ID: 902274005

View in Genome Browser
Species Human (GRCh38)
Location 1:15326205-15326227
Sequence ACTCCAAAGCAGAGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902274005_902274011 24 Left 902274005 1:15326205-15326227 CCTTCAAGGCTCTGCTTTGGAGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 902274011 1:15326252-15326274 GAACTGGAGACTCACGCCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 100
902274005_902274010 23 Left 902274005 1:15326205-15326227 CCTTCAAGGCTCTGCTTTGGAGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 902274010 1:15326251-15326273 TGAACTGGAGACTCACGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
902274005_902274006 8 Left 902274005 1:15326205-15326227 CCTTCAAGGCTCTGCTTTGGAGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 902274006 1:15326236-15326258 ACCACGTTTTGCCAGTGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 65
902274005_902274009 22 Left 902274005 1:15326205-15326227 CCTTCAAGGCTCTGCTTTGGAGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 902274009 1:15326250-15326272 GTGAACTGGAGACTCACGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902274005 Original CRISPR ACTCCAAAGCAGAGCCTTGA AGG (reversed) Intronic
902274005 1:15326205-15326227 ACTCCAAAGCAGAGCCTTGAAGG - Intronic
902354000 1:15882854-15882876 GCTGCCAAGCAGAGCCATGAGGG - Intronic
902405047 1:16177943-16177965 ACTCCTTATAAGAGCCTTGAAGG + Intergenic
904109211 1:28112288-28112310 ACTCCAAAGCAGAGCTCAGTGGG - Intergenic
905309867 1:37041958-37041980 ACTCCTGAGTAGAGCCTTGGGGG + Intergenic
906143875 1:43548883-43548905 TCTCCATAGAAGAGCCTTGATGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907638518 1:56160743-56160765 TCTCCAAAGCAAAGACTTGAGGG + Intergenic
907710519 1:56876394-56876416 ACTCTCAAGCAGAGACATGAGGG - Intronic
908230799 1:62103088-62103110 ACTCCACAGCAGAAACTTGAGGG - Intronic
908522911 1:64962025-64962047 ACTTCAAAGGAGTGCCATGAAGG + Intronic
911263946 1:95720882-95720904 ACTCTAGAGAAGAGCTTTGATGG - Intergenic
915247879 1:154568878-154568900 ACTCCAACCCAGTGCCTTTAGGG + Intronic
915284108 1:154842071-154842093 GCTCCAAACCAGAACCTTGGGGG + Intronic
917393368 1:174564009-174564031 ACTACAAGGCAGAGCTTTGCAGG - Intronic
918703581 1:187635503-187635525 ACCCCAGAGCTGACCCTTGATGG + Intergenic
919940043 1:202280226-202280248 GATCCAGAGCAGGGCCTTGAAGG - Intronic
921035750 1:211376649-211376671 AGGCCAAAGCAGAATCTTGAAGG - Intergenic
923490739 1:234481842-234481864 ACTGCAGAGCACAGCATTGAAGG + Intergenic
1063384197 10:5605854-5605876 ACTCCAAACCACAGACTTGTGGG + Intergenic
1067519168 10:46982263-46982285 ACTCCAAAACAAACCTTTGAGGG - Intronic
1067643077 10:48069571-48069593 ACTCCAAAACAAACCTTTGAGGG + Intergenic
1067988071 10:51174835-51174857 ACTTCAAAGGTGAGACTTGAAGG - Intronic
1070189706 10:74100778-74100800 ACTCCAAATCCTGGCCTTGATGG - Intronic
1070337049 10:75465069-75465091 CCTCCACAGCAGAGCATTTAAGG - Intronic
1071513709 10:86283161-86283183 GTGCCAAAGCAGAGCCTTGGAGG - Intronic
1072359080 10:94641266-94641288 TCTCCAAAACAGAGTTTTGAGGG - Intergenic
1073185874 10:101614727-101614749 ACCACACAACAGAGCCTTGAGGG - Intronic
1074291841 10:112143495-112143517 CCTCCAAAGCATGCCCTTGAGGG + Intergenic
1075265677 10:120998286-120998308 ACTCCAAAGCAGGGAACTGATGG - Intergenic
1076212795 10:128662498-128662520 CCTCCAAAGCAGAGCCTGAGGGG + Intergenic
1083416831 11:62531283-62531305 GCTCCAGATCTGAGCCTTGAAGG - Exonic
1084676931 11:70640731-70640753 ATTCCAGAGCCCAGCCTTGAGGG - Intronic
1085818033 11:79762143-79762165 ACTCAAAAGCAGAGTCTCCAAGG + Intergenic
1085866557 11:80301633-80301655 ACACCAAAGCAGTGGATTGAGGG - Intergenic
1087192500 11:95269814-95269836 TCTCCAAAGGAAAGCCTTAATGG + Intergenic
1087320197 11:96648971-96648993 ACACCAAAGCAAAGCCTTAAAGG - Intergenic
1088266446 11:107992354-107992376 ACTCTAAAACAGAGTCTAGATGG - Intergenic
1089785005 11:120901427-120901449 ACATCTGAGCAGAGCCTTGAAGG - Intronic
1094091352 12:26653550-26653572 GCTCCACAGCAGAGCTTAGACGG - Intronic
1096432224 12:51556080-51556102 ACTCCAAAGCAGAGGTATGCTGG - Intergenic
1096617498 12:52842186-52842208 ACTCCCAAGCAGAGCCCTCTGGG - Intronic
1098059323 12:66543215-66543237 ACTCAAAAGCCCTGCCTTGAAGG - Intronic
1098237349 12:68430112-68430134 ACTGCAAGGCTGAGTCTTGAGGG - Intergenic
1099121549 12:78695739-78695761 AGTCCAAAGTAGAGCCGAGAAGG - Intergenic
1101610850 12:106290230-106290252 ACCCCAAAGCTGAGTCTTGAGGG - Intronic
1103159088 12:118712722-118712744 AGACCAAAGCAGAGACTTCAGGG - Intergenic
1105419452 13:20239667-20239689 GCTCCAAAGCTGAGCCTTGCAGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107830222 13:44368480-44368502 GCTCCAAAGCTCAGCCATGAGGG + Intergenic
1109966326 13:69702044-69702066 ACTCCAGAATAGAGCTTTGATGG - Intronic
1110164987 13:72431053-72431075 ACTTGTAAGCAGAGGCTTGAAGG + Intergenic
1112134844 13:96565683-96565705 GCTCCAAAGGAGAGACTTTAAGG + Intronic
1112607779 13:100924328-100924350 AATGCAAAGAAGAGCCTAGAAGG - Intergenic
1114055151 14:18962026-18962048 AATCCAGAGGAGAGACTTGAGGG - Intergenic
1114107391 14:19439752-19439774 AATCCAGAGGAGAGACTTGAGGG + Intergenic
1114199811 14:20509554-20509576 ACTCCTAAGCTGAGGCTGGAGGG - Intronic
1115804888 14:37039724-37039746 ACACCAAATAAGATCCTTGAGGG - Intronic
1116089586 14:40287921-40287943 ATATAAAAGCAGAGCCTTGAAGG - Intergenic
1121024126 14:90601914-90601936 ACTCCAGAGCTGGCCCTTGATGG + Intronic
1121107114 14:91288282-91288304 ACTCCAAAGGACAGCCCTTAGGG + Intronic
1121380241 14:93459280-93459302 ACTCTTAAGATGAGCCTTGAAGG + Intronic
1125346282 15:38722117-38722139 ACTCCAAAGCAGATGCCTGGTGG - Intergenic
1128662791 15:69514335-69514357 ACTCCAGAGCACAGCTCTGAGGG - Intergenic
1130297465 15:82657235-82657257 ACACCAACACAGAGCCGTGAAGG + Intergenic
1133901297 16:9977576-9977598 ACTCCAAAGCTGAGAGTGGAAGG + Intronic
1138180879 16:54939345-54939367 ACTCCAAAAGAGGGCCTTGTGGG - Intergenic
1140241300 16:73203304-73203326 ACATGAAAGCAGGGCCTTGAAGG - Intergenic
1150443772 17:65212635-65212657 ACTCCTTAGAACAGCCTTGAAGG - Intronic
1151270356 17:72990187-72990209 AAACCGATGCAGAGCCTTGATGG + Intronic
1151943188 17:77305455-77305477 AGGACAAAGCTGAGCCTTGAAGG - Intronic
1153128632 18:1828200-1828222 ACTAGAAAGCAGTGCCTTAAAGG - Intergenic
1157087084 18:44591904-44591926 CCTCCAAAGCAGATACTTGCTGG + Intergenic
1158725892 18:59971524-59971546 GCTTCAAAACAGAGCCTTAACGG - Intergenic
1159540508 18:69768435-69768457 ACTACAAAGAAGAACCTAGAGGG + Intronic
1160059415 18:75515744-75515766 CCTCCACATGAGAGCCTTGAAGG - Intergenic
1161953013 19:7478102-7478124 ACTCCAGGGCTGAGCCTTCATGG - Intronic
1162365624 19:10247339-10247361 AGTCCAATGCAGAGGCCTGAAGG - Intergenic
1163150033 19:15405977-15405999 CCTCCCAAGCAGAGCCCTGATGG - Intronic
1164512492 19:28908998-28909020 ACTCCCAAGCTGTGCCCTGAGGG - Intergenic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
925732658 2:6931362-6931384 ACTTCAAAGGAAAACCTTGAAGG + Intronic
926227498 2:10978753-10978775 AATCCAAGGCAGAGCCAAGAAGG + Intergenic
927234656 2:20859831-20859853 ATATCAAAACAGAGCCTTGAAGG + Intergenic
927735562 2:25517913-25517935 ACTGCAACACAGAACCTTGAGGG + Intronic
929001174 2:37348322-37348344 ACTTAAAAGCAGAGCCGTGCGGG - Intronic
929802678 2:45117665-45117687 ACTCCAAAGCAGAACAGTGGAGG - Intergenic
930021389 2:47004107-47004129 ACTCCAGAGCTCAGCCTTGCCGG + Intronic
931284577 2:60821123-60821145 TCTCCAAAGCAGAACCTGCAAGG - Intergenic
932692213 2:73922487-73922509 ACTCTAACTCAGAGCCTTGTTGG + Intergenic
933216548 2:79636410-79636432 AGTCCAAAGCAGAACCATGAAGG + Intronic
935212023 2:100946392-100946414 ACTTCAAAGCAGGGACCTGAAGG + Intronic
935413209 2:102787592-102787614 ATTGCAAAGAAGGGCCTTGAAGG + Intronic
936596241 2:113851091-113851113 ACTCCTAAGCAGAGCTTTCATGG + Intergenic
937937408 2:127257204-127257226 GCTACAAAGTAGGGCCTTGATGG + Intergenic
938473162 2:131584812-131584834 AATCCAGAGGAGAGACTTGAAGG - Intergenic
939934897 2:148279135-148279157 AATCAAAAGCAGAGCCATCAAGG + Intronic
940001322 2:148968975-148968997 ACTCCAGAGCAGAGATTTGCTGG - Intronic
943271557 2:185811814-185811836 GCTGCAAAGCATAGCCTTGGTGG + Intronic
943984076 2:194596201-194596223 ATTCCTAAGCAAAGCATTGAAGG - Intergenic
944563190 2:200962247-200962269 GCACCAAGGCAGTGCCTTGAGGG - Intronic
945474383 2:210264145-210264167 ACTCCAGAGCACTGCCTGGAGGG - Intergenic
946035505 2:216738998-216739020 ATTCCAAATCAGAGTCTTGAAGG + Intergenic
947195704 2:227565055-227565077 ACTCCACCACAGTGCCTTGAAGG + Intergenic
1169962130 20:11172525-11172547 AATCCATATCAGAGCCTTAAAGG + Intergenic
1170149879 20:13218727-13218749 ACTCAAAAACAGAGCCCTGCTGG + Intergenic
1170548891 20:17458547-17458569 ACTCCAAATGAGAGCCCAGAGGG + Intronic
1175428161 20:58883595-58883617 ACTCAACAGCAGAGCCCAGATGG - Intronic
1177828674 21:26112184-26112206 GCTCCAAGGCAGAGGCTTGGAGG + Intronic
1180473633 22:15684576-15684598 AATCCAGAGGAGAGACTTGAGGG - Intergenic
1181929233 22:26386256-26386278 ATTCCAAAGCAAAGTGTTGAAGG - Intergenic
1183005933 22:34902153-34902175 AGTCCAAAGCAGAGACTTGCAGG + Intergenic
1183034106 22:35127739-35127761 ACTCCTAAGCTGAGTCTTGAAGG - Intergenic
1183717261 22:39540688-39540710 TCTCCAAAGCCCAGCCCTGAGGG - Intergenic
949924030 3:9026814-9026836 CCTCCAAAGCAGAGCTGTGACGG + Intronic
954938542 3:54349405-54349427 ATTCCAAAGCAAAGACTTCATGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
957619074 3:82571421-82571443 ACTTCAAATCTGAGTCTTGATGG - Intergenic
958555733 3:95673673-95673695 GGTCCAGAGCAGAACCTTGAAGG - Intergenic
958699831 3:97574373-97574395 ACACTTAAGCAGAGTCTTGAAGG + Intronic
960797705 3:121505400-121505422 ACTGAAAAGCAGAGCAATGAAGG + Intronic
962348146 3:134637100-134637122 TCTGCAAAGCATAGCTTTGAAGG + Intronic
962580710 3:136795420-136795442 ACTCTAAACTAGAGCCATGAGGG - Intergenic
963264740 3:143228880-143228902 ACTCCAAACAGCAGCCTTGAAGG - Intergenic
964099437 3:152971073-152971095 AGTCCAAAGTAGACACTTGAAGG - Intergenic
965622744 3:170656915-170656937 ACCCCAGGGCCGAGCCTTGAGGG + Intronic
968975065 4:3817752-3817774 ACTGCACACCAGAGCCTGGACGG - Intergenic
972929567 4:44054969-44054991 GCTACCAAGAAGAGCCTTGAAGG + Intergenic
975558329 4:75686448-75686470 ACACCTAAGCTGAGTCTTGAAGG + Intronic
976624197 4:87161372-87161394 AATCAGAAGCATAGCCTTGAAGG - Exonic
981759470 4:148178035-148178057 ACTCCAAAATAAAGCCTTCAGGG + Intronic
984563330 4:181297349-181297371 ATCCTAAAGCAGAGCCCTGAAGG + Intergenic
984654946 4:182307638-182307660 ACTTTAAAGCAGAGCCGTGGTGG + Intronic
985888406 5:2697670-2697692 ACCCCAAAACAGAGCATGGAGGG + Intergenic
986022245 5:3815180-3815202 ATTCCCCAGCAGAGCCTTGGGGG - Intergenic
986267231 5:6201211-6201233 AGTCCAAAGAAGGGCCTTGCTGG + Intergenic
986377241 5:7144660-7144682 ACCCAAAAGCTGAGGCTTGAAGG + Intergenic
986456676 5:7927166-7927188 GCTGCAAAGCAAAGCCTTCAGGG - Intergenic
988983073 5:36590802-36590824 ACTCCAGATAAGAGCCCTGAAGG - Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
991479839 5:67065983-67066005 ACTCCAGTGCAGAGTGTTGATGG - Intronic
991537428 5:67686278-67686300 ACATCCAAGCAGATCCTTGAAGG - Intergenic
992140556 5:73792854-73792876 ACTTGAAAGCAGGTCCTTGAAGG + Intronic
994023400 5:95053820-95053842 GCTGAAAAGCAGAACCTTGAAGG + Intronic
996024690 5:118631819-118631841 AAACCAAAGCAGAGATTTGATGG + Intergenic
1000037809 5:157461996-157462018 ACTCCCAGGCAGTGCCTGGAAGG - Intronic
1001530550 5:172458414-172458436 TCTCCCAAGCAGAGCCTAAATGG - Intergenic
1003158485 6:3616426-3616448 TCTCCAAAGCAGTCACTTGAAGG - Intergenic
1004117537 6:12785324-12785346 ACTCCATGGCAGAGCTGTGATGG + Intronic
1007285748 6:40746295-40746317 AGTCCAAAGCAGGGCCTAAATGG + Intergenic
1015344642 6:132141543-132141565 ACTTAAAAGTAGAGCCTTAAAGG + Intergenic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1022785176 7:33631357-33631379 ACACTAGAGCTGAGCCTTGAGGG - Intergenic
1023542019 7:41275696-41275718 ACTCCAAAGCAGAGGCCTGGAGG - Intergenic
1030314075 7:108096473-108096495 AATTGAAAGCAGAGCTTTGAAGG - Intronic
1031381384 7:121090145-121090167 ACTACAAAGAAGAGCGTTCATGG + Intronic
1033433734 7:141313364-141313386 ACTTCCAAGGAGAGCCATGAGGG - Intronic
1033908001 7:146230286-146230308 ACTTCAAAGCAGTGCCTGGCAGG + Intronic
1034419612 7:150982432-150982454 ACTCCAAACTAGAGACTGGAAGG + Intergenic
1034791528 7:153974650-153974672 ACTCCAACACAGGGCCCTGAGGG + Intronic
1035493913 7:159305133-159305155 TCTCCAAAGCATAACATTGAAGG + Intergenic
1036137981 8:6179792-6179814 GCTCAGAAGCAGATCCTTGAGGG - Intergenic
1040987789 8:53315317-53315339 ACACCTTAGCAGAGTCTTGATGG - Intergenic
1042866013 8:73357306-73357328 CCTCCAAAGCAGAGCTTTAATGG + Intergenic
1043694477 8:83202347-83202369 GCCCTAATGCAGAGCCTTGAAGG + Intergenic
1047198791 8:122745997-122746019 GCTCCAAAGCAGTGCTATGAGGG - Intergenic
1048383500 8:133889670-133889692 ACTTCAAAGCACAGGCTTGCAGG + Intergenic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1048573843 8:135675984-135676006 AATCCAAAGCTGATCCTTAAGGG - Intergenic
1051543449 9:18247709-18247731 GCTACAAAGCAGAGGCTTCAAGG + Intergenic
1052014508 9:23449250-23449272 AATCAAAAGCAGAACCATGATGG + Intergenic
1053566547 9:39258397-39258419 GCTCTCAAGCAGAGCCTTGCCGG - Intronic
1053832325 9:42096257-42096279 GCTCTCAAGCAGAGCCTTGCCGG - Intronic
1054130599 9:61360615-61360637 GCTCTCAAGCAGAGCCTTGCCGG + Intergenic
1054598223 9:67091163-67091185 GCTCTCAAGCAGAGCCTTGCCGG + Intergenic
1055673742 9:78633717-78633739 ACACCAAAGTAGAACCTTAAAGG - Intergenic
1057262539 9:93593220-93593242 ATTCCAAAGCTGACCCCTGAGGG + Intronic
1059679796 9:116575100-116575122 AATTAAAAGTAGAGCCTTGAAGG - Intronic
1060688246 9:125631836-125631858 ACCCCTAAGCCAAGCCTTGAAGG - Intronic
1061177314 9:129005562-129005584 ACAGCAGAGCAGAGCCTTTAGGG - Intronic
1061211053 9:129193698-129193720 CCCCCACAGCAGAGCCATGAAGG - Intergenic
1061948761 9:133924152-133924174 AATTCAAAGCAGGGTCTTGAAGG + Intronic
1062052955 9:134456921-134456943 ACTCCAAGGCAGAGCTATGGGGG + Intergenic
1185890732 X:3819691-3819713 AAACAAAAGCAGACCCTTGAAGG + Intronic
1187503098 X:19856338-19856360 ACTCCAAAGCAGGGCTTTTTGGG - Intronic
1187723106 X:22172517-22172539 ACTCCAGAGCTGAGCTTTGCAGG + Intronic
1191875638 X:65792333-65792355 ACTTCAAAGCAAAGCATTGAAGG - Intergenic
1192894468 X:75426760-75426782 TCTCCACAGCAGAGCCATAATGG + Intronic
1196371725 X:114986572-114986594 ACTCCTTAGGAGAGCCCTGATGG - Intergenic
1196723334 X:118875132-118875154 AATTCAGAGCAGGGCCTTGAGGG + Intergenic
1197621353 X:128753475-128753497 ACTAAAAAGCAGAGCCCTCATGG + Intergenic