ID: 902274140

View in Genome Browser
Species Human (GRCh38)
Location 1:15327097-15327119
Sequence TGGACGGGCGAAGCCGTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902274131_902274140 30 Left 902274131 1:15327044-15327066 CCCTCTCTGCTGCAGCTGGAGCA 0: 1
1: 0
2: 6
3: 48
4: 542
Right 902274140 1:15327097-15327119 TGGACGGGCGAAGCCGTTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 27
902274132_902274140 29 Left 902274132 1:15327045-15327067 CCTCTCTGCTGCAGCTGGAGCAC 0: 1
1: 1
2: 12
3: 44
4: 320
Right 902274140 1:15327097-15327119 TGGACGGGCGAAGCCGTTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902274140 Original CRISPR TGGACGGGCGAAGCCGTTCC GGG Exonic
902274140 1:15327097-15327119 TGGACGGGCGAAGCCGTTCCGGG + Exonic
919667066 1:200302378-200302400 GGGCCGGGCGCAGCCGCTCCGGG - Intergenic
1064268885 10:13847661-13847683 TGGACAAGGGAAGCCATTCCAGG + Intronic
1064340173 10:14478375-14478397 TGGAGGGGTGAAGCCGGACCCGG + Intergenic
1084113477 11:67028314-67028336 AGGATGGGTGAAGCCCTTCCTGG + Intronic
1088917029 11:114235193-114235215 TGGACGTGAGAAGCCCCTCCGGG + Intronic
1096761134 12:53842904-53842926 CGGAAGGGCGAAGGCGTGCCAGG - Intergenic
1104582331 12:130019927-130019949 TGGACGGGAGATGAGGTTCCAGG + Intergenic
1112409097 13:99146700-99146722 TCGAGGGGAGAAGCCGTTCCAGG + Intergenic
1118280994 14:64428531-64428553 TGGAAGGGTGAAGGTGTTCCCGG - Intronic
1127003172 15:54534189-54534211 TGGAGGGGCGAAGGTGTTCCTGG - Intronic
1136035686 16:27538226-27538248 TGGACCGGCCTAGCCGTTCCAGG + Exonic
1161721361 19:5904443-5904465 TGAAGGGGCGAGGCCGTGCCTGG + Intergenic
1163435814 19:17294486-17294508 TTGGCGGGCGAAGCCGGCCCTGG + Exonic
927190223 2:20512275-20512297 TGGAGGGGAGAGGCCATTCCTGG - Intergenic
941083938 2:161094570-161094592 TGGACGGGAGCAGGAGTTCCAGG - Intergenic
1179494309 21:41762115-41762137 TGGAAGGGGGAAGTCGTGCCGGG - Intronic
1183394004 22:37561177-37561199 TGGATGGCCGAAGTCTTTCCCGG + Intronic
1184285316 22:43467484-43467506 TGGCCGTGTGAAGCCATTCCTGG + Intronic
1184478772 22:44735571-44735593 TGGACGCGCCAAGCAGTCCCGGG - Intronic
963615257 3:147528624-147528646 TGGAGGGGCCAAGATGTTCCTGG + Intergenic
964743268 3:159988878-159988900 TGCCCGGCCGCAGCCGTTCCGGG - Exonic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980792047 4:137632565-137632587 TGGAGGGGCCAAGGTGTTCCTGG - Intergenic
1008092919 6:47310011-47310033 TGGAAAGGCGAAGGCGTTCCAGG + Intergenic
1024951165 7:54861785-54861807 TGGACCGGCGCAGCCATTCCAGG - Intergenic
1048991343 8:139761977-139761999 TGTACAGGCAAAGCCGTGCCTGG + Intronic
1052619195 9:30883495-30883517 TGGAGGGGCCAAGATGTTCCTGG + Intergenic
1058004393 9:99900384-99900406 TGGAGGGGAGGAGCAGTTCCTGG + Intergenic
1058806405 9:108596465-108596487 TGGAAGGGCGAAACCAATCCTGG - Intergenic
1189926499 X:45960281-45960303 TGGAGGGGCCAAGGTGTTCCTGG - Intergenic
1194013113 X:88585524-88585546 TGGAGGGGCCAAGGTGTTCCTGG - Intergenic
1201017737 Y:9623296-9623318 AGGACGGGAGAAACCATTCCCGG + Intergenic