ID: 902270185

View in Genome Browser
Species Human (GRCh38)
Location 1:15298617-15298639
Sequence GTGATAGACATGATATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902270185_902270189 4 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270189 1:15298644-15298666 TCTTGGTCAAAGCAGATCACAGG 0: 1
1: 0
2: 7
3: 32
4: 229
902270185_902270194 27 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270194 1:15298667-15298689 GCCAGCCTAGATTTAGGGGCTGG 0: 1
1: 1
2: 4
3: 34
4: 189
902270185_902270196 28 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270196 1:15298668-15298690 CCAGCCTAGATTTAGGGGCTGGG 0: 1
1: 0
2: 4
3: 19
4: 185
902270185_902270192 22 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270192 1:15298662-15298684 ACAGGGCCAGCCTAGATTTAGGG 0: 1
1: 3
2: 21
3: 91
4: 299
902270185_902270193 23 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270193 1:15298663-15298685 CAGGGCCAGCCTAGATTTAGGGG 0: 1
1: 1
2: 3
3: 44
4: 181
902270185_902270191 21 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270191 1:15298661-15298683 CACAGGGCCAGCCTAGATTTAGG 0: 1
1: 2
2: 6
3: 22
4: 141
902270185_902270190 5 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270190 1:15298645-15298667 CTTGGTCAAAGCAGATCACAGGG 0: 1
1: 1
2: 23
3: 173
4: 649
902270185_902270197 29 Left 902270185 1:15298617-15298639 CCACCCAATATCATGTCTATCAC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902270197 1:15298669-15298691 CAGCCTAGATTTAGGGGCTGGGG 0: 1
1: 0
2: 0
3: 36
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902270185 Original CRISPR GTGATAGACATGATATTGGG TGG (reversed) Intronic
902270185 1:15298617-15298639 GTGATAGACATGATATTGGGTGG - Intronic
905240373 1:36577105-36577127 GGGATAGATTTGATATAGGGTGG + Intergenic
909521193 1:76569738-76569760 GTGAGAAATATGATATTTGGAGG - Intronic
909819116 1:80037115-80037137 ATTATAGTCATGAAATTGGGGGG - Intergenic
911506772 1:98762662-98762684 TTGATATACAGGATTTTGGGGGG + Intergenic
913564621 1:120059845-120059867 GTCAAATACATGATTTTGGGTGG - Intronic
913633509 1:120733720-120733742 GTCAAATACATGATTTTGGGTGG + Intergenic
914285208 1:146219192-146219214 GTCAAATACATGATTTTGGGTGG - Intronic
914546239 1:148669931-148669953 GTCAAATACATGATTTTGGGTGG - Intronic
914620326 1:149400732-149400754 GTCAAATACATGATTTTGGGTGG + Intergenic
919374119 1:196770770-196770792 ATTACAGACATGATATTTGGTGG - Intergenic
921586667 1:216954679-216954701 GTGATAGCCTTGATATTCTGAGG - Intronic
1063283406 10:4656619-4656641 ATGATAGACATTATGTTTGGAGG + Intergenic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1066298650 10:34077736-34077758 GTTATTTAAATGATATTGGGTGG - Intergenic
1066746535 10:38607308-38607330 TGGATAGACATGATAAAGGGTGG + Intergenic
1068295442 10:55065462-55065484 GTGATAGACATGATAGTGACTGG - Intronic
1068729803 10:60344210-60344232 GATATAGACATGATATTAGATGG - Intronic
1069637374 10:69933491-69933513 GTGAGAGACAGGATGTTTGGTGG + Intronic
1071940607 10:90587543-90587565 GGCATAGACATGAAATTGGAGGG + Intergenic
1072960856 10:99927766-99927788 GAAATGGAAATGATATTGGGTGG + Intronic
1082215998 11:49570318-49570340 GTGAGAGAGATGATAGTGGTTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083676362 11:64327761-64327783 GAGAGAGAAAGGATATTGGGTGG + Intergenic
1087122101 11:94585849-94585871 GTGGTTGACATGAAATTGGCAGG + Intronic
1090963482 11:131578139-131578161 GTGCATGACATGAAATTGGGAGG + Intronic
1092337399 12:7645405-7645427 GGGAGAAATATGATATTGGGTGG - Intergenic
1092590613 12:9950586-9950608 GTGAAAAACATGGGATTGGGTGG + Intergenic
1094160627 12:27386212-27386234 GGGATAGAAAGGATATTGTGTGG + Intronic
1102706600 12:114886214-114886236 GTGACACGCATGATATTGGTAGG + Intergenic
1105263355 13:18796269-18796291 GAGAAAGACATGAGATTGGGGGG - Intergenic
1106662219 13:31811341-31811363 GAGAAAGACATGAGATTTGGCGG + Intergenic
1108832648 13:54498901-54498923 GAGAAGGACATGAAATTGGGAGG + Intergenic
1109608605 13:64733095-64733117 CTGAAAGAGATGATATTAGGAGG - Intergenic
1109962273 13:69645849-69645871 GAGATAGACATGATATTTGGCGG + Intergenic
1114140333 14:19902058-19902080 GAAAAAGACATGAGATTGGGAGG + Intergenic
1114688301 14:24555930-24555952 GAGAAAGACATGATATTTGGGGG + Intergenic
1115875232 14:37853931-37853953 GTGATAGTCCTGATATGGGCTGG + Intronic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1121493176 14:94374505-94374527 CTGATAGAGCTGATATTGGAGGG + Intergenic
1127027700 15:54825377-54825399 GAGATAGAAATGATATGGGAGGG - Intergenic
1127465982 15:59245112-59245134 GGGATAAACAAGAAATTGGGTGG + Intronic
1128472515 15:67967259-67967281 GTAATAGACCTTATTTTGGGAGG + Intergenic
1135062536 16:19283170-19283192 GTCATTGTGATGATATTGGGAGG + Intergenic
1139096615 16:63712060-63712082 CTGATTGACATGCTATTGTGTGG + Intergenic
1139565492 16:67773016-67773038 GAGAAAGACATGAAATTTGGGGG + Intronic
1140636308 16:76918817-76918839 GTGATAAAGATTATATTGGCTGG + Intergenic
1143455867 17:7067323-7067345 GAGAAGGACATGAGATTGGGAGG - Intergenic
1150510523 17:65747673-65747695 CTGATGGAAATGATATTTGGGGG + Intronic
1153517611 18:5918747-5918769 GTGAAAGACCTGAGATCGGGAGG + Intergenic
1155222091 18:23694766-23694788 GAGACAGACATGATAATGGATGG - Intronic
1156191492 18:34726317-34726339 GAGAAAGACATGAAATTCGGGGG - Intronic
1158209477 18:55031033-55031055 GGAATAGACATGATTTTGGATGG - Intergenic
1158452285 18:57577910-57577932 GAGAGAGACAAAATATTGGGTGG + Intronic
1158571626 18:58601518-58601540 GTGAGAGAAATGATATTGGGTGG + Intronic
1158904672 18:62000632-62000654 GAGAAGGACATGAAATTGGGAGG - Intergenic
1159201020 18:65184162-65184184 GTAATAAACATAATATTAGGTGG + Intergenic
1164286736 19:23823507-23823529 GTGAAAGAGATGGTTTTGGGAGG - Intronic
1166972005 19:46575195-46575217 ATGATATATATGATATTGGGAGG + Intronic
1168168094 19:54568018-54568040 GTGATAGAAATGAACTTGGCAGG + Intergenic
926564047 2:14450622-14450644 CTGATAGACCTGAGAATGGGAGG + Intergenic
926973153 2:18486853-18486875 GTGATAGACATGAGAGTTAGGGG + Intergenic
932101975 2:68909148-68909170 GAGATGGAGATGATATTGGGAGG + Intergenic
932489417 2:72110850-72110872 GTGATAAACTCGAAATTGGGAGG + Intergenic
934494047 2:94782154-94782176 GAGAAAGACATGAGATTTGGGGG - Intergenic
936501381 2:113069536-113069558 GTGAGAGAAATGAAATTGGGAGG + Intronic
941257724 2:163254344-163254366 GTGTTAGACATAAGATTGGCAGG + Intergenic
941994159 2:171585799-171585821 GAGACAGATATGACATTGGGTGG - Intergenic
944526875 2:200628510-200628532 TTTACAGACATGCTATTGGGTGG + Intronic
945538506 2:211051150-211051172 ATGATAGGAATGATATAGGGAGG - Intergenic
1170090986 20:12589534-12589556 CTTAAAGACATGCTATTGGGAGG + Intergenic
1170159952 20:13300764-13300786 TTGATTGACATGATTGTGGGTGG + Intergenic
1173375726 20:42481285-42481307 GTGTTAGCCATGAGATTAGGAGG - Intronic
1173474058 20:43346147-43346169 GTGATAGAGATGATTAAGGGAGG - Intergenic
1173986557 20:47266196-47266218 GTGGCATTCATGATATTGGGAGG - Intronic
1176670382 21:9728530-9728552 GTCATTGTGATGATATTGGGAGG - Intergenic
1176847073 21:13884919-13884941 GAGAAAGACATGAGATTGGGGGG - Intergenic
1177305000 21:19303904-19303926 GTGTTAGTGATGTTATTGGGGGG - Intergenic
1178126924 21:29526114-29526136 GAGAAAGACATGAGATTGGGAGG - Intronic
1181550219 22:23634129-23634151 TTAAGAGACATGATGTTGGGAGG + Intergenic
1181893239 22:26083409-26083431 GTCAAGGACATGATATTGAGTGG + Intergenic
1182685040 22:32115956-32115978 GTGATAGACTTGGGATTGGTTGG - Intergenic
951576743 3:24122283-24122305 GTTATAAAAATGATATTGGAAGG + Exonic
952635741 3:35528445-35528467 ATGACAGAAATGATATAGGGAGG + Intergenic
959380311 3:105633404-105633426 GTTGTAGACATGAAATTGGCAGG - Intergenic
959712784 3:109401569-109401591 ATGATGGACATGAATTTGGGGGG + Intergenic
960209448 3:114942521-114942543 TTGATTGACATGATATTTGAGGG - Intronic
963197161 3:142545077-142545099 GTGATAGATAATATATTGGTAGG - Intronic
970770208 4:19603127-19603149 ATGATAGTGATGATATTAGGGGG - Intergenic
972234563 4:37115952-37115974 GTGAGAGAGATGATATTGGCTGG + Intergenic
975506054 4:75139227-75139249 GTGATAGACATGGTATAATGTGG - Intergenic
976006518 4:80436704-80436726 GAGATAAAGATGATTTTGGGGGG + Intronic
979398445 4:120218275-120218297 GTGATACAAATGATATTGTTTGG - Intergenic
981653369 4:147084210-147084232 GTGAGACACATGAGATTGGAAGG + Intergenic
983384054 4:167035572-167035594 GTGAGAGACATGATCAGGGGTGG - Intronic
985404393 4:189623010-189623032 GTCATTGTGATGATATTGGGAGG + Intergenic
988671299 5:33384879-33384901 GAGAAAGACATGAAATTTGGAGG - Intergenic
988756581 5:34259554-34259576 GTGAAAGACATGCTATTGATTGG + Intergenic
988996862 5:36723283-36723305 GTGATACACACGGTATTTGGAGG + Intergenic
990019682 5:51109822-51109844 GACATAGACATGCTGTTGGGTGG - Intergenic
992778863 5:80110358-80110380 GTGCTAGACAATACATTGGGGGG + Intergenic
994216711 5:97145492-97145514 GTGATAGTCATGATATGGTTTGG - Intronic
999080189 5:148836226-148836248 GTGACAGTGATGCTATTGGGAGG - Intergenic
1001687660 5:173606571-173606593 GGGATAGGCAAGATGTTGGGAGG + Intergenic
1002392698 5:178928238-178928260 GAGAAAGACATAAGATTGGGAGG - Intronic
1003953038 6:11136005-11136027 GTGAAACACATGTTTTTGGGGGG + Exonic
1005896254 6:30181801-30181823 GTGATAGACAAGAGATGGAGAGG + Intergenic
1006521111 6:34571793-34571815 GTGATAGACAGTAGATTGCGAGG - Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1022207224 7:28176550-28176572 GTGATACACAGTATGTTGGGAGG - Intronic
1022338855 7:29449709-29449731 GTGATTGACATTATAGTGGTTGG + Intronic
1022512677 7:30950806-30950828 GAGAAAGACATGAGATTTGGGGG + Intronic
1022703306 7:32781320-32781342 GAGAAGGACATGATATTTGGGGG - Intergenic
1022907544 7:34871454-34871476 GAGAAGGACATGATATTTGGGGG - Intronic
1023309414 7:38868537-38868559 GTCATAGTCAGAATATTGGGGGG - Intronic
1023614220 7:42002608-42002630 GTGATATATATGATATTCTGTGG - Intronic
1023712949 7:43014108-43014130 GTGATTGAAAGGATATGGGGTGG - Intergenic
1030335324 7:108319208-108319230 TTAATAGACATGATATTTGTAGG + Intronic
1030621996 7:111800367-111800389 GGGAGAGATATGTTATTGGGTGG - Intronic
1031182276 7:118433643-118433665 GAGAAGGACATGAGATTGGGAGG + Intergenic
1032830737 7:135622903-135622925 GTGATGGTCATGAGATTGGAAGG + Exonic
1033426129 7:141245851-141245873 GTGATAGAAATGTTATTGTGTGG + Intronic
1037150480 8:15629095-15629117 GTGATATACATGATTTTCGATGG + Intronic
1037496769 8:19447945-19447967 GTGATAGACATGCTGGTGGTGGG + Intronic
1042081823 8:65062106-65062128 ATAATAGATATGAAATTGGGAGG + Intergenic
1042091837 8:65166825-65166847 GTGATTTACATCATACTGGGAGG + Intergenic
1042975797 8:74467714-74467736 GTGTTAAACAAGATAGTGGGAGG + Intronic
1046086678 8:109445359-109445381 GTGATAGAGATGCTACTGGGGGG - Exonic
1047101227 8:121678262-121678284 GTGAAAGTCATGAAATTGGATGG + Intergenic
1048018002 8:130514535-130514557 GTGACAGACGCGATATTGGGTGG + Intergenic
1048516272 8:135114336-135114358 GAGAAAGACATGAGATTTGGGGG + Intergenic
1050692232 9:8241009-8241031 GTGACAGACATGATATGGGAAGG + Intergenic
1051502781 9:17796068-17796090 GTGATAGACAATATCTTCGGTGG - Exonic
1053663021 9:40297850-40297872 GAGAAAGACATGAGATTTGGGGG + Intronic
1053664466 9:40307923-40307945 GAGAAAGACATGAGATTTGGGGG + Intronic
1053913525 9:42928380-42928402 GAGAAAGACATGAGATTTGGGGG + Intergenic
1054375146 9:64444074-64444096 GAGAAAGACATGAGATTTGGGGG + Intergenic
1054520148 9:66068361-66068383 GAGAAAGACATGAGATTTGGGGG - Intergenic
1054521594 9:66078434-66078456 GAGAAAGACATGAGATTTGGGGG - Intergenic
1055312236 9:74994388-74994410 TTAATAGAAAAGATATTGGGAGG + Intronic
1056397388 9:86194152-86194174 GAGAAAGACATGAGATTTGGGGG + Intergenic
1057677039 9:97144004-97144026 GAGATGGATATGATATTTGGGGG - Intergenic
1058423938 9:104860292-104860314 GTGACAGATATGAAATTGGCAGG + Intronic
1186531449 X:10299832-10299854 GAGGAATACATGATATTGGGGGG + Intergenic
1186839621 X:13472000-13472022 GCTACAGACATAATATTGGGTGG + Intergenic
1189918909 X:45884383-45884405 GGGATAGACATTTTAGTGGGTGG + Intergenic
1190153467 X:47967647-47967669 GAGAAAGACATGAGATTTGGGGG + Intronic
1190501725 X:51085724-51085746 GTGACAGACATGATATTTAAGGG - Intergenic
1190703462 X:53005683-53005705 GAGAAAGACATGAGATTTGGGGG - Intergenic
1194105035 X:89758107-89758129 GTGAGAAATATGTTATTGGGTGG + Intergenic
1194306700 X:92257373-92257395 GAGAAAGACATGAGATTTGGGGG - Intronic
1194829603 X:98605656-98605678 GAGAGAAACATGATATTGTGTGG - Intergenic
1195365031 X:104116891-104116913 GTGATAGGAATGAGATTGTGGGG - Intronic
1196097536 X:111816079-111816101 GAGATAGAAATGATATTCAGTGG + Intronic
1200738597 Y:6828676-6828698 GTGCTAGACATGATGCTGGGTGG + Intergenic
1200837174 Y:7743868-7743890 GTGATAGTGGTGATATTGGTGGG - Intergenic