTAGAGAAAGAGAAGGG - Intergenic
993011266 5:82485714-82485736 ATTTGTACAGAGATAGAAAACGG - Intergenic
993049475 5:82910039-82910061 GTGATTGCAGAGAGAGATAATGG + Intergenic
993132660 5:83918983-83919005 ATACTTGCAGGGATGGAGAAAGG + Intergenic
993503057 5:88683574-88683596 TTGTTTGCCGAGATCAAGAAAGG - Intergenic
994046297 5:95314180-95314202 CTGTTGTCAGTGATAGAGAAGGG - Intergenic
994075982 5:95650591-95650613 ATGTTAGCAGAAAAAGAGCATGG - Intronic
994451308 5:99948597-99948619 GTGTTTGCAGAAAAACAGAATGG - Intergenic
995064205 5:107841840-107841862 ATGTTGGGAGAGATATAGAAGGG - Intergenic
995377622 5:111493950-111493972 AAGTTAGCAGACATTGAGAAAGG + Exonic
996022124 5:118602797-118602819 ATATATGCAGAGAGAGAGAGTGG - Intergenic
996577077 5:124987578-124987600 TTTCTTGCAGACATAGAGAAGGG + Intergenic
997029746 5:130112672-130112694 TTGTTTGGAGAGATATAGACTGG + Intronic
997268170 5:132510944-132510966 ATGTGTGTAGAGAGAGAGAGAGG - Intergenic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998297345 5:140984406-140984428 TTTTTTACAGAGATAGAGAAGGG + Intronic
999186476 5:149714307-149714329 ATCTTTACAGTGATAGAGCAGGG + Intergenic
999376703 5:151091706-151091728 CTAGTTGCAGAGAGAGAGAAAGG - Intronic
999883295 5:155891077-155891099 GTGTTGGAAGAGAAAGAGAAAGG + Intronic
999939659 5:156528088-156528110 ATGACAGCAGAGATGGAGAAAGG + Intronic
1000412784 5:160950983-160951005 GTGTTTCCAGAGATAGAAAATGG + Intergenic
1000657062 5:163891990-163892012 ATGTTTACAGAAATACAGGAGGG - Intergenic
1000925912 5:167193889-167193911 ATGTTTGCTGAGACAAAGAATGG - Intergenic
1001018287 5:168161305-168161327 ATGGTGGCAGAGGTAGAGATAGG + Intronic
1001544350 5:172561185-172561207 ATGTCTGCAAATATAAAGAAGGG - Intergenic
1002663976 5:180809797-180809819 ATGTGTGTTGAGAGAGAGAATGG - Exonic
1003602656 6:7531921-7531943 ATGTTAGAAGAGACAGATAAAGG - Intergenic
1003863140 6:10340191-10340213 GTGTTTTAAGAGATCGAGAAAGG - Intergenic
1004121009 6:12822229-12822251 ATGTTGGCAGAAATAGAAACTGG + Intronic
1005254329 6:23983917-23983939 AGCTTTACAGAGAGAGAGAATGG + Intergenic
1006827722 6:36948468-36948490 AAGTTTTTAGAAATAGAGAAAGG + Intronic
1008203796 6:48627416-48627438 ATGTTTGAAGAGAAAGTTAAGGG + Intergenic
1009743772 6:67784953-67784975 GTGATTGAAGAGATAGAGATAGG + Intergenic
1010050346 6:71496836-71496858 ACATTGGCAGAGATACAGAAAGG - Intergenic
1011481178 6:87795625-87795647 ATGTTTGTAGAGAAGAAGAAAGG - Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1012853347 6:104472814-104472836 TTTTTTGCAGAGATAGAAAGTGG - Intergenic
1015449746 6:133351805-133351827 ATGTGTACAGAGGTAGAGAAAGG + Intronic
1015929276 6:138340767-138340789 ATGTTGTCAGAGAGAGAGTATGG - Exonic
1016198907 6:141383265-141383287 ATATTTGAAGAGATAATGAATGG + Intergenic
1016547968 6:145245552-145245574 CTGTCTGCAGACACAGAGAAAGG - Intergenic
1017120762 6:151021929-151021951 ATGTTTGCAAGGCTAGAGGAAGG - Intronic
1018393702 6:163360685-163360707 ATGTTTCCAAAGATAGCGTAGGG - Intergenic
1018546267 6:164939993-164940015 AAGTTATCAGAGATAGAGAGAGG + Intergenic
1018577079 6:165270352-165270374 ATGTGTGCATAGATAGACACAGG - Intergenic
1019536023 7:1530451-1530473 ATGTTTATAGAGACAGAGAATGG + Intergenic
1020817744 7:12926679-12926701 ATTTTTGCAAAGAAACAGAAAGG - Intergenic
1021323880 7:19243101-19243123 TTGACTGCAGAGATAGACAAAGG - Intergenic
1023502468 7:40865187-40865209 GTGTGTGGAGAGAGAGAGAAAGG - Intergenic
1024530252 7:50385421-50385443 ATGTTAGCAGGGATAGAGTTAGG + Intronic
1024681107 7:51689005-51689027 ATGTTTGTAAAGCTAGAAAAGGG - Intergenic
1026401382 7:70016986-70017008 ATGATTGTAGGGATAGAGAATGG + Intronic
1026927328 7:74203648-74203670 TTTTTTGCAGAGATAGGGAGGGG - Intronic
1027918789 7:84362886-84362908 CTTTTTGCAGACATAGAGCAGGG - Intronic
1028016176 7:85716359-85716381 ATGTTTGCAAAGATAGTTGAAGG + Intergenic
1028090777 7:86698124-86698146 ATGTTTGCTGCTATAGAAAATGG - Intronic
1028306420 7:89270816-89270838 ATGTTTGAAGAAATTGTGAATGG + Intronic
1028538216 7:91913180-91913202 ATGTCTTCAGAGATAAAGAGAGG - Intergenic
1029035994 7:97522474-97522496 TTGTTTGCAGAAGCAGAGAAGGG - Intergenic
1029794570 7:102880553-102880575 ATGTTTGAAGAAATAAAAAATGG - Intronic
1029845781 7:103410935-103410957 AAGTTTGCAGTGTTAGAAAATGG - Intronic
1030201091 7:106905296-106905318 AAGTTTGCAGAGACAAAGGATGG + Exonic
1032102829 7:128997359-128997381 AGATTTGAAGAGGTAGAGAAGGG + Intronic
1032743949 7:134767025-134767047 ATGTTTACAGACAGAGAGGAGGG + Intronic
1032868322 7:135952575-135952597 ATGTTGGTACAGAAAGAGAATGG - Intronic
1032951764 7:136922535-136922557 ATGTGTGTAGACATAGAGTATGG - Intronic
1033037262 7:137886383-137886405 AGGTTAGAAGAGAGAGAGAAAGG + Intronic
1033259338 7:139829067-139829089 ATGTTTGCTGAGAAACAAAATGG - Intronic
1034033376 7:147792332-147792354 AAGTTGGCGGAGATAGAAAATGG - Intronic
1035137253 7:156716239-156716261 AGATTTGGATAGATAGAGAAAGG + Intronic
1036379824 8:8229183-8229205 GTGATGGAAGAGATAGAGAAGGG + Intergenic
1036402859 8:8425901-8425923 GAGTCTGCAGAGATAGAAAAAGG + Intergenic
1036734619 8:11300077-11300099 ATGTTTGAAGTGATAGAAGATGG + Exonic
1037188788 8:16097451-16097473 TTGTTTGCAGAGAGAGGGAATGG - Intergenic
1037244568 8:16818140-16818162 ACCTTTGCTGAAATAGAGAAGGG + Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1040799991 8:51329856-51329878 ATGTTTATGGAGATTGAGAAGGG + Intronic
1041311175 8:56518115-56518137 ATGTTTGCAGAAAAAGAAAATGG - Intergenic
1041408671 8:57529335-57529357 CTGTTTCCAGATATAAAGAAAGG + Intergenic
1041884687 8:62794811-62794833 GTGAGTGCAGAGATAGTGAAGGG + Intronic
1042355373 8:67822257-67822279 GTGTTTGCAGGGTTAGAGATAGG - Intergenic
1043240902 8:77934697-77934719 AGGTTTGCAGTGAGAGATAATGG - Intergenic
1043282321 8:78483695-78483717 ATGTTTGCAGGGAGAGTGAAAGG - Intergenic
1043293888 8:78639926-78639948 AAGTCTACAGAGACAGAGAACGG - Intergenic
1043596568 8:81894039-81894061 ATGTATGTGGAGATAGAGATAGG + Intergenic
1044328071 8:90883542-90883564 CTGTTTGCAGTGTCAGAGAATGG + Intronic
1044422926 8:92019387-92019409 GTGGTTGCACAGACAGAGAAAGG + Intronic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045041596 8:98229553-98229575 ATTTTTGCAGAGATAGGGTCTGG + Intronic
1045157541 8:99493481-99493503 TTATTTGAAGAGAGAGAGAATGG + Intronic
1045346948 8:101301924-101301946 ATGTTGGGAGAGACAGAGAATGG - Intergenic
1045643684 8:104279880-104279902 ATGATTACAGAGAAAGGGAAAGG + Intergenic
1045864826 8:106852892-106852914 AAGATTGGAGAGAGAGAGAAAGG + Intergenic
1046343070 8:112884181-112884203 TTGTTTGAAAAGATAGAGTAAGG - Intronic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1049409989 8:142468799-142468821 ATGTGTGCAGAGACAGAGGCAGG - Intronic
1050399622 9:5238265-5238287 ATATTTACAGAGACAGAGCATGG + Intergenic
1051540443 9:18210205-18210227 ATATTTGGAGGGAAAGAGAAAGG - Intergenic
1052348375 9:27433293-27433315 ATGTGTTCAGAGCTAGAAAAGGG - Intronic
1052651845 9:31313787-31313809 ATGTATGCAGAAATACAGAATGG - Intergenic
1054989177 9:71301886-71301908 ATGTTTCCACAGAAATAGAAAGG - Intronic
1055831603 9:80385883-80385905 ATGTATTCAGAGATAGTGACTGG + Intergenic
1056936868 9:90921651-90921673 AAGTTTCCAGAGAGAAAGAAGGG - Intergenic
1057851912 9:98572567-98572589 TTGTTTCCAGAGATGGTGAAGGG - Intronic
1059788745 9:117616705-117616727 TTGTTTCCAGAGAGAGATAAGGG - Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059890255 9:118794346-118794368 ATGTTCACAGAAATAGTGAATGG + Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1185582005 X:1216978-1217000 AAGTCTGCAGAGAGAGAGAAAGG + Intergenic
1185918550 X:4063369-4063391 ATGTTTGCAGATGTAGCTAAGGG + Intergenic
1186231214 X:7456497-7456519 ATATTTGAAGAGCTAGTGAATGG - Intergenic
1187228007 X:17392659-17392681 ATATATGAAGAGAGAGAGAAAGG - Intronic
1188150036 X:26661979-26662001 ATATTACCAGAGATAAAGAAGGG + Intergenic
1188643917 X:32540605-32540627 ATGTTTGTTGAGAGAGTGAATGG - Intronic
1188964989 X:36539952-36539974 TTTTTTGCAGAGATAGAGACAGG + Intergenic
1190429822 X:50368315-50368337 GGGTTTGCAGAGAGAGAGAGAGG + Exonic
1190844263 X:54176774-54176796 ATGTTTGCCGTGAGAGAGATTGG - Intronic
1191780207 X:64856480-64856502 GTGTTAGTGGAGATAGAGAAGGG - Intergenic
1191968263 X:66785199-66785221 ATGATTCCATTGATAGAGAAGGG - Intergenic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1193855391 X:86595027-86595049 AAATTTACAGAGATAAAGAAGGG - Intronic
1194153027 X:90349909-90349931 ATGTTTTAAGAGACAGACAAAGG - Intergenic
1194835314 X:98674222-98674244 AGGTTTGTAGATATAAAGAATGG + Intergenic
1196353045 X:114755441-114755463 GTGATTGCAGAGGCAGAGAAGGG - Intronic
1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG + Intergenic
1197326551 X:125101532-125101554 ATGTTTGCTTAGAAAGACAATGG + Intergenic
1199202525 X:145109282-145109304 ATTTTGGCAGAGCTAGAGAACGG + Intergenic
1199207962 X:145171500-145171522 ATGTTTACAAAGATTGAGACTGG + Intergenic
1199482748 X:148315574-148315596 AATTTTGCATTGATAGAGAATGG - Intergenic
1199517298 X:148692721-148692743 ATGTGTGCAGAGACAAAGGATGG + Intronic
1200325344 X:155232415-155232437 ATGTTTGCAGATTTGGTGAAAGG - Intronic
1200499371 Y:3926711-3926733 ATGTTTTAAGAGACAGACAAAGG - Intergenic
1201295289 Y:12457331-12457353 ATGTATGCATAGATACATAAAGG + Intergenic
1202106260 Y:21370200-21370222 ATATTTTTAAAGATAGAGAAGGG + Intergenic