ID: 902275854

View in Genome Browser
Species Human (GRCh38)
Location 1:15338731-15338753
Sequence GGAGGGGGAGATCATTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3307
Summary {0: 1, 1: 0, 2: 6, 3: 207, 4: 3093}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902275854_902275868 30 Left 902275854 1:15338731-15338753 CCAGGTGAATGATCTCCCCCTCC 0: 1
1: 0
2: 6
3: 207
4: 3093
Right 902275868 1:15338784-15338806 GCAGTCACTCACATGCCACCTGG 0: 1
1: 0
2: 2
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902275854 Original CRISPR GGAGGGGGAGATCATTCACC TGG (reversed) Intronic
Too many off-targets to display for this crispr