ID: 902272928

View in Genome Browser
Species Human (GRCh38)
Location 1:15317524-15317546
Sequence CAGGGTTTCAAGTGAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902272923_902272928 11 Left 902272923 1:15317490-15317512 CCTTTAGATTGAACTCAAAAATA 0: 1
1: 0
2: 0
3: 21
4: 268
Right 902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG 0: 1
1: 0
2: 2
3: 10
4: 156
902272921_902272928 24 Left 902272921 1:15317477-15317499 CCAAACAGTTGGCCCTTTAGATT 0: 1
1: 0
2: 0
3: 10
4: 115
Right 902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG 0: 1
1: 0
2: 2
3: 10
4: 156
902272922_902272928 12 Left 902272922 1:15317489-15317511 CCCTTTAGATTGAACTCAAAAAT 0: 1
1: 0
2: 5
3: 42
4: 405
Right 902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG 0: 1
1: 0
2: 2
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902272928 Original CRISPR CAGGGTTTCAAGTGAGTTGA TGG Intronic
902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG + Intronic
903404614 1:23085938-23085960 GAGGGTTCCTAGTGAGTTGGGGG - Exonic
907149624 1:52271672-52271694 CAGGCCTTCAAGTCAGTTAATGG + Intronic
907954514 1:59215432-59215454 CAGTGTTTCAGGTAAGTTCAGGG + Intergenic
911041463 1:93594287-93594309 CAGGGCTTCAGATGACTTGAGGG - Intronic
912634269 1:111277375-111277397 AAGGCTTTCAGGTGAGTTCAAGG - Intergenic
916934781 1:169616387-169616409 CAGGGTTCTAAGCTAGTTGATGG - Intronic
920771897 1:208894293-208894315 TATGGTTTCCAGTGAGTTGAGGG - Intergenic
922551594 1:226498214-226498236 CAGGCTTTCATGTGGATTGAAGG - Intergenic
923932505 1:238718204-238718226 TGTGTTTTCAAGTGAGTTGAAGG + Intergenic
1063087716 10:2834582-2834604 CAAGGATTGAAGTGAGATGAGGG - Intergenic
1063586327 10:7356339-7356361 CAGGATTTCAAAGGAGTTCAAGG + Intronic
1066989624 10:42500570-42500592 TAAGGTTTCAAGTGTCTTGATGG - Intergenic
1067535799 10:47109008-47109030 CAGGGCCCCAAGTGGGTTGATGG + Intergenic
1067678441 10:48408534-48408556 CAGGAGATGAAGTGAGTTGATGG + Intronic
1070471502 10:76784938-76784960 GAGGTTTTCAAGTTAGTTGGTGG - Intergenic
1071170370 10:82857126-82857148 CAAGGTTTCAACTGAGGTTAAGG - Intronic
1073620843 10:105046829-105046851 CCAGGTATCAAGTGAGTGGAAGG - Intronic
1078024831 11:7685113-7685135 CTGGGTTTCCAGTGACTTGGTGG + Intergenic
1078506980 11:11959459-11959481 GAGGGTTTCAAAGGAGTTCATGG + Intergenic
1079451974 11:20605585-20605607 CAGGGCTTCCAGTGACTAGAAGG + Intronic
1081239043 11:40680561-40680583 AAGGGTCTCAAGAGATTTGATGG + Intronic
1084314216 11:68334948-68334970 CAGGGTTCCCAGTGACTTTATGG - Intronic
1084955698 11:72690179-72690201 CAAGCAGTCAAGTGAGTTGAGGG + Intronic
1086862359 11:91939814-91939836 CAGGCCTTCAATTGATTTGATGG - Intergenic
1087389256 11:97513545-97513567 CAGGGTTCCAAGTGATTTGAGGG + Intergenic
1087791842 11:102414215-102414237 CAGGGATGCCAGTGAGTTGTAGG - Intronic
1088166282 11:106941531-106941553 CAGGACTTCAAATGAGATGATGG - Intronic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089980964 11:122772219-122772241 CAGGGTGTCAAGAGAGCTCACGG - Intronic
1092200978 12:6582603-6582625 AAAGAGTTCAAGTGAGTTGAGGG - Exonic
1093624680 12:21331230-21331252 AAGGGGTTCAAGTCATTTGATGG + Intronic
1095368475 12:41437697-41437719 CAGAGTTTCCAGTCAGTTCATGG - Intronic
1095716474 12:45351564-45351586 CAGAGTGGGAAGTGAGTTGAGGG + Intronic
1096675750 12:53224880-53224902 CAGGGTTCAAAGTGAGATTAAGG - Intronic
1100509758 12:95258163-95258185 CAGGGTTTCATCTTTGTTGAAGG + Intronic
1102528193 12:113526983-113527005 AAGGTTTCCCAGTGAGTTGATGG - Intergenic
1103645011 12:122384911-122384933 AAGGGAAACAAGTGAGTTGATGG + Intronic
1106379773 13:29224944-29224966 CAGGGTTTAGTGGGAGTTGAGGG + Intronic
1107512030 13:41094614-41094636 CAAGGTTTCAAGTGGTTTGAAGG + Intergenic
1113240862 13:108335581-108335603 CATGATTTCAAGTGGTTTGATGG + Intergenic
1114589712 14:23850233-23850255 TAAGGTTTCAAATGAGTTTAGGG - Intergenic
1114948090 14:27712272-27712294 CTGAATTTCAAGTGTGTTGAGGG - Intergenic
1117528193 14:56632499-56632521 CAAGGTTTGAAGAGAGTGGAGGG - Intronic
1118819257 14:69334429-69334451 CAGGGTTGCAAGTGAGATGGAGG + Intronic
1121532713 14:94668854-94668876 CATGGTCTCATGAGAGTTGATGG - Intergenic
1127336636 15:57992651-57992673 CAGTCTTGCAAATGAGTTGAGGG - Intronic
1131322322 15:91406355-91406377 CATGATTTGAAGTGAGTTGATGG + Intergenic
1131416595 15:92265002-92265024 CAGGGATTTTAGTGAGTGGATGG + Intergenic
1133313184 16:4864523-4864545 CAGGGAATCCAGTGATTTGATGG + Intronic
1135174259 16:20214301-20214323 AAGAGTTTTAAGTGAGGTGAAGG + Intergenic
1135475338 16:22769567-22769589 CTAGGTTTCAGGTGAGGTGATGG + Intergenic
1138465209 16:57185512-57185534 CCAGGTTTCAAGTGAGTAGCAGG - Intronic
1146307307 17:31740352-31740374 TAGGGTTTCTAGTGAATAGAGGG + Intergenic
1148639155 17:49172290-49172312 CAAGGTTTCAGGTGTCTTGATGG + Intergenic
1148972295 17:51494435-51494457 CAGGGTGTCAAGTGAGGAGATGG + Intergenic
1152828695 17:82483965-82483987 CAGGGCTGCCAGGGAGTTGAAGG + Intronic
1158830724 18:61274978-61275000 CAGGGTTTCTAATGAATTGTTGG + Intergenic
1159859910 18:73635487-73635509 CAGCCTTTCTAGTAAGTTGAGGG - Intergenic
1160211187 18:76881391-76881413 CAGCGTTTCAAATGAGCAGACGG + Exonic
1163185018 19:15631852-15631874 AAGGTTTTCAAGTGAGAGGAAGG + Intronic
1166060658 19:40323509-40323531 CAGGGCTTCCAGTGAGGGGACGG + Intronic
1166331443 19:42080198-42080220 CAGGTTGGCAGGTGAGTTGAAGG - Exonic
1167861176 19:52285294-52285316 CAGTGTTGGAAGTGAGTTGGAGG - Intronic
1167968630 19:53170818-53170840 CAGATTTTCAACTGAGTGGAGGG - Intronic
926424885 2:12731612-12731634 CAAGGTTTCAAATGTGTTCATGG + Intronic
928159545 2:28909521-28909543 CAGGATCTCCAGTGATTTGAAGG - Intronic
929101702 2:38321078-38321100 CCGGGTTTCAGGTGGGTTGTGGG + Intronic
929814405 2:45219783-45219805 CCCTGTTCCAAGTGAGTTGATGG + Intergenic
930603617 2:53469834-53469856 CTGGGTTTGAAGTGTGTTCAAGG + Intergenic
932994356 2:76831641-76831663 CATGGTTTCAATTTAGTTTATGG - Intronic
934969345 2:98750440-98750462 CAGGGATTCAAGTGATTTAATGG + Intergenic
937377189 2:121345381-121345403 CAAAGGTTCAAATGAGTTGATGG + Intronic
940436980 2:153667150-153667172 CAGGGTTGCCAATGAGTTGTAGG - Intergenic
942303755 2:174586636-174586658 CAGGGGTTCTAGTGAGGCGAAGG - Intronic
943785780 2:191877116-191877138 AAGGTTTTCCAGTCAGTTGATGG + Intergenic
944300003 2:198112848-198112870 TAAGATTCCAAGTGAGTTGAGGG - Intronic
945699855 2:213155746-213155768 CAGGGATTCAAGTTATTTTAGGG - Intergenic
948760308 2:240186155-240186177 CAGGGCTTCATGGGAGTTGGTGG + Intergenic
1168809884 20:698271-698293 CAGGGTCTCAGGTGAGTAAAAGG + Intergenic
1170275040 20:14576253-14576275 CAGGTTTTGATGTGATTTGATGG + Intronic
1170319518 20:15079652-15079674 GAGGGAGTCAAGGGAGTTGAGGG - Intronic
1170847357 20:19973862-19973884 CAGTGTTCCATGTAAGTTGAGGG - Intronic
1172318289 20:33974017-33974039 GACTGTTTCAAGAGAGTTGACGG - Intergenic
1173629198 20:44497659-44497681 TAGCGTTTCAAGGGATTTGAGGG - Exonic
1175296306 20:57911126-57911148 CAGGTTTTCAATGGAGTTCACGG - Intergenic
1178897508 21:36571590-36571612 GAAGGTTTCCAGTGAGATGAAGG + Intronic
1179289413 21:40005777-40005799 CAGTGTCTCCAGTGAGTTCAGGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182517504 22:30867370-30867392 CAGGGTTTGAAGAAAGTTGGGGG - Intronic
1184272851 22:43394606-43394628 CAGGGTTTCGAGCGAGATGGCGG + Intergenic
1184401149 22:44275342-44275364 CAGGGGTTTAATTGAGGTGATGG - Intronic
949199946 3:1364484-1364506 AAGGGTTTCAACTGAGTTGAAGG + Intronic
954234356 3:49244832-49244854 CAGGGTTTCAGATGAGAGGATGG + Intronic
956738707 3:72258672-72258694 CTGGGTTTGCAGTGTGTTGAGGG - Intergenic
957253226 3:77802314-77802336 GAAAATTTCAAGTGAGTTGATGG - Intergenic
957682038 3:83449411-83449433 CAGGATTTCAAGTGAATACAAGG + Intergenic
958261313 3:91384386-91384408 CAGTGATCCAAGTGAGATGATGG + Intergenic
959081412 3:101805510-101805532 CAGGAAGTCAAGTGAGCTGAAGG - Intronic
959111198 3:102124509-102124531 CAGGGTTCCTAGGGAGGTGAGGG - Intronic
961022170 3:123517406-123517428 CTGTGTTTGAATTGAGTTGAAGG - Intronic
961521538 3:127469891-127469913 CAGTATCTCAAGTGAGCTGATGG + Intergenic
962120303 3:132554080-132554102 CTGGGATTCTAGTGAATTGATGG - Intergenic
964545622 3:157830378-157830400 CAGGGTGGAAAGTGAATTGAAGG + Intergenic
965011382 3:163096628-163096650 CAGGGTTCCTAGGGATTTGAGGG - Intergenic
965134263 3:164741421-164741443 TAGGGTTACAAGAGAGGTGAGGG - Intergenic
967531869 3:190557246-190557268 CTGGGTTTTCAGTGAGTGGAAGG - Intronic
972931292 4:44073959-44073981 TAGGCTATCAACTGAGTTGAAGG - Intergenic
974594066 4:63994686-63994708 CAGGGTTCCAAGTGGTTTGAAGG + Intergenic
976642563 4:87354410-87354432 CAGGAGTTCAATTGAGTTCAAGG + Intronic
977016432 4:91697788-91697810 TAAGGTTTCAAGTGTCTTGATGG + Intergenic
977452745 4:97219831-97219853 CAGGGTATCAAAAGATTTGATGG - Intronic
977621668 4:99145081-99145103 CAGGGCTGCAACAGAGTTGAAGG - Intronic
978045979 4:104128105-104128127 TAGGCTTTCAAGTGATTGGAAGG - Intergenic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
982069674 4:151684196-151684218 CAGTGTTTCAGGTGAGCTGTGGG - Intronic
984331617 4:178327879-178327901 CTGGCTTGCAATTGAGTTGAAGG + Intergenic
984741648 4:183170033-183170055 TAGGTTTTCAAGTTACTTGAAGG + Intronic
984881489 4:184413420-184413442 CTGTTTTTCAAGTGAGTTGCTGG + Intronic
988765553 5:34370985-34371007 CGGTGTTTCAAGTGAATTGGTGG - Intergenic
989699986 5:44252560-44252582 CAGGGCTTCAAGTAAGGAGATGG + Intergenic
991371333 5:65923826-65923848 CAGAATTTCAGGTGAGTTGGAGG + Intergenic
993196166 5:84749334-84749356 CAGGGGCTCAAGGGAGTTGCTGG - Intergenic
994335764 5:98563896-98563918 CAGGGTTGCTACTGATTTGAAGG - Intergenic
994466347 5:100138171-100138193 CTGGACTTCAAGTGATTTGATGG + Intergenic
994816897 5:104596364-104596386 CTGGGATTCGAGTGAGATGAAGG - Intergenic
999039306 5:148389571-148389593 GAGTTTCTCAAGTGAGTTGAAGG + Intronic
1000876887 5:166650769-166650791 CAAAATTTCAAGTCAGTTGAAGG + Intergenic
1006410540 6:33870969-33870991 CAGGCTTTCAAGTGAGGGGAGGG - Intergenic
1008608108 6:53160047-53160069 CAGTTTTTCAAGTGATTTCAAGG - Intergenic
1008993845 6:57635768-57635790 CAGTGATCCAAGTGAGATGATGG - Intronic
1009182455 6:60534852-60534874 CAGTGATCCAAGTGAGATGATGG - Intergenic
1010920617 6:81675563-81675585 CTGTGTTTCAAATGAATTGAGGG - Intronic
1011420858 6:87171174-87171196 GAGGGTTTGGAGTTAGTTGATGG + Intronic
1012625239 6:101396826-101396848 AAGCCTTTCAACTGAGTTGATGG + Intergenic
1013002679 6:106039999-106040021 GAGGGTTTCAAGAGAGGTGTGGG - Intergenic
1016492099 6:144616998-144617020 CAGGGTTTGAATTGAATTCATGG - Intronic
1020496276 7:8856955-8856977 CAGGTTTCCAAGTGGATTGAAGG - Intergenic
1021925764 7:25532194-25532216 CAGGGATTCAAGAGCTTTGAAGG - Intergenic
1022672945 7:32473195-32473217 CAGTGTTTCAAGTCACATGATGG - Intergenic
1023680771 7:42684999-42685021 CAGGCTTTCTAGAGAGATGAGGG + Intergenic
1031088662 7:117326723-117326745 CAGGGATTCAATTGAGATGCTGG + Intergenic
1034197371 7:149258782-149258804 GAAGGTTTCAAGTGAGATCAAGG + Intergenic
1037002976 8:13743565-13743587 CAGGCTTTGTAGTTAGTTGAAGG + Intergenic
1037966087 8:23135085-23135107 CAGGGTTCCAAGTGAGGCCATGG + Intergenic
1037971694 8:23176651-23176673 CAGGGTTTCAAGTGAGGCCGAGG + Intergenic
1044622854 8:94207504-94207526 GAGGGTTTCTAGTGAGTTACGGG - Intronic
1044949255 8:97419267-97419289 CAGGGGTGCAATTGAGTTGCAGG - Intergenic
1045109833 8:98929813-98929835 CTGCTTTTCAAGTGAGTTTATGG - Intronic
1049773891 8:144395942-144395964 CAGGGTCTCAAGTGACCTGGTGG + Intronic
1052240078 9:26261338-26261360 CAGGGCATCAAGTGAGGAGATGG + Intergenic
1052978232 9:34427862-34427884 CAAGCCTTCAGGTGAGTTGAAGG - Intronic
1055427230 9:76208594-76208616 CAGAGGTTCAAGGGAGATGATGG - Intronic
1055806278 9:80097374-80097396 GAGAGTTCCAAGTGAGTTGCAGG + Intergenic
1060778743 9:126396057-126396079 CTGGGTTTCAAATGAGTTGCTGG - Intronic
1060953187 9:127618128-127618150 CAGGGGATGAAGTGAGTAGAAGG + Intronic
1187945884 X:24426097-24426119 AAGGCTTTCAAGTGATTTGGCGG + Intergenic
1188439111 X:30197246-30197268 CAGGCTTTCAAGAGATTGGATGG - Intergenic
1189614384 X:42768630-42768652 CTGGGATTCGGGTGAGTTGAAGG - Intergenic
1190904356 X:54711121-54711143 CAGGGTTTCAAGGGAGGAGCTGG - Intergenic
1190938469 X:55017870-55017892 CAGGGTTACAAATGACTGGAGGG - Intronic
1195202082 X:102561779-102561801 CCTGGTTTTCAGTGAGTTGAGGG + Intergenic
1195656267 X:107334178-107334200 CTGCTTTTCAAGTGAGATGATGG + Intergenic
1195804101 X:108743240-108743262 CATGGTTGCAAGTGATTTGGAGG - Intergenic
1198480489 X:137035461-137035483 CAGGGTTTGGAGTTGGTTGATGG + Intergenic
1199172466 X:144746994-144747016 CAGGGTTCCAAGTGGCTTGAGGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200978913 Y:9243434-9243456 TAGGGTTTCAGGTGTCTTGATGG - Intergenic