ID: 902284060

View in Genome Browser
Species Human (GRCh38)
Location 1:15395021-15395043
Sequence CCGCACCCAGCCTTTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902284060_902284071 24 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284071 1:15395068-15395090 CTTTGGGAGGCCGAGATGGGCGG 0: 1848
1: 34981
2: 120297
3: 161864
4: 167878
902284060_902284069 20 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284069 1:15395064-15395086 AGCACTTTGGGAGGCCGAGATGG 0: 5294
1: 101129
2: 189241
3: 132828
4: 69895
902284060_902284070 21 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284070 1:15395065-15395087 GCACTTTGGGAGGCCGAGATGGG 0: 2393
1: 48068
2: 196944
3: 268621
4: 177352
902284060_902284066 11 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284066 1:15395055-15395077 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
902284060_902284064 8 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284064 1:15395052-15395074 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
902284060_902284063 7 Left 902284060 1:15395021-15395043 CCTATGGGAAAGGCTGGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 902284063 1:15395051-15395073 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902284060 Original CRISPR CCGCACCCAGCCTTTCCCAT AGG (reversed) Intronic
900185644 1:1331964-1331986 CCCCACCCAGCCCTGCCCGTGGG + Intronic
900434660 1:2623706-2623728 CCTGCCCCAGCCTTTCTCATCGG - Intronic
901188259 1:7388795-7388817 CAGCTCCCATCCTGTCCCATGGG + Intronic
901428063 1:9196081-9196103 CCCCCTCCAGCCTTTCCCTTTGG - Intergenic
901660589 1:10795949-10795971 CCCCACCCACCCCTTCCCATGGG + Intronic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
903034147 1:20484128-20484150 CCGCACCTAGCCTTGCCCACCGG - Intronic
903064826 1:20693554-20693576 CCGCACCCAGCCTCCACCTTGGG + Intronic
903472009 1:23593800-23593822 CCTCCCTCGGCCTTTCCCATGGG + Intronic
903635488 1:24811768-24811790 CTGCACCCAGCCTGCCCCAGAGG + Intronic
904599702 1:31666670-31666692 CCCCACCCAGCCTCTCCCTCTGG + Intronic
904769338 1:32872135-32872157 CTGCACCAAGCTCTTCCCATCGG - Intronic
904836217 1:33338832-33338854 CCTCCCCCAGCCTCTCCCATCGG - Intronic
907523942 1:55042868-55042890 CGGCACCAAGCCTTTCACAGGGG - Intronic
916633286 1:166639573-166639595 CCGGACCCAGCCTTTGAGATGGG - Intergenic
917286989 1:173431584-173431606 TAGCAGCCAGCCTTTCCCCTGGG - Intergenic
920022199 1:202965027-202965049 ATGCACCCAGCTGTTCCCATGGG + Intronic
921053997 1:211530548-211530570 TAGCACCGAGCCTTTCCCAGTGG - Intergenic
921316270 1:213894246-213894268 CCTGGCCCAGCCTTCCCCATGGG + Intergenic
922490521 1:226012855-226012877 CAGCATCCAGCCCTTCTCATTGG - Intergenic
922714832 1:227863521-227863543 CTGCACCCAGCACTTCCCTTAGG - Intergenic
924515670 1:244763633-244763655 CCACACCCAGCCTTTCCTACAGG + Intergenic
1062913556 10:1230365-1230387 CCGCCGCCAGCCTTTCCTTTGGG + Intronic
1064379699 10:14830292-14830314 CCGAACCCATCCCTACCCATAGG - Intronic
1065634408 10:27715849-27715871 CAGCCCCCAGCCCATCCCATAGG - Intronic
1066065854 10:31760262-31760284 CCGCCCCCCGCATTCCCCATTGG + Intergenic
1075886974 10:125908592-125908614 CCCCTCCCACCCTTTCCCCTGGG - Intronic
1080010293 11:27452319-27452341 CTTCACCCAGCTTTTCCCAATGG + Intronic
1080586525 11:33687880-33687902 CAGCACCTGGCCTTTCCCAGAGG - Intergenic
1081454931 11:43212288-43212310 CCTGACCCAGCCTTCCTCATTGG - Intergenic
1084104488 11:66972312-66972334 CCGCACCCAGCCTGTAAAATGGG - Intergenic
1084329190 11:68420411-68420433 CCGCGCCCAGCCTTTACAACGGG - Intronic
1084607478 11:70180987-70181009 CGGCCCTCAGCCTTCCCCATCGG + Intronic
1084657626 11:70528463-70528485 CCCCATCCAGCCCCTCCCATGGG - Intronic
1085658891 11:78343607-78343629 CCGCATACAGCCTTTCCCCATGG - Intronic
1087067689 11:94042956-94042978 CCTATCCCAGCCTTTCCCAAAGG - Intronic
1088004879 11:104927571-104927593 CTGCAGCCAGCCTTCCCCCTAGG - Intergenic
1088581488 11:111320952-111320974 CCACCCCCAGCATTTCCCAGGGG + Intergenic
1088794711 11:113258050-113258072 CCTCATCCAGCCTTAGCCATGGG + Intronic
1089299993 11:117492782-117492804 CCGCCCCCAGCCTTTCCCAGGGG - Intronic
1089641225 11:119848469-119848491 CCACACCCAGCCTTTCTCTTAGG - Intergenic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1091658664 12:2364375-2364397 CCACTCCCAGCCTCTCCCACTGG - Intronic
1094429262 12:30348831-30348853 CCACACCCAGCTTTTCCTATTGG + Intergenic
1096498909 12:52053960-52053982 CCCCACCATGCCTTCCCCATGGG + Intronic
1096764098 12:53868923-53868945 ACACACCCAGCCTTCACCATGGG + Intergenic
1099248538 12:80223032-80223054 CACCCCCCAGCCTTTCCCCTTGG + Intronic
1102411743 12:112726083-112726105 CCGCACCCAGCCTTTTTTTTCGG + Intronic
1102412484 12:112732189-112732211 CAGAACCCAGCTTTTCCCTTGGG - Intronic
1102514870 12:113439731-113439753 CCGGAGCCAGCCTTCCCCATAGG - Intergenic
1103595790 12:122023548-122023570 TCGCAGCCAGCCCTTTCCATAGG - Intronic
1104657086 12:130581454-130581476 GCCCACCCAGCCTGTCCCAGTGG + Intronic
1104666573 12:130651400-130651422 CAGCACCCTGCCTTGCACATGGG - Intronic
1104937726 12:132375406-132375428 ACCCACCCAGCCTGGCCCATAGG + Intergenic
1108195630 13:47991763-47991785 GTGCACCCAGTTTTTCCCATTGG - Intronic
1109816844 13:67596007-67596029 CCGCGCCCAGCCTACCCCATTGG - Intergenic
1112599178 13:100838562-100838584 CCACTCCCAGCCATGCCCATGGG - Intergenic
1113101223 13:106721732-106721754 ACGATCCCAGCCTTTGCCATGGG + Intergenic
1113573664 13:111379098-111379120 CCATACCCAGCCTTTCCTGTAGG + Intergenic
1113660635 13:112104635-112104657 CCCCAGCCCACCTTTCCCATTGG + Intergenic
1114448292 14:22806812-22806834 CTGCCTCCAGCCTTGCCCATAGG - Intronic
1114861748 14:26531315-26531337 CCGCGCCCAGCCTCTCCTAGAGG - Intronic
1117341521 14:54796188-54796210 CCACAACCTGCCTTGCCCATGGG + Intergenic
1117968024 14:61225462-61225484 CAGCACACCGCCTTTACCATCGG - Intronic
1119386680 14:74261619-74261641 CCACACCCAGCCTGTCCCACTGG + Exonic
1120589758 14:86361832-86361854 CCTGACACAGCCTTTCCCCTGGG - Intergenic
1121075434 14:91064338-91064360 CCGCACCCAGGCTTCTCCCTAGG - Intronic
1121836024 14:97093134-97093156 CCCCACCCAGCCTCTCTCCTTGG - Intergenic
1122666508 14:103334000-103334022 CCTCCCCCCGCCTTTCCCAGAGG - Exonic
1202871138 14_GL000225v1_random:165417-165439 CCCCTCCCACCCTTTCCCCTGGG + Intergenic
1124249523 15:28097719-28097741 CCACACCTGGCCTTTCCCAGGGG + Intronic
1125551810 15:40550753-40550775 CCGCACCCAGGTTTACACATGGG + Intronic
1125814965 15:42576064-42576086 CCTCTCCCAGCCTTTCTCAAAGG - Intronic
1129069874 15:72941885-72941907 CATCTCCCAGCCTTTCTCATAGG - Intergenic
1131234419 15:90683559-90683581 CCGCCCCCAGCCACACCCATGGG - Intergenic
1132644030 16:990680-990702 CCGGCCCCCGCCTTCCCCATGGG + Intergenic
1132854034 16:2036893-2036915 CCGCACCCACCCTGTGCCCTGGG - Intronic
1133334228 16:4996343-4996365 CCGCATCCAGCTTGTCCCCTTGG - Exonic
1133623111 16:7545290-7545312 CCGCACCCTGCCTCTCTCAGTGG - Intronic
1133771352 16:8868757-8868779 CCACACCCACCCCTTCCCCTGGG + Intronic
1134046433 16:11104415-11104437 CCACACCCAGCATATCCCAGAGG + Intronic
1134115314 16:11543647-11543669 CCGCATCCAGCCTCCCCCAGGGG + Intergenic
1134440638 16:14297860-14297882 CCGCACCCGGCCTGTACAATAGG - Intergenic
1134540597 16:15061662-15061684 CAGCACCCAGCTTGTGCCATTGG - Exonic
1137576332 16:49602633-49602655 CCACACCCAGCCTGTGCCCTGGG - Intronic
1137708903 16:50553139-50553161 CCACACCCAGTGTTTCCAATTGG - Intronic
1138652063 16:58466304-58466326 CCGCACCCAGCCCCCACCATGGG + Intronic
1139947940 16:70654406-70654428 CCCCACCACACCTTTCCCATTGG + Intronic
1141471328 16:84240481-84240503 GGTCACCCAGCCTTTCACATAGG - Intergenic
1142270953 16:89088962-89088984 CCACCCCCAGCCTTTCCCGGAGG - Intronic
1143389128 17:6549801-6549823 CCACACCGAGCCCTTCCCCTGGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146747465 17:35345243-35345265 CCTTACCCAGCCCTCCCCATAGG + Intergenic
1147474237 17:40694935-40694957 CCGCACCCAGCCTCGCACATGGG - Intergenic
1147635420 17:41960971-41960993 CAGCCCCCAGCCTGTCCCCTTGG + Intronic
1148511242 17:48171770-48171792 CCGCACCCAGCCAATCACAGAGG - Intronic
1148930178 17:51121048-51121070 CCGACCGCAGTCTTTCCCATTGG - Intergenic
1150137367 17:62703389-62703411 GGGCACCCAGCCTCCCCCATAGG - Intronic
1151745957 17:76011916-76011938 CCACACCCAGCCTCCCCCACTGG - Intronic
1152226593 17:79095622-79095644 CCCCACTCAGCCTTTCCCTGGGG - Intronic
1152375244 17:79915537-79915559 CCCCACCCAGCTTTTCCCCAAGG - Intergenic
1152660420 17:81539493-81539515 CCAAACCCAGCCTTTTCAATGGG - Intergenic
1160556350 18:79727854-79727876 CCGCACCACCCCTTTCCCAGAGG + Intronic
1160698216 19:494693-494715 CTGCACCCAGCCCCTCCCCTAGG + Intronic
1160911297 19:1474969-1474991 CTGCACCCAGGCTTTCCCTGGGG - Exonic
1161056815 19:2194871-2194893 CAGAACCCAGCCTGTCCCACAGG - Intronic
1164369868 19:27635079-27635101 CCGCACCCAGACTTTCTAATGGG - Intergenic
1167647235 19:50712362-50712384 TCCCACCCAGCCTTCCCCCTGGG + Intronic
1167937114 19:52918197-52918219 CCGCACCCAGCCTCTGCAAGTGG - Intergenic
1167995368 19:53397669-53397691 CCGCACCCAGCCTTTGCATGAGG + Intronic
1168005502 19:53483476-53483498 CCGCACCCAGCCTTTGCATGAGG + Intronic
1168127558 19:54294394-54294416 CCTGAGCCAGCCTCTCCCATGGG + Intergenic
925919833 2:8631203-8631225 CCCCTCCCAGCCCTTCCCCTTGG + Intergenic
925984619 2:9206373-9206395 CCGCACCCCGCTTTCCTCATGGG + Intergenic
926101799 2:10122673-10122695 GCGCTCCCGGCCCTTCCCATTGG - Exonic
927603341 2:24463623-24463645 ATGCACCCAGCTTTGCCCATGGG + Intergenic
928568996 2:32584080-32584102 CCGCACCCAGCCTATTCTTTAGG - Intronic
928951507 2:36817366-36817388 CCCCACCCAGCCTTCCCCCTGGG - Intergenic
931461994 2:62457382-62457404 CCGCACCCAGCCCTTCCTCCAGG - Intergenic
932343655 2:70982143-70982165 CCTCCCCCAGCCTTTTCCCTAGG + Intronic
933999445 2:87695314-87695336 CCCTTCCCAGCCTTTGCCATGGG - Intergenic
935844989 2:107155868-107155890 CTGCACTCTGCATTTCCCATTGG + Intergenic
935942565 2:108256100-108256122 CCACAGACAGCCTTTCCCGTAGG + Intronic
936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG + Intronic
936294409 2:111255577-111255599 CCCTTCCCAGCCTTTGCCATGGG + Intergenic
936876149 2:117192080-117192102 CCTCATCCAACCTTTCCAATAGG + Intergenic
937216533 2:120316809-120316831 CCCCACTCACCCTTGCCCATGGG + Intergenic
938307603 2:130265884-130265906 CCCCACCCAGCATTCCCCAGGGG + Intergenic
938447729 2:131390958-131390980 CCCCACCCAGCATTCCCCAGGGG - Intergenic
941110699 2:161416807-161416829 GCGCACCCCGCCTTCTCCATCGG + Exonic
944181920 2:196904833-196904855 CTGCCCCTAGCCTTTCCCACAGG - Intronic
946076673 2:217079380-217079402 CACCACTCAGCCTCTCCCATTGG - Intergenic
947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG + Intronic
947900264 2:233715840-233715862 CTGCACCCAGCTTTTCATATTGG - Intronic
947901663 2:233726235-233726257 CTGCACCCAGCTTTTCATATTGG - Intronic
1170429466 20:16263314-16263336 CCTCACCCAGACTGTACCATGGG - Intergenic
1172904247 20:38357143-38357165 CCACACCCAGCCAGTCCCATTGG + Intronic
1176422971 21:6531244-6531266 CCGCACCCAGCCTATGACATAGG - Intergenic
1177342932 21:19828042-19828064 CTGCACACAGCTTTGCCCATTGG - Intergenic
1178981411 21:37267900-37267922 CCGCACCCTGCCCTTCCCGCGGG + Intronic
1179698465 21:43139561-43139583 CCGCACCCAGCCTATGACATAGG - Intergenic
1179828541 21:43981860-43981882 CTGCCACCAGCCTCTCCCATTGG + Intronic
1180146131 21:45920082-45920104 CCGCACACTGCCTTTCCTTTGGG - Intronic
1180186411 21:46141953-46141975 CCGCTCCCAGCCTGGCCCCTTGG - Intronic
1180228699 21:46413380-46413402 CTGCACCCAGCCTCTCCCAGGGG - Intronic
1181746853 22:24961283-24961305 CCACACCCAGCCTGGCCCTTGGG + Intronic
1183216252 22:36482035-36482057 CCTCAGCCCGCCATTCCCATTGG - Intergenic
1183975383 22:41508941-41508963 CCGCCCCGAGTGTTTCCCATGGG - Intronic
1184364198 22:44039075-44039097 CATCTTCCAGCCTTTCCCATGGG - Intronic
1184827794 22:46964848-46964870 CCACAGCCAGCCTTTCACGTGGG + Intronic
950875255 3:16265356-16265378 CCCCACCCCGCCTTTCCCGAGGG - Exonic
955900001 3:63742785-63742807 CATCACCCAGCTTTCCCCATAGG - Intergenic
956255404 3:67278241-67278263 CTGCATCCCGCCTTTCCCAATGG + Intergenic
956431363 3:69189519-69189541 CTTCACCCAGCTTTTCCCAATGG - Intronic
956678405 3:71755200-71755222 CCCAACCCAGCCTTTCCCTTTGG + Exonic
956710536 3:72035106-72035128 CCCAACCCAGCACTTCCCATTGG - Intergenic
956710564 3:72035246-72035268 CCCAACCCAGCACTTCCCATTGG - Intergenic
960035413 3:113097591-113097613 CTTCACTCAGCCTTTCCCACAGG + Intergenic
961173116 3:124813185-124813207 CCCAGCCCAGCCTTTCCCGTTGG + Intronic
964115101 3:153128293-153128315 CCCCTCCCACCCTTTCCCCTAGG + Intergenic
968771533 4:2510682-2510704 CCTCACCCTGCCTGTCCCCTGGG - Intronic
969253172 4:5983358-5983380 CCACACCCTTCCTTGCCCATTGG + Intronic
970021501 4:11574473-11574495 CCTCACTCATTCTTTCCCATGGG + Intergenic
970397126 4:15680378-15680400 CTGCACCCAGCCTCTCCCACTGG - Intronic
971498046 4:27288793-27288815 CCGATGCCTGCCTTTCCCATTGG + Intergenic
972446633 4:39150577-39150599 CCGCACCCGGCCTTTACCTGTGG - Intergenic
973888580 4:55346826-55346848 CCGCACGGAGCCTTTCCCTGTGG + Intronic
976184262 4:82429601-82429623 CCTCCCGCAGCCTCTCCCATTGG - Exonic
978748337 4:112220308-112220330 CAGCCACTAGCCTTTCCCATAGG - Intergenic
979738033 4:124112922-124112944 CCCCACTCACCCTTTTCCATGGG - Intergenic
985713539 5:1443353-1443375 ACGCACCCATCCCTTCCCAGAGG - Intronic
987191243 5:15480578-15480600 CACCAGCCACCCTTTCCCATTGG - Intergenic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
999277674 5:150342479-150342501 CTGCCCCCAGCCTTTCCTTTAGG + Intergenic
1002211941 5:177604549-177604571 CCGCCCCCACCCTCTCCCCTCGG + Intronic
1002348790 5:178567450-178567472 CCACACCCAGCCTTTCAGGTTGG - Intronic
1002749771 6:96954-96976 CCACAGCCACCCTTTCCCCTAGG - Intergenic
1003638695 6:7858373-7858395 CCACACCCAGCCTTCCCAACCGG + Intronic
1006077281 6:31541883-31541905 CCGCACCCATCCCGTCACATGGG - Intronic
1007299532 6:40856385-40856407 ACCCATGCAGCCTTTCCCATGGG + Intergenic
1009211442 6:60868135-60868157 CCTTATCCACCCTTTCCCATGGG + Intergenic
1013013015 6:106136532-106136554 CCGCACCCGGCCTGACCCACAGG - Intergenic
1016647755 6:146429611-146429633 CCCCACCAAGACTTTCCCAAAGG - Intronic
1017146093 6:151236915-151236937 CCCCACACATCCTCTCCCATGGG - Intergenic
1017989529 6:159473881-159473903 CCTTACCCAGCCTTTCCAAAAGG + Intergenic
1018183730 6:161246653-161246675 CCGCACCCAGCCTAGCACAGGGG + Intronic
1018803504 6:167241086-167241108 CCGATCCCAGCCTTTCCTGTTGG - Intergenic
1019512695 7:1425975-1425997 CCTCTCCCAGCCTTTCCACTCGG + Intergenic
1022813117 7:33888312-33888334 CCCTCCCCTGCCTTTCCCATTGG + Intergenic
1023190477 7:37575550-37575572 TCGCACCTGGCCTTTTCCATTGG - Intergenic
1025977163 7:66378373-66378395 CCACGCCCAGCTTTTCCCTTTGG - Intronic
1028028692 7:85880417-85880439 CCCCTCCCACCCTTTCCCCTGGG - Intergenic
1028430569 7:90742873-90742895 CCGTACCAAGCATTTCCGATAGG - Intronic
1030759366 7:113331860-113331882 CCTAACTCATCCTTTCCCATTGG + Intergenic
1031895872 7:127347627-127347649 CCGCCCCCAGCCTGTCCCTAAGG + Intronic
1032041401 7:128565567-128565589 CTGCACCCAGCCTTTGAGATTGG + Intergenic
1033209163 7:139447691-139447713 CCGCACCCAGCCTTTTGAATTGG + Intergenic
1035731538 8:1856855-1856877 CCCCTGCCAGCCTTTCCCAAGGG - Intronic
1036769591 8:11569977-11569999 CCGCACGCTGCTTTTCCCATCGG + Intergenic
1037786375 8:21905825-21905847 CCTCACCCCACCTTTCCCAAGGG + Intergenic
1040108618 8:43555210-43555232 CCTCACTCAGGCTCTCCCATGGG - Intergenic
1040576904 8:48660434-48660456 CTGCACCCAGCTTCTCCTATTGG + Intergenic
1042593934 8:70425406-70425428 CCCCACCCAGCCCCTCCCTTCGG + Intergenic
1044988342 8:97774497-97774519 CCGCACCCACCCTTAAACATGGG - Intergenic
1046273233 8:111922823-111922845 CCCCACCTACCCTTTCCCGTAGG - Intergenic
1048561673 8:135545179-135545201 ACGCAAGCAGCCTTTCCCCTGGG + Intronic
1048614225 8:136056854-136056876 TTGCCCCCAGCCTCTCCCATAGG + Intergenic
1049412066 8:142477901-142477923 CCACACCCAGCCTGTGACATGGG - Intronic
1049780519 8:144426622-144426644 CCACACACAGCCTCTCCCCTGGG + Intronic
1052006884 9:23360093-23360115 CCACCCCCAGCCCCTCCCATTGG + Intergenic
1052970284 9:34373167-34373189 CCTAACCCACCCTTTCTCATGGG + Intronic
1059340420 9:113594712-113594734 CCCCACCTAGCCTTCCCCCTAGG - Intronic
1061506906 9:131036686-131036708 GCCCACCCAGCCTCTCCCACGGG + Intronic
1061665404 9:132157973-132157995 CGGCACCCTGCCTTTCCCGGTGG - Intergenic
1061730892 9:132613171-132613193 CCTCACCCAGCCTTCCTCATGGG + Intronic
1062437694 9:136553915-136553937 CAGGACCCTGCCTCTCCCATTGG + Intergenic
1062635260 9:137487250-137487272 CCGCACCCAGCTTCTGCCAAGGG + Intronic
1203733317 Un_GL000216v2:111170-111192 CCCCTCCCACCCTTTCCCCTGGG - Intergenic
1187832888 X:23400663-23400685 ATTCACCCAGCCCTTCCCATAGG - Exonic
1192318819 X:70072568-70072590 CCCCTCCCATCCTTTCCCCTAGG - Intergenic
1198394217 X:136206609-136206631 CAAAACCCAGCCCTTCCCATTGG - Intronic
1198860822 X:141068113-141068135 GCACACCCAGGCTTACCCATAGG + Intergenic
1198901870 X:141519273-141519295 GCACACCCAGGCTTACCCATAGG - Intergenic
1199431873 X:147770910-147770932 GAGCTCCCAGCCTATCCCATGGG - Intergenic
1200267899 X:154655612-154655634 CTTCACCCACCCTTACCCATCGG - Intergenic
1201979659 Y:19892998-19893020 CCTCACCCATCCTTTCTCATTGG + Intergenic
1202627693 Y:56877255-56877277 CCCCTCCCACCCTTTCCCCTGGG + Intergenic