ID: 902281909

View in Genome Browser
Species Human (GRCh38)
Location 1:15381007-15381029
Sequence CTGTTGTCATTTTTCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902281908_902281909 15 Left 902281908 1:15380969-15380991 CCTTGAAAAACTGGGTGGTTAGA 0: 1
1: 0
2: 0
3: 16
4: 169
Right 902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 199
902281906_902281909 22 Left 902281906 1:15380962-15380984 CCAAATTCCTTGAAAAACTGGGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902281909 Original CRISPR CTGTTGTCATTTTTCACCCC CGG Intronic
900206277 1:1433220-1433242 CTGTGGTCATGTTTGACCCTGGG - Intergenic
900834176 1:4987338-4987360 CTGTTCTATTTTTTCACCCATGG - Intergenic
900972149 1:5997576-5997598 GTGTTTTCATTTTCCACCCCCGG + Intronic
902209997 1:14898086-14898108 CTGTGGTCCTTTCTCACCCCCGG - Intronic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
904390626 1:30183260-30183282 CTATTGTCCTGGTTCACCCCTGG - Intergenic
904851721 1:33464640-33464662 TTGTTTTTTTTTTTCACCCCTGG + Intergenic
905948894 1:41928562-41928584 CTGATGTCCTTTTTCATTCCAGG + Intronic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
908267483 1:62393669-62393691 CTCTTCTCATTCTTCACCACTGG + Intergenic
912192930 1:107361741-107361763 CTGATGTCATTTTTGACACTCGG + Intronic
913564927 1:120063627-120063649 CTGTGGTCATTTTTCCCCCTTGG - Intronic
913633202 1:120729932-120729954 CTGTGGTCATTTTTCCCCCTTGG + Intergenic
913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914116530 1:144746379-144746401 ATGTTGTCATTGTTCAAGCCAGG - Intergenic
914285514 1:146222981-146223003 CTGTGGTCATTTTTCCCCCTTGG - Intronic
914546545 1:148673734-148673756 CTGTGGTCATTTTTCCCCCTTGG - Intronic
914620020 1:149396934-149396956 CTGTGGTCATTTTTCCCCCTTGG + Intergenic
914993186 1:152515854-152515876 CCGATGTGATTTTTCTCCCCGGG + Exonic
917240334 1:172941217-172941239 CTCTTCTCATTTGTCACCCTGGG - Intergenic
918740347 1:188122819-188122841 CTGTTCTCACTTTTCTTCCCTGG - Intergenic
920945156 1:210522226-210522248 CAGGTGTCATTTCTCACCTCTGG - Intronic
921968382 1:221117855-221117877 CTCTGGTCATTTTACATCCCTGG - Intergenic
922248156 1:223820629-223820651 CTGGTTTCCTTTTTCACCTCTGG - Intronic
923445138 1:234063669-234063691 CTTTTGTCATATTTCAGCCTTGG + Intronic
924235506 1:241996542-241996564 GTGTTGTCATATTTCATCCATGG - Intronic
1064648046 10:17480149-17480171 CTTTTTTCACTTTTCACACCTGG - Intergenic
1064938634 10:20708353-20708375 AAGTTGTGACTTTTCACCCCAGG + Intergenic
1065643590 10:27810966-27810988 CTGTTGCTTTTTTTCACTCCCGG + Intergenic
1067727280 10:48779797-48779819 CTGTTGTCATTTTTCATGAGAGG + Intronic
1067758095 10:49021222-49021244 CTTATATCATTCTTCACCCCAGG + Intronic
1068619769 10:59169041-59169063 CTGCCTTCATTTTTCCCCCCAGG + Intergenic
1068746554 10:60538223-60538245 CTGTTATCCTTGTTCACCACTGG - Intronic
1068897883 10:62227726-62227748 GTGTCTTCATTTTTCACTCCTGG - Intronic
1070329490 10:75407535-75407557 TTGCTTTCATTTTTCACCGCGGG - Intergenic
1072514854 10:96170244-96170266 CAGTTGTTATCTGTCACCCCAGG + Intronic
1072956218 10:99890542-99890564 CTGTTGGCCATTTTCTCCCCAGG - Intronic
1073771704 10:106742163-106742185 CAGTTGCCATTTCGCACCCCAGG - Intronic
1074969173 10:118521504-118521526 CTGTTAGCATCTTTCTCCCCTGG + Intergenic
1075645657 10:124094253-124094275 CTGTTGTATTTTTGCATCCCGGG + Intergenic
1076355985 10:129853825-129853847 CTATTGGCATTTTTCCCCCTTGG - Intronic
1078733806 11:14001291-14001313 CTTTTGTGAATTTTAACCCCAGG + Intronic
1080298919 11:30762376-30762398 CTGTTGTCATTTTTTTCTCTTGG + Intergenic
1080469254 11:32529171-32529193 CTTTTGTCAGTTTTCACATCAGG + Intergenic
1082875294 11:57981711-57981733 CTGTTGTCATTTATTTACCCAGG - Intergenic
1084252486 11:67911240-67911262 CTGTGGCCTTTTTTCACCCAAGG - Intergenic
1084477349 11:69396454-69396476 CTGTGGTCATCTTTCACCTGAGG - Intergenic
1084988295 11:72897596-72897618 CTGTTGTCATTTTACACATGAGG + Intronic
1085852308 11:80136402-80136424 CTATTGTTATTTTTCTCCTCTGG + Intergenic
1086100901 11:83098742-83098764 CTGTTGTCACTTTTGAACCTGGG + Intergenic
1088109427 11:106245328-106245350 CTGTTGTCACCTTTCTCCCCTGG - Intergenic
1088443017 11:109892450-109892472 CTGTTTTCTATTTTCACTCCAGG - Intergenic
1090955002 11:131506025-131506047 CTGATGTCAGTTATCACTCCGGG + Intronic
1091088490 11:132746741-132746763 TTTTTGTCATTTTTGACTCCCGG + Intronic
1094856262 12:34404215-34404237 CTGTTTTCATTTCACACCACAGG - Intergenic
1095818358 12:46449746-46449768 CTTTTGTTATTTTTTTCCCCTGG + Intergenic
1097327646 12:58296806-58296828 CAGGTGTCATTTTTATCCCCAGG - Intergenic
1098848894 12:75570951-75570973 CTGATGTTTTTTTTCTCCCCAGG - Intergenic
1099264957 12:80434115-80434137 CTGTTGTCATACTTGACCCATGG + Intronic
1101825374 12:108216426-108216448 CTGTTGTCATTCATGACTCCAGG + Intronic
1102980384 12:117236596-117236618 GTGTTGTCTTTTTGCTCCCCAGG - Intronic
1104427779 12:128692354-128692376 TTGTGTTCATTTTTCACCTCTGG - Intronic
1104726421 12:131078301-131078323 CTGCTTACATTTTTGACCCCCGG + Intronic
1105426322 13:20298065-20298087 CTGTTGTCCTGTTTCAACCTCGG + Intergenic
1109019410 13:57067639-57067661 CTGGTATCATTTTTAACCCTGGG - Intergenic
1109447643 13:62464362-62464384 CTCTTCTCATTTTACACACCTGG - Intergenic
1110093839 13:71490105-71490127 ATATTTTCATATTTCACCCCAGG + Intronic
1112360315 13:98711389-98711411 GAGGAGTCATTTTTCACCCCAGG + Intronic
1113142547 13:107170441-107170463 CAGTTGCCATTTTTCACGGCGGG + Exonic
1118000601 14:61519452-61519474 TTTTTGTCATTTCTCATCCCAGG + Intronic
1122812077 14:104294019-104294041 CTCTTGTCCTTTCTCACCCCGGG - Intergenic
1124369183 15:29093795-29093817 TTGCTGCCATTTCTCACCCCTGG - Intronic
1126720661 15:51575041-51575063 CTTTTCTAATTTTTCCCCCCAGG - Intronic
1130567092 15:85005675-85005697 CAGTTTTCATTTGTCACCACAGG - Intronic
1132112391 15:99111560-99111582 CTGTTATCGTTTTTCCACCCTGG + Intronic
1132874205 16:2128574-2128596 CTGGTCTCATTTTACACACCAGG - Intronic
1135614807 16:23902039-23902061 CTGTTGGAATTTTTACCCCCAGG + Intronic
1136021756 16:27444998-27445020 TTGTTCTCATTCCTCACCCCAGG - Intronic
1138175157 16:54890806-54890828 CTCTTGTCATTTTGCCCTCCAGG + Intergenic
1138440085 16:57029171-57029193 TTGTTGACATTTTTCTTCCCTGG + Intronic
1139934748 16:70561362-70561384 CTGTTTTCATTTTACACACGTGG + Intronic
1140717317 16:77738535-77738557 CTGGAGTGATTTTTCAACCCTGG + Intronic
1142473382 17:175864-175886 CGGGTGTCAGTTTTCCCCCCAGG - Intronic
1146542781 17:33711955-33711977 TAGCTGTCATTTATCACCCCAGG - Intronic
1148378136 17:47168907-47168929 CTGTTGTCACTTCTCCCCCGTGG - Intronic
1149027209 17:52040892-52040914 CTCTTTTCAGTTTTCTCCCCTGG - Intronic
1149561842 17:57612989-57613011 CTGAAGCCAGTTTTCACCCCTGG + Intronic
1149678063 17:58484849-58484871 CTGTTGTCATTCATAACCCTGGG + Intronic
1150481716 17:65516432-65516454 TTGTTATTATTTTTCTCCCCTGG - Intergenic
1155023534 18:21919266-21919288 ATTTTGTCATTTTTCCCCCTAGG + Intergenic
1155149067 18:23108109-23108131 CTGTTGTAAATGTGCACCCCTGG + Intergenic
1157133554 18:45032002-45032024 CTCTGGTCATTTTCCAGCCCTGG + Intronic
1157844871 18:50993831-50993853 CTGCTGTCCTTTCTCCCCCCAGG - Intronic
1158436707 18:57439425-57439447 CTCTTGTCCCTTTTCAACCCAGG - Intronic
1160144922 18:76355998-76356020 CTGTTTTCATTTTTCAACTGAGG - Intergenic
1163003921 19:14385627-14385649 CAGTGGTGATATTTCACCCCCGG - Intronic
1163063391 19:14775992-14776014 CAGTGGTGATATTTCACCCCGGG + Intronic
1164543760 19:29142199-29142221 CTCTGGTCTTTTTTCAACCCTGG + Intergenic
1166624934 19:44343151-44343173 CTGTTGTCATTCTTTACCCTTGG + Intronic
1167069066 19:47209137-47209159 CTCTTTTCATTTTTCTCCCCAGG + Exonic
1202702028 1_KI270712v1_random:171847-171869 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
926081599 2:9991022-9991044 GTGTTGTCATTTTTCAAGACTGG - Intronic
926304932 2:11631069-11631091 CAGCTCTCATATTTCACCCCTGG - Intronic
926988846 2:18654605-18654627 CTGTGGTTTTTTTTCTCCCCTGG + Intergenic
934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934863813 2:97788164-97788186 CAGTTTTCATTCTTCACCACTGG + Intronic
935815191 2:106840954-106840976 CTGTGGTGTTATTTCACCCCGGG + Intronic
936952201 2:117989169-117989191 CTGTTGGCATTTTCCAACCACGG + Intronic
936973117 2:118193487-118193509 CTGTTGTCATTTTTCGCATGTGG - Intergenic
939076634 2:137610208-137610230 CTTTTGTCTTTTTTTACCCTAGG + Intronic
940049525 2:149447595-149447617 CTGATGTCATTATGAACCCCTGG - Intronic
940302330 2:152188096-152188118 CTCTTTTCATTTTTCACATCTGG + Intergenic
941866943 2:170344853-170344875 CTGTTGTGATTCATCCCCCCGGG - Intronic
942954213 2:181755259-181755281 CTGCTGTCATTTATAACCCCTGG + Intergenic
946296924 2:218791905-218791927 CTATTGTCATTTTTCAATGCAGG - Intronic
948076974 2:235172517-235172539 CTGTTGTCACTCTCCACCCCTGG + Intergenic
948145102 2:235702848-235702870 CTGGAGTCAGTTTTCATCCCAGG - Intronic
1169907632 20:10619302-10619324 CTGTTGTCCTTTTTCTTCCAAGG + Intronic
1170598070 20:17820424-17820446 CTATTGTCATTTTTCAAACATGG + Intergenic
1173402375 20:42736892-42736914 CTGTGGTCACTTCTCACACCTGG + Intronic
1173845875 20:46188232-46188254 CTGATGTCAGTTTCCACACCTGG + Intronic
1175437596 20:58965361-58965383 CTTTTGTTCTTTTTCACTCCAGG + Intergenic
1176906321 21:14505973-14505995 TTGATTTCATTTTTCACCCAGGG - Intronic
1177829690 21:26124127-26124149 CTGTTATTATTTTTCATGCCAGG - Intronic
1179389316 21:40973098-40973120 CTTTTATCATTCTTAACCCCAGG + Intergenic
1184624119 22:45709453-45709475 CTGATGACATCTTTCAGCCCTGG - Intronic
1184895138 22:47402404-47402426 CTGCTGTCATTTCTCAGGCCCGG + Intergenic
949712171 3:6884250-6884272 ATGTTATCATGTTTGACCCCTGG + Intronic
951705779 3:25543053-25543075 CTGTTGACATTTATAACACCTGG + Intronic
952512610 3:34072268-34072290 CAGTTGTCATTTCTCACCTCTGG + Intergenic
953283387 3:41580511-41580533 CTGTTGGCATTTTTCTCTCTGGG - Intronic
955795825 3:62636049-62636071 CTGTTTTCCTTTTTTACCCTGGG + Intronic
956517545 3:70065842-70065864 CCCTTGTTATTTTTCACCGCTGG + Intergenic
956823036 3:72971130-72971152 CTTTTGTGATCTGTCACCCCTGG + Intronic
959038993 3:101398725-101398747 CTGGTATTATTTTTCTCCCCGGG - Intronic
959623493 3:108424023-108424045 CAGATGCCATTTTTCACACCTGG - Intronic
960333637 3:116391740-116391762 CTGCTCCCATTTCTCACCCCGGG - Intronic
961930951 3:130532232-130532254 CTGTTGTCTTTATTCACTCAGGG + Intergenic
962395609 3:135013200-135013222 CTGTTGTCCTTTTTCACATTTGG - Intronic
964369414 3:155984094-155984116 CTTTTGTCAGTGTTCACTCCTGG - Intergenic
966640978 3:182189667-182189689 CTGTTTTCAGTTGTTACCCCTGG - Intergenic
968165406 3:196460729-196460751 CAGTTGTCTCTTTTCACCTCAGG - Intergenic
968461959 4:730608-730630 CTGTTGTGCTTTTTCTCCGCAGG + Exonic
968688170 4:1975436-1975458 GTGTTGGCATTTTGCACTCCTGG + Intronic
969064813 4:4470357-4470379 CTGTGGTGATTTTGCACCCCAGG - Intronic
969506170 4:7589220-7589242 TTGATGTCATATTTCACCTCTGG - Intronic
969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
970074361 4:12200766-12200788 CTTCTGTCATTTCCCACCCCAGG + Intergenic
975991743 4:80265740-80265762 CAGTTGTCCTCTTTCGCCCCAGG - Intergenic
977348339 4:95846494-95846516 CAGTTGTCATTTTTTTCCCTGGG - Intergenic
979956017 4:126955206-126955228 CTGTTGTAATTTTACAAGCCAGG + Intergenic
979983170 4:127281754-127281776 CTGTGGCCATTTTTCACTTCTGG - Intergenic
982900881 4:161002208-161002230 TTGTTGTCATTTTTCTTTCCTGG - Intergenic
983157169 4:164363204-164363226 CTGCTGTTATTTTTTTCCCCAGG - Intronic
983316150 4:166134754-166134776 CTGTTTTCATTCTTCTCCGCGGG + Intergenic
984017609 4:174444607-174444629 CTGTGGTCATTTTTTCCTCCAGG + Intergenic
984393056 4:179163439-179163461 CTGTTGTCAGTGTTTACCCCTGG + Intergenic
984688580 4:182699262-182699284 CTGTTGTGATTTTTCTCAACTGG + Intronic
985698100 5:1353381-1353403 CTGTTGTCTTTGTTTATCCCTGG + Intergenic
986975249 5:13386717-13386739 CTGAAGTCATTTATCAGCCCTGG - Intergenic
988331993 5:29853619-29853641 CTGTTGTGATTTTTTGCCCCAGG + Intergenic
989658639 5:43773721-43773743 CTGTTGCCATCTTTCATGCCAGG + Intergenic
989832771 5:45940997-45941019 GTTTTTTCATTTTTCACCCTAGG - Intergenic
991702784 5:69331733-69331755 TTGGTGCCATTCTTCACCCCAGG + Intronic
992210954 5:74478986-74479008 CTTTTGTCAGTTTTCAAACCTGG + Intergenic
992215327 5:74519569-74519591 CTGTGGTCATCATTCACCACCGG - Intergenic
992704509 5:79376831-79376853 CTTTTGTCATTTTTTTCCCTTGG - Intronic
993306689 5:86283376-86283398 CAGTTGCCATTTTTCCCCCAGGG - Intergenic
993686032 5:90938850-90938872 CTTTTGTTATCTTTCAACCCAGG + Intronic
1000556497 5:162732872-162732894 CTGTTGTCCTTGTTCATTCCTGG + Intergenic
1001560530 5:172666042-172666064 CTGTTGACCTCCTTCACCCCTGG - Intronic
1001561405 5:172671487-172671509 CTGTTCTGATTTTTCACCATAGG + Intronic
1003714030 6:8626125-8626147 GTGTTCTCATTGTTCACACCGGG - Intergenic
1003755926 6:9120054-9120076 CTGTTGTCAGTTTTCTTCTCTGG + Intergenic
1005025188 6:21455926-21455948 CTGTTCTCTTTTTTCCCCCTTGG + Intergenic
1007522748 6:42464795-42464817 CTGTTGTCATTTTTACTCTCTGG + Intergenic
1011084417 6:83523460-83523482 TGGTTGATATTTTTCACCCCTGG + Exonic
1012350083 6:98239632-98239654 CTGCTGCCATATTTCACACCAGG + Intergenic
1012661745 6:101906267-101906289 CTCTTTTCATTTTTGACCCAGGG + Intronic
1016816668 6:148309161-148309183 CTGTACTCTTTTTTCCCCCCAGG - Intronic
1017678752 6:156842272-156842294 CTGTTGTCCCTCTTCCCCCCAGG + Intronic
1019467614 7:1198410-1198432 CTGTACTCATTTTACAACCCTGG - Intergenic
1020353695 7:7253516-7253538 CTGTGGACATTCTTCACCACTGG - Intergenic
1022287881 7:28972893-28972915 ATGTTGTCATTTCTCACATCTGG + Intergenic
1022531801 7:31071485-31071507 CTGTTCTCATTTTCAACCTCTGG + Intronic
1022812115 7:33880120-33880142 CTGTTGTCATTTCTGAGCCTTGG + Intergenic
1026358980 7:69585400-69585422 CTGTTGCCATGTGACACCCCTGG + Intergenic
1028909909 7:96196195-96196217 CTGTGGTCATTTTTCACTACAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030590822 7:111479223-111479245 TTGGTGTCATTTTTCACCTTGGG - Intronic
1030675370 7:112379622-112379644 CTGTGCTCATTTTTCCCCCCTGG + Intergenic
1031373388 7:120995507-120995529 CTATTGTTAATTTTCACCCTTGG + Intronic
1031661729 7:124434579-124434601 CTGTTGTCTTTTTCCCTCCCTGG - Intergenic
1032243568 7:130187331-130187353 CTCTTTTCATTTTTAACCACTGG - Intronic
1034086867 7:148329677-148329699 CTGTTGATATTTTTGACCCTTGG - Intronic
1039252965 8:35687046-35687068 CTGTGGTTATATTTCCCCCCAGG + Intronic
1040453416 8:47572014-47572036 CTGTTGTCATTTCTAACCATTGG + Intronic
1040664677 8:49618712-49618734 CTGTGGTCATTTTCCTGCCCTGG - Intergenic
1040908035 8:52488818-52488840 CAGTTGTTATTTTTTGCCCCAGG - Intergenic
1041257528 8:55992147-55992169 TTCTTGTCTTTGTTCACCCCTGG + Intronic
1041450512 8:58001567-58001589 CTGTTTTGATTGTTCATCCCTGG + Intronic
1041833172 8:62180171-62180193 CTGTTGTCATTTCTCATCAATGG - Intergenic
1042449992 8:68932973-68932995 CAGCTGTCATTTTTCCCTCCTGG - Intergenic
1045084545 8:98667352-98667374 CTGTTTTCATTTTGTTCCCCCGG - Intronic
1046960724 8:120110261-120110283 CTTGTGTCCATTTTCACCCCTGG + Intronic
1050044990 9:1533765-1533787 ACTTTGTCATTCTTCACCCCTGG - Intergenic
1051322153 9:15916923-15916945 CTGTTGTCATCCTTGGCCCCAGG - Intronic
1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG + Intergenic
1056733841 9:89187683-89187705 GTTTTGTCAGTTTTCACCACTGG + Intergenic
1057445762 9:95113315-95113337 CTTTTGCCACTTTTCACTCCTGG - Intronic
1060990391 9:127845613-127845635 CTGTTGTCATTTTATAGACCAGG - Intronic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1185785865 X:2890435-2890457 CCATTTTAATTTTTCACCCCTGG - Intergenic
1186864969 X:13711075-13711097 ATGTTTTTATTTTTCACCCTTGG + Intergenic
1186976847 X:14916996-14917018 GTGTTCACATTTTTCCCCCCAGG + Intronic
1188665051 X:32809019-32809041 CTGTTGTAATTTTTCACTCTGGG - Intronic
1188939200 X:36216325-36216347 CTGTTGACATGTTCCATCCCAGG + Intergenic
1196069753 X:111507829-111507851 ACGTTGTCATTTTTACCCCCAGG + Intergenic
1201636538 Y:16128790-16128812 CTCTTGTCATTTGTCATCCCTGG - Intergenic
1202017217 Y:20422779-20422801 CTGTTGTTTTTATTCACCTCAGG + Intergenic