ID: 902268636

View in Genome Browser
Species Human (GRCh38)
Location 1:15287382-15287404
Sequence GACTCACAGTTCCCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22190
Summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902268632_902268636 15 Left 902268632 1:15287344-15287366 CCAGAGACTGTGTAATTTAAAAA 0: 6
1: 249
2: 8258
3: 16211
4: 15368
Right 902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG 0: 5
1: 251
2: 3897
3: 9101
4: 8936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902268636 Original CRISPR GACTCACAGTTCCCCAGGGC TGG Intronic
Too many off-targets to display for this crispr