ID: 902281893

View in Genome Browser
Species Human (GRCh38)
Location 1:15380845-15380867
Sequence CTGCAGTCAGTGTTGAACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902281888_902281893 -7 Left 902281888 1:15380829-15380851 CCAAAGCCTGGGGCCCCTGCAGT 0: 1
1: 0
2: 4
3: 37
4: 307
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
902281887_902281893 -2 Left 902281887 1:15380824-15380846 CCTATCCAAAGCCTGGGGCCCCT 0: 1
1: 0
2: 1
3: 22
4: 223
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
902281884_902281893 4 Left 902281884 1:15380818-15380840 CCTGCTCCTATCCAAAGCCTGGG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
902281882_902281893 5 Left 902281882 1:15380817-15380839 CCCTGCTCCTATCCAAAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 242
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
902281880_902281893 15 Left 902281880 1:15380807-15380829 CCAGCATCCACCCTGCTCCTATC 0: 1
1: 0
2: 2
3: 27
4: 297
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
902281881_902281893 8 Left 902281881 1:15380814-15380836 CCACCCTGCTCCTATCCAAAGCC 0: 1
1: 0
2: 3
3: 24
4: 308
Right 902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902281893 Original CRISPR CTGCAGTCAGTGTTGAACGC AGG Intronic
901907938 1:12430590-12430612 GTGCAGTCAGTGTTGGAACCAGG + Intronic
902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG + Intronic
903694069 1:25194730-25194752 CTGCAGTCAGTGAGAAACGCAGG + Intergenic
904558162 1:31379073-31379095 CTGCAGTGTGTGTGGAAAGCTGG - Intergenic
904586687 1:31584672-31584694 TTGCAGACAGTGCTGAACCCAGG + Exonic
904896341 1:33821040-33821062 CTGCAGTCAAAGTTCAAAGCTGG + Intronic
904979331 1:34483787-34483809 CTTCAGTCAGTGGTAAAAGCAGG + Intergenic
905098889 1:35500999-35501021 CTGCATGCAGTGTTGCACGGAGG - Intronic
905895993 1:41546101-41546123 CTGCAGTCACTGTTGACTGAAGG - Intronic
907386915 1:54131960-54131982 ATGGTGTCAGTGTTGAAGGCTGG - Intergenic
908057180 1:60300583-60300605 TTGCAGTCAGTTTTGAAATCAGG + Intergenic
909046057 1:70711228-70711250 ATGCCTTCAGTGTTGAACTCAGG - Intergenic
910232198 1:84997819-84997841 CTGCAGTCAGCAGTGATCGCAGG - Intergenic
910977550 1:92923009-92923031 CTGAAGACAGTGTTAAAAGCAGG - Intronic
912696590 1:111846878-111846900 CTGGATTCAGGTTTGAACGCAGG + Intronic
1065268194 10:23999338-23999360 CTGGAGGCAGTGTTGGACCCTGG + Intronic
1067131257 10:43567490-43567512 TTGCAGTCTGTGTCGAAAGCAGG - Intronic
1072619395 10:97069497-97069519 CTCCAGCCATTGTTGAAAGCTGG - Intronic
1074347190 10:112698762-112698784 GTGCACTCATTGTTGAACACAGG + Intronic
1074881574 10:117663495-117663517 CTGAAGCCAGAGTTGAATGCAGG - Intergenic
1076614624 10:131747407-131747429 CTGGGGACAGTGTTGAACACTGG - Intergenic
1077734910 11:4781284-4781306 CTGCAATCAGTTTTTAAGGCAGG - Intronic
1081552580 11:44127661-44127683 CTGTAGTCAGAGTTGAACACCGG - Intronic
1089878877 11:121754074-121754096 CTGCTGTGAGTGTTGGAAGCTGG - Intergenic
1090386724 11:126361612-126361634 CTGCAGGGAGTGGAGAACGCAGG - Intronic
1090422709 11:126586614-126586636 CAGAAGTCAGAGTTGAACTCGGG + Intronic
1092216590 12:6688309-6688331 CAGCAGTCAGTCTGGAAGGCAGG + Intronic
1093168249 12:15830001-15830023 CTGCAGTGAGTAGTGAACTCTGG - Intronic
1094166380 12:27447679-27447701 CTGCAGTGAGTGGTGATCGCAGG + Intergenic
1096345945 12:50846877-50846899 CTGCAGTAAGTTTTGAAATCAGG + Intronic
1105510238 13:21045695-21045717 CTGCAGGAACTGGTGAACGCAGG - Exonic
1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG + Intergenic
1113657475 13:112076723-112076745 GTGCAGTCAGTGTGGAACAAGGG + Intergenic
1119642554 14:76326058-76326080 TTGCAGTCAGTGGTGGATGCCGG - Intronic
1131722373 15:95184134-95184156 CTGCAGTAAGTTTTGAATTCAGG + Intergenic
1132143691 15:99414510-99414532 CTGCAGCCAGTGATGCAGGCTGG - Intergenic
1132476843 16:143630-143652 GTGCAGTGAGTGTGGAATGCTGG - Intergenic
1147462078 17:40579478-40579500 CTGCAGTCAGTGTCCAACAAAGG - Intergenic
1148212076 17:45814652-45814674 CTGCTGACAGTGTTGAGCCCGGG - Intronic
1153736540 18:8075345-8075367 TTGCAGTCAGTTTTGAAATCAGG + Intronic
1157663142 18:49463233-49463255 CTGCAGGCAGTTTTGAAAGTTGG - Intergenic
1158005268 18:52664911-52664933 CTGCATTCAGTGTTGGAGGGAGG - Intronic
1161681501 19:5681926-5681948 CTGCAGTCAGTGTAGAGCTGGGG + Intronic
1163076774 19:14899599-14899621 CTGTGGTCAGTGTTAAAGGCAGG + Intergenic
1164855540 19:31517858-31517880 CTGCAGTCAGTCCTCAAAGCCGG - Intergenic
1165598108 19:37028281-37028303 CTGCAGTCAGGGATGATCTCAGG + Intronic
1168513525 19:56992444-56992466 CTGCAAACAGTGATGAACACTGG - Intergenic
926983649 2:18597968-18597990 CTAAAGTGAGTGTTGAAGGCAGG - Intergenic
928379746 2:30807502-30807524 CTGAAGTCACTGTTTAACGAAGG - Intronic
932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG + Exonic
938905384 2:135831591-135831613 CTGCTATCAGTTATGAACGCAGG - Intronic
947362804 2:229363583-229363605 CTGCAGTCACTGGTGCATGCAGG + Intronic
1174783126 20:53408272-53408294 CTGGACTCTGTGTCGAACGCTGG - Intronic
1175768090 20:61605023-61605045 GTGCAGACAGTGTGGAAGGCTGG + Intronic
1175951699 20:62587131-62587153 CTGCTGTAAGTGGGGAACGCTGG + Intergenic
1178892089 21:36528679-36528701 CTGCAGACAGTGATGCACCCTGG + Intronic
1179787196 21:43736691-43736713 CTGCAGTGAGTCATGACCGCAGG - Intronic
1180056686 21:45362522-45362544 CTGCAGTCACTGTTGGGCCCTGG - Intergenic
1184812823 22:46848414-46848436 CTGCAGTGAGTTTTTAAAGCAGG + Intronic
952720699 3:36529757-36529779 CTGCAGTCAGAGAAGAAGGCAGG - Intronic
955059707 3:55484551-55484573 CTGCTGTCAGTGTTGAGGCCTGG - Intronic
957437903 3:80202437-80202459 CTGTACTCAGTGTTGAACACTGG - Intergenic
962425997 3:135269955-135269977 TTGCAGTCATTCTTGAAAGCTGG + Intergenic
967081037 3:186049776-186049798 CTCTAGTTAGTGTTGTACGCTGG + Intronic
976045542 4:80942307-80942329 CTGGAGTCAGTCTTTAACGTTGG + Intronic
977714582 4:100167535-100167557 CTTCATCCAGTGTTGAACTCTGG + Intergenic
980940205 4:139266851-139266873 CAGCAGTCAGTGCTGAAACCGGG - Exonic
982199318 4:152944773-152944795 GTGCCGTCAGTGCTGAACACAGG + Intronic
986357573 5:6943602-6943624 CTGCAGTTTGTGCTGAATGCTGG + Intergenic
993026852 5:82656919-82656941 CTCCAGTCACTGTGGGACGCAGG - Intergenic
996469702 5:123845336-123845358 CTGCAGGCAGTGTAGAAAGAAGG + Intergenic
1012707763 6:102554710-102554732 GTTCAGCCAGTGTTGAACGCAGG - Intergenic
1019276120 7:176910-176932 CTGAAGTCAGTTTTCAAAGCAGG - Intergenic
1023636847 7:42220516-42220538 CTGCACTCAGTCTTGATCACAGG - Intronic
1023675530 7:42625609-42625631 CTGGAGTCAGTCTTAAACGAAGG + Intergenic
1024059598 7:45687891-45687913 CTGCAGTCAGGACTGAAGGCAGG + Intronic
1024792018 7:52976882-52976904 TTGCAGTAAGTGTTGAAGTCCGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1032636782 7:133718080-133718102 GGGCAATCAGTGTTGAACTCTGG - Intronic
1038011516 8:23480239-23480261 CTGCAGGCAGAGTTCAACGTGGG - Intergenic
1040678679 8:49783216-49783238 CTTCAGTCAGTGGTGAACTTAGG - Intergenic
1041421352 8:57670508-57670530 CTGTACTCACTGTTGTACGCAGG - Intergenic
1046597028 8:116272971-116272993 CTGCAGTGAGTGGTGAATGTGGG + Intergenic
1048018328 8:130517156-130517178 CAGCAGTGTGTGTTGAAGGCAGG + Intergenic
1049187588 8:141266114-141266136 CTCCTGTCGCTGTTGAACGCTGG - Intronic
1049635788 8:143688428-143688450 ATGCAGTGAGTGTTGAGTGCAGG + Intronic
1053460596 9:38267506-38267528 CTGCAGTAAGTTTTGAAGTCAGG - Intergenic
1053753758 9:41281066-41281088 CTGCAGACAGTGTTGCCCACTGG + Intergenic
1054259281 9:62845426-62845448 CTGCAGACAGTGTTGCCCACTGG + Intergenic
1058832959 9:108835801-108835823 ATGCAGTCACTGATGAACCCAGG + Intergenic
1061812788 9:133172048-133172070 CTGCAGACAGTGTGGAACCCTGG - Intergenic
1062170358 9:135131621-135131643 CTGGAGTCAGTGATGAAGGGGGG - Intergenic
1189075817 X:37913077-37913099 CTGCTGTTAGTCTTGAATGCAGG + Intronic
1189359749 X:40340704-40340726 CTGCAGGGAGTGTTGACAGCTGG - Intergenic