ID: 902277605

View in Genome Browser
Species Human (GRCh38)
Location 1:15350704-15350726
Sequence ACTCCTCATGTTACACCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902277605_902277613 29 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277613 1:15350756-15350778 CCCTGGTGAGGTCAGAGTCCAGG 0: 1
1: 0
2: 2
3: 27
4: 253
902277605_902277610 17 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277610 1:15350744-15350766 GGGATACACCTGCCCTGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 140
902277605_902277608 -3 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277608 1:15350724-15350746 AGTCAGTATATTCATGGCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 173
902277605_902277606 -9 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277606 1:15350718-15350740 ATGAGGAGTCAGTATATTCATGG 0: 1
1: 0
2: 1
3: 14
4: 181
902277605_902277609 12 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277609 1:15350739-15350761 GGCTTGGGATACACCTGCCCTGG 0: 1
1: 0
2: 1
3: 22
4: 301
902277605_902277607 -4 Left 902277605 1:15350704-15350726 CCTAGAGGTGTAACATGAGGAGT 0: 1
1: 0
2: 2
3: 4
4: 116
Right 902277607 1:15350723-15350745 GAGTCAGTATATTCATGGCTTGG 0: 1
1: 1
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902277605 Original CRISPR ACTCCTCATGTTACACCTCT AGG (reversed) Intronic
902277605 1:15350704-15350726 ACTCCTCATGTTACACCTCTAGG - Intronic
902452554 1:16506505-16506527 AATCCTCCTGTTCCACCTATCGG - Intergenic
903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG + Intronic
906471996 1:46138886-46138908 TCTGCTCATCTTACACTTCTTGG + Intronic
906872688 1:49501683-49501705 ACACCTAATATTACACCTCAAGG - Intronic
909642305 1:77882623-77882645 ACCCCAAATGTTCCACCTCTTGG - Intergenic
909980849 1:82099006-82099028 GCTCCCCAAGTTACCCCTCTTGG + Intergenic
910196695 1:84649278-84649300 CATCCTCATCTCACACCTCTAGG + Intronic
917522375 1:175758966-175758988 ACGCCACATGTGACACCTTTGGG - Intergenic
918139395 1:181707714-181707736 ACTCCTCCTTTTAAGCCTCTGGG + Intronic
919197144 1:194300446-194300468 TCTTCTCATGTTACTCCTCATGG - Intergenic
921310042 1:213833546-213833568 ACTCCTCATCCTCCACATCTTGG + Intergenic
923941291 1:238830458-238830480 AATCCTCCTGTTCCACCTATTGG + Intergenic
1070568135 10:77619556-77619578 ACTCCTCACGTTCATCCTCTTGG - Intronic
1071437811 10:85663041-85663063 ACTCCTCACATTCCACATCTTGG + Intronic
1079970073 11:27026014-27026036 ACTCCTCATGTTACACTTTGAGG + Intergenic
1080686708 11:34522112-34522134 ACTTCTGATGTCACACCTGTTGG - Intergenic
1084640520 11:70423258-70423280 ACCTCTCATGTTAAACATCTGGG - Intronic
1086001257 11:81988279-81988301 ACACCTCCTGTTCCACCTATTGG + Intergenic
1088477681 11:110260342-110260364 TCTCCTCATATTTGACCTCTTGG + Intronic
1089644174 11:119867124-119867146 ACACCTCAAGTTCCACCTGTAGG - Intergenic
1091104737 11:132908086-132908108 AATAGTCATGTTATACCTCTAGG + Intronic
1091114726 11:133002551-133002573 AATCCTCATGCTACCCCTGTGGG - Intronic
1093487616 12:19668466-19668488 ACTCTTCATCTTGAACCTCTCGG - Intronic
1094361802 12:29638808-29638830 ACTCCTCCCGTTTCACCACTAGG + Intronic
1097604709 12:61739112-61739134 ACTCCTCAGTTTCCACATCTGGG - Intronic
1101236809 12:102797894-102797916 ACTCCACCTGTTCCACCTCCTGG - Intergenic
1103124816 12:118412185-118412207 ACTCCTCATGAAAGACCACTTGG - Intronic
1103125265 12:118416653-118416675 ACTGCTGATTTTTCACCTCTGGG - Exonic
1106562515 13:30859002-30859024 ACTCCTGTTATTGCACCTCTAGG - Intergenic
1107517821 13:41148892-41148914 AATCCTCCTGTTCCACCTATCGG + Intergenic
1108591310 13:51915534-51915556 ACTCCACATGCTACAGATCTGGG + Intergenic
1111863799 13:93742629-93742651 ACACCTCATGTCATGCCTCTGGG + Intronic
1114057917 14:18990819-18990841 CCTCCTCATGTTTCTCCTTTTGG + Intronic
1114104630 14:19410934-19410956 CCTCCTCATGTTTCTCCTTTTGG - Intronic
1116022660 14:39480681-39480703 ACTCCTAATATTACACCTCTTGG - Intergenic
1117635504 14:57739112-57739134 ACACCAAAAGTTACACCTCTTGG - Intronic
1118545313 14:66879999-66880021 TCACTTAATGTTACACCTCTGGG + Exonic
1118951230 14:70438265-70438287 ACTCCTCATGTTACATCTGTGGG - Intergenic
1120053886 14:79899720-79899742 ACTCCTCATACAACACCTCCTGG + Intergenic
1121359715 14:93245604-93245626 ACTCCTCCATATACACCTCTTGG + Intronic
1121894616 14:97635271-97635293 ACCCCTCATGTTAAGCCTGTAGG - Intergenic
1122165289 14:99818667-99818689 ACTCCTCAGCTGACACCTCAAGG - Intronic
1124011185 15:25840015-25840037 ACCCCTCATGCTACCTCTCTGGG + Intronic
1127027119 15:54819159-54819181 GCTCCTCATCTTAAAACTCTAGG + Intergenic
1127323659 15:57872670-57872692 ACTTCTCATCTTTCACCTCCGGG + Intergenic
1133130653 16:3674443-3674465 ACTCCTCATGTTGCCACTCACGG + Exonic
1138932844 16:61682366-61682388 AATCCACATGTGACATCTCTTGG - Intronic
1141509091 16:84501164-84501186 ACTCTTCTTGTTACACCCCCAGG - Intronic
1142469466 17:155345-155367 ACTCCTCGTGGCACAGCTCTAGG - Intronic
1142791280 17:2268258-2268280 AAGCCTCATGATACAACTCTAGG + Intronic
1143560284 17:7689656-7689678 CCCCCTCATGGTACAGCTCTGGG - Exonic
1144291112 17:13827269-13827291 ACTCCACATCTTACCACTCTGGG + Intergenic
1146931865 17:36783318-36783340 ACCCCTGATGATACACCTCAGGG + Intergenic
1147378988 17:40041168-40041190 ACTCTTCATGTTAAACCTAATGG + Intronic
1147537890 17:41332826-41332848 ACTCCAGATGTGTCACCTCTGGG + Intergenic
1147636201 17:41966008-41966030 ACTCCGCCTCTGACACCTCTGGG + Intergenic
1149103906 17:52938766-52938788 AATCCTCCTGTTCCACCTATTGG - Intergenic
1150462250 17:65362499-65362521 ACTCGTCATATTAGAACTCTTGG - Intergenic
1155564809 18:27122053-27122075 ACTCCTGCTTTTACTCCTCTGGG - Intronic
1156222801 18:35070656-35070678 ACTCCTCCTTTAAAACCTCTAGG + Intronic
1157505937 18:48226613-48226635 ACACCTCATGTGACACCTGGAGG - Intronic
1161534938 19:4813147-4813169 ACTCCCCAGGTTTCACTTCTGGG + Intergenic
1164878225 19:31708281-31708303 ACCCCTCATGTTCTGCCTCTTGG - Intergenic
1165007494 19:32818667-32818689 ACCCCTCCTCTCACACCTCTGGG - Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1167868222 19:52345474-52345496 ATTCCTCATGAACCACCTCTAGG - Intronic
928478863 2:31660397-31660419 ACTTCTAAAGATACACCTCTAGG + Intergenic
929825314 2:45305422-45305444 ACTCCTGATACTAGACCTCTTGG - Intergenic
932500426 2:72178352-72178374 AATCCTCAGGTTACACCTAAGGG + Exonic
933246995 2:79986798-79986820 ACTCTTCATGTTGGAACTCTGGG - Intronic
933509180 2:83218181-83218203 ACTACTCATGTTACACATTTTGG + Intergenic
933805308 2:85994825-85994847 ACTCCTCAGATTTCACATCTGGG - Intergenic
936403348 2:112182566-112182588 ACTCCTCCTTTTAGCCCTCTGGG + Intronic
938931762 2:136092824-136092846 ACTCCTCAGATTACCCCTCCTGG + Intergenic
1169988673 20:11474600-11474622 TCTCCTCATGTTGCACCACCTGG - Intergenic
1170020800 20:11834609-11834631 ACTCCTCTGGTGCCACCTCTAGG - Intergenic
1177355418 21:19999714-19999736 ACTGCTCCTGCTACATCTCTTGG - Intergenic
1179179470 21:39033278-39033300 ACTTCTCATGTTATGCCTCGGGG - Intergenic
1183501755 22:38184194-38184216 ACACCTCATGTTGCCCCTGTGGG - Intronic
952694676 3:36250770-36250792 TCTCCACAGGTGACACCTCTAGG + Intergenic
953866089 3:46584759-46584781 ACTCCTCAAGAAACCCCTCTGGG - Intronic
954529163 3:51303732-51303754 CCTCCTCAGGTGACACCTCTGGG - Intronic
956631260 3:71318864-71318886 ACTCCCCATTTTTCACTTCTTGG + Intronic
958522156 3:95204143-95204165 CCTCCTCATGTGACATCTCCAGG - Intergenic
962328969 3:134460780-134460802 ACTTCTCATGACAAACCTCTGGG + Intergenic
962977066 3:140455261-140455283 CCTCCTCAGGGTCCACCTCTGGG - Intronic
965792253 3:172402205-172402227 TCTCCTGAGGATACACCTCTAGG - Intergenic
971787117 4:31118928-31118950 ACTCCTCTTTTTTAACCTCTAGG + Intronic
973254024 4:48091027-48091049 AGTCCTCATCTTACTCATCTTGG - Intronic
974987792 4:69051323-69051345 GCTCCTCCTGTTACATTTCTTGG + Intronic
979133188 4:117075083-117075105 ACTCCTAAAGTTACACCTGTTGG - Intergenic
982532958 4:156570704-156570726 ACTCCTCATCTAACCCCCCTTGG - Intergenic
992581786 5:78185481-78185503 TGTCCTCATGTTACACTTCAAGG - Intronic
996400237 5:123054331-123054353 ATTCCCCATATTACACATCTGGG - Intergenic
998618772 5:143771562-143771584 ACTGCTCATTTTCCCCCTCTGGG + Intergenic
999303797 5:150507194-150507216 GCTCCTCATGTCACACCACGTGG - Intronic
1004299073 6:14440779-14440801 ATTCATCATCTTATACCTCTGGG - Intergenic
1006886551 6:37386773-37386795 ACTGCTCATGTTCCATCTCCAGG - Intronic
1008801916 6:55378790-55378812 ACTGCTCATGTTCTGCCTCTGGG + Intronic
1011141794 6:84166130-84166152 ATGCCTCATGTTAAACCTGTTGG + Intronic
1014538003 6:122639597-122639619 ACTCCTGATATAACACCTTTTGG - Intronic
1015462869 6:133512939-133512961 ACCCCTCCTCTTACACCTGTTGG - Exonic
1019994157 7:4712666-4712688 GCTTCTCATTTTACACCTCAAGG + Intronic
1020650341 7:10867342-10867364 ACTCCTACTGTTACAACTCATGG + Intergenic
1021289007 7:18820822-18820844 ATTTCTAATGATACACCTCTTGG - Intronic
1031851719 7:126872775-126872797 ACTCCTCTTGGTCCACCTCCGGG + Intronic
1032564525 7:132928157-132928179 TCTCTTCATGTTACAAGTCTTGG - Intronic
1037511255 8:19585710-19585732 TCTTCTCATTTTACACCTCATGG - Intronic
1039427961 8:37502600-37502622 TCTCCTCATTTGACACCTCCTGG - Intergenic
1042866219 8:73358724-73358746 ATCCCTCATGTTACACCTTCAGG - Intergenic
1057013489 9:91629933-91629955 ACTTCTGATGTTGCTCCTCTGGG + Intronic
1057719371 9:97519701-97519723 ATTCCTCAGGTGACACCACTGGG + Intronic
1058128176 9:101220588-101220610 TATCCTCATGTTTCACCCCTTGG + Intronic
1059688477 9:116660856-116660878 ACTCCTCATCCAACTCCTCTAGG + Intronic
1186105485 X:6201363-6201385 AGTCATCATTTTACTCCTCTGGG - Intronic
1191038401 X:56052739-56052761 CCTCCTTAGGCTACACCTCTGGG - Intergenic
1193365076 X:80622729-80622751 CCTCCTCAGGTGACATCTCTAGG - Intergenic
1197124094 X:122924480-122924502 ACTCCTCAAGTGACATCTCCAGG - Intergenic
1198507198 X:137312598-137312620 TCTCCTCAAATTACACCTTTGGG - Intergenic
1199296242 X:146162089-146162111 AATCCTCCTGTTTCACATCTAGG - Intergenic
1201648342 Y:16259998-16260020 ATTCCTCATGAAACACCACTGGG + Intergenic
1201654468 Y:16325303-16325325 ATTCCTCATGAAACACCACTGGG - Intergenic