ID: 902285436

View in Genome Browser
Species Human (GRCh38)
Location 1:15405401-15405423
Sequence ATGCTGTCCTCAGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902285427_902285436 2 Left 902285427 1:15405376-15405398 CCCCAACCCCTATCTGATGCCAC 0: 1
1: 0
2: 2
3: 14
4: 168
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285428_902285436 1 Left 902285428 1:15405377-15405399 CCCAACCCCTATCTGATGCCACT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285426_902285436 6 Left 902285426 1:15405372-15405394 CCAGCCCCAACCCCTATCTGATG 0: 1
1: 0
2: 3
3: 29
4: 289
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285430_902285436 -4 Left 902285430 1:15405382-15405404 CCCCTATCTGATGCCACTGATGC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285432_902285436 -6 Left 902285432 1:15405384-15405406 CCTATCTGATGCCACTGATGCTG 0: 1
1: 1
2: 2
3: 28
4: 259
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285431_902285436 -5 Left 902285431 1:15405383-15405405 CCCTATCTGATGCCACTGATGCT 0: 1
1: 0
2: 2
3: 11
4: 142
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285424_902285436 18 Left 902285424 1:15405360-15405382 CCAGCAGGTCACCCAGCCCCAAC 0: 1
1: 0
2: 1
3: 37
4: 325
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285425_902285436 7 Left 902285425 1:15405371-15405393 CCCAGCCCCAACCCCTATCTGAT 0: 1
1: 0
2: 0
3: 29
4: 302
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
902285429_902285436 0 Left 902285429 1:15405378-15405400 CCAACCCCTATCTGATGCCACTG 0: 1
1: 0
2: 0
3: 13
4: 180
Right 902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902285436 Original CRISPR ATGCTGTCCTCAGGGAAAAC AGG Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901626593 1:10628491-10628513 TTCTTTTCCTCAGGGAAAACCGG - Intronic
901777942 1:11573510-11573532 CTGCTTTCCTCAAGGTAAACTGG + Intergenic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902815153 1:18912186-18912208 AGGCTGTCCTCAGGAAAGACAGG + Intronic
902842300 1:19082682-19082704 ATGCTGGACTCTGGGAAAGCAGG + Intronic
903699174 1:25233404-25233426 AGGCTGGCCTCAGGGAAGAAGGG - Intergenic
904340929 1:29834050-29834072 ATGCTGTCCTGAGAGCAAAGAGG - Intergenic
909970492 1:81980009-81980031 ATACTCTCCACAGGGAACACAGG + Intronic
915911781 1:159919936-159919958 AAGCTGTCTTCAGGCAAGACAGG - Intronic
917857173 1:179110171-179110193 ATGCTTTCCCCAGGGAGGACGGG + Intronic
919582642 1:199396393-199396415 ATGCTGTCATCAGAGTAGACTGG + Intergenic
920690577 1:208143473-208143495 ATGCTGACCTCAAAGAAAAGAGG + Intronic
921398091 1:214690004-214690026 ATGCTGTCCTTAGAGAAAGTTGG + Intergenic
921893344 1:220374545-220374567 AACCTGGCCTCAGGGAGAACTGG + Intergenic
922000521 1:221473107-221473129 ATGCTGCTCTCAGGGATAAGAGG - Intergenic
922753167 1:228080449-228080471 ATGATGTCTTCAGGCCAAACAGG - Intergenic
923534935 1:234841871-234841893 ATGCTGTCTTCATAGAAATCAGG - Intergenic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924595619 1:245442474-245442496 ATGTGGTCCTCAGGGAAACTGGG + Intronic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1067434050 10:46264916-46264938 ATGCTGTCCTCAGAAAACCCTGG + Intergenic
1068617257 10:59132798-59132820 AAGGTGTCTTCAGGGAGAACAGG + Intergenic
1069855610 10:71439413-71439435 ATGCTGTCCTCAGGATAACCAGG + Intronic
1070043132 10:72802106-72802128 ATTCTGTCCTGAAGGACAACAGG + Intronic
1071154747 10:82675494-82675516 ATGCTGTCCACAGGGGTAATCGG + Intronic
1074209535 10:111317282-111317304 ATGCTCAGCTCAGAGAAAACTGG - Intergenic
1074858314 10:117489962-117489984 CTGCTGTCCCCAGGGAAAGGTGG - Intergenic
1074951506 10:118341962-118341984 AGGCTGTCGATAGGGAAAACAGG - Intronic
1076486972 10:130828017-130828039 ATACTGTCCTCAGGGAACCCGGG - Intergenic
1078815178 11:14813758-14813780 ATGCTGGCCTCATAAAAAACTGG - Intronic
1079177323 11:18154212-18154234 ATACTTTGCTCAGGGAAAGCTGG + Intronic
1079191439 11:18280758-18280780 ATGCTATGCTCAGTGAAAACAGG + Intronic
1080040174 11:27751826-27751848 ATGCTGTCCTCAGAGTATAATGG + Intergenic
1080652859 11:34236496-34236518 ATGCTGCTGTTAGGGAAAACTGG - Intronic
1081193601 11:40134503-40134525 CTACTGTCCACAGGCAAAACTGG + Intronic
1082183663 11:49151947-49151969 GTGCTATCCTCAGGGAATATTGG - Intronic
1083459001 11:62798703-62798725 AGCCTGTGCTCAGGGAAAAATGG + Intronic
1084859993 11:72011975-72011997 AAGCTGTACTCTGGGAAAAAGGG + Intronic
1085463365 11:76708440-76708462 ATTCTGTCCTCAAGAAAACCTGG + Intergenic
1086682692 11:89693407-89693429 GTGCTATCCTCAGGGAATATTGG + Intergenic
1089711034 11:120314928-120314950 CTGCTGTCCTCAGCAAAAGCAGG + Intronic
1089816769 11:121183040-121183062 AGGCTGTCCCCAGGAAAAAGGGG - Intronic
1091829155 12:3536936-3536958 ATGCTGTCCTTAGTGACAAAAGG - Intronic
1092692261 12:11127130-11127152 AGGCTGTCTTAATGGAAAACAGG + Intronic
1097205139 12:57314602-57314624 CTGCTAACCTCTGGGAAAACTGG + Intronic
1098631594 12:72729495-72729517 ATACTGTTTTCAGGAAAAACTGG - Intergenic
1099687558 12:85908990-85909012 AAGCTATCATCAGGGAGAACAGG + Intergenic
1099744463 12:86684987-86685009 ATACTATCCTCAGGGTGAACAGG - Intronic
1099813991 12:87621733-87621755 ATGCTTTCCTCAGGCAATGCAGG + Intergenic
1100364820 12:93910492-93910514 ATTCTGGCCTCATGGAGAACTGG + Intergenic
1102000176 12:109552652-109552674 ATGCTGTCCTCAGCGTCACCTGG + Intergenic
1106409721 13:29502878-29502900 ATGATGACCGCAGGGAGAACAGG - Intronic
1109013408 13:56977903-56977925 TTCATGGCCTCAGGGAAAACTGG - Intergenic
1109241119 13:59889880-59889902 ATGAACTCCCCAGGGAAAACAGG - Intronic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1111101232 13:83589684-83589706 ATGCTGTCCTCACAGATAGCAGG + Intergenic
1114189405 14:20429394-20429416 GTGCTGGCCTAAGGGAGAACAGG + Exonic
1114822838 14:26042290-26042312 ATATTGTCCTCAGGCAATACTGG + Intergenic
1115873260 14:37830579-37830601 ATGAGGTCCACAGGGATAACAGG - Intronic
1117327484 14:54682924-54682946 ATGCTGGCTGCAGGGAACACAGG - Intronic
1118186865 14:63545540-63545562 GAGATGTCCTCAGGGAAAAGTGG + Intergenic
1120685971 14:87538010-87538032 AAGCTGTCATCAGTGAAAAAAGG + Intergenic
1121859983 14:97308363-97308385 ATGCTGCCATCAGGGAAACAGGG - Intergenic
1122831264 14:104397528-104397550 ATTCTATCCTCATGGAAAACAGG + Intergenic
1124126103 15:26939236-26939258 ATGCCGTCCTCACGGTGAACTGG - Intronic
1125300286 15:38247577-38247599 TTGCCGTCCTTAGGGAAAAAAGG + Intergenic
1127432358 15:58923054-58923076 ATGCTGGACACATGGAAAACAGG + Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1129922876 15:79335426-79335448 ATACTGTCCTCAGGGAACTCTGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132077736 15:98836557-98836579 ATGCTAACGTTAGGGAAAACTGG - Intronic
1132162053 15:99551408-99551430 ATGCTGGCAACAGGGAAGACCGG - Intergenic
1133102736 16:3489020-3489042 ATGCTGGCCCCAAAGAAAACTGG - Intergenic
1133103505 16:3493150-3493172 ATGCTGGCCCCAAAGAAAACTGG + Intergenic
1134471169 16:14527225-14527247 ATCATGTCGTCAGGTAAAACTGG - Intronic
1138146190 16:54614112-54614134 ATGCTCACCTCAGGAAAATCAGG + Intergenic
1138582458 16:57950534-57950556 ATGCTGACTGCAGGGAACACAGG + Exonic
1140546742 16:75817029-75817051 ATACTGGCCTCTGGGAAAAGGGG + Intergenic
1141448668 16:84081387-84081409 ATGGTGGCATCAGGGGAAACTGG + Intronic
1142940899 17:3379229-3379251 AGACTGTCCTCAGGAGAAACTGG + Intergenic
1143161310 17:4873329-4873351 ATGCTGTGCTGTGGGAGAACAGG - Intronic
1143161320 17:4873409-4873431 ATGCTGTGCTGTGGGAGAACAGG - Intronic
1143161330 17:4873489-4873511 ATGCTGTGCTGTGGGAGAACAGG - Intronic
1143454155 17:7054946-7054968 ATACTCTCCTCAAGGACAACAGG - Intergenic
1145795611 17:27653808-27653830 CTGCTGTCCTCAGGGAAGTGGGG + Intergenic
1148510649 17:48166572-48166594 AGGCTGTGATCAGGGAAAAGTGG + Intronic
1148856991 17:50584312-50584334 ATGCTGGCCTGAGGGAAGAGAGG + Intronic
1148945370 17:51258746-51258768 ATGCACTCCTAAGAGAAAACAGG + Intronic
1149526108 17:57357141-57357163 AGGCTGTCCTCAAGGAGAAACGG - Intronic
1152350837 17:79783334-79783356 ATGCTGTCCCCAAGGAACACTGG - Intronic
1152409502 17:80116057-80116079 ATCCTCTCCTCTGTGAAAACAGG - Intergenic
1152448860 17:80363769-80363791 AGGCTGTCATCAGGGAAGTCAGG + Exonic
1152798525 17:82320492-82320514 ATGCTGTCCTCAGACACACCAGG - Intergenic
1153844665 18:9038458-9038480 CTCCTGTTCTCAGGAAAAACTGG + Intergenic
1153939172 18:9962417-9962439 ATGCTGCCTTTAGGGAAAAAAGG + Intergenic
1157385100 18:47253694-47253716 ATTCAGTCCTCAGGGTAACCTGG - Intergenic
1157541990 18:48517294-48517316 GGGCTGTCCTCAGGGAATACAGG + Intergenic
1158521618 18:58175908-58175930 ATGCTTCCCTCTGGGAAACCTGG - Intronic
1159511630 18:69402347-69402369 ATCCAGTCATCAGGGAACACAGG - Intronic
1160807426 19:998619-998641 CTGGTGTCCTCAGGGACCACTGG - Intergenic
1160924788 19:1538753-1538775 ATTCTGTCCCCAGGGGACACTGG + Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161030401 19:2055539-2055561 ATCCTGTCCCCAGGGGACACTGG - Intergenic
1161105088 19:2439546-2439568 ATTCTGTCCCCAGGGGACACTGG - Intronic
1161141113 19:2648435-2648457 ATGCTAACATAAGGGAAAACTGG + Intronic
1162910462 19:13845015-13845037 CTGCTGTCCCCTGGGTAAACCGG - Intergenic
1163448188 19:17360004-17360026 GAGCTGGCCTCAGGGAAAGCAGG - Intronic
1164566952 19:29332773-29332795 ATGTTGTCCCAAGGTAAAACTGG + Intergenic
1164589763 19:29500261-29500283 AGGCAGTCCTCAGGGGAACCAGG - Intergenic
1165094797 19:33404202-33404224 TAGCTGTCCCCAGGCAAAACTGG - Intronic
1166733852 19:45073134-45073156 TTCCTGTCCTGAGGGAAAGCCGG - Intronic
1166788769 19:45385370-45385392 ATGCCCTCCTAAGGGAAAAGGGG - Intronic
925403040 2:3589315-3589337 ATGCTGGCATGAGGGGAAACAGG - Intergenic
925414081 2:3657291-3657313 TTGCTTTCCTCTGGGAAAGCTGG + Intergenic
926108949 2:10170021-10170043 ATGCTGCCTTCAGGGACAGCAGG - Intronic
927700687 2:25266579-25266601 CTGCTCTCCTCAGGGCAGACAGG + Intronic
930017992 2:46984065-46984087 GTGCTTCCCTCAGGGAATACTGG - Intronic
930240387 2:48930082-48930104 ATGCGGTTCTCAGGGAATCCTGG + Intergenic
931991283 2:67792977-67792999 ATGCTGTCCAGATGGAAACCTGG + Intergenic
932395091 2:71439116-71439138 ATGCTCACATCAGGGTAAACTGG + Intergenic
932502444 2:72195275-72195297 ATGCTGTCATCAGTGAGAAATGG - Intronic
932609538 2:73188415-73188437 TTTCTGTGCTCAGGAAAAACAGG - Intergenic
932764424 2:74460974-74460996 CTGCTGTCCTCAGGGAAGGTGGG - Intergenic
933360851 2:81282398-81282420 ATTCTGTGAACAGGGAAAACTGG - Intergenic
934149646 2:89134113-89134135 AAGCTGTCCTCAGGGAGAGCTGG - Intergenic
934217649 2:90047915-90047937 AAGCTGTCCTCAGGGAGAGCTGG + Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935715435 2:105935340-105935362 ATGGAGTCCTCAGGGCAGACAGG - Intergenic
935973609 2:108555728-108555750 AGGCTGTCCTGAGGGAAGGCAGG + Intronic
936379643 2:111973118-111973140 AGTGGGTCCTCAGGGAAAACAGG - Intronic
936686914 2:114838189-114838211 ATCCTAACCTCAAGGAAAACTGG + Intronic
937097482 2:119245219-119245241 ATGATTTCCTCGGGAAAAACTGG - Intronic
937710201 2:124972013-124972035 ATGCCTTCCACAGGCAAAACTGG - Intergenic
940702006 2:157056936-157056958 GAGCTGTCCTCTGGGAAGACTGG + Intergenic
940770831 2:157837949-157837971 ATGCTGTCCTCACTGGAAGCCGG - Intronic
942311020 2:174656761-174656783 CTGCTGTGCTCAGGGGAAACTGG + Intronic
942607289 2:177705982-177706004 ACGCTGTCCCTAGAGAAAACAGG + Intronic
943803312 2:192089567-192089589 ATGCTGTTCTCACGAAAAAATGG - Intronic
946010869 2:216562531-216562553 TTGCTGCCCCCAGGGAGAACAGG + Intronic
947384158 2:229574129-229574151 TGGCTGTCCTGAGCGAAAACTGG + Intronic
948887520 2:240891595-240891617 AAGCTGCCCTCAGGGAATCCGGG + Exonic
1169354449 20:4895808-4895830 ATGCTGTCCTGAGTGAGATCTGG + Intronic
1169845037 20:9980966-9980988 ATGCTGACCTCAAGGAAGAAGGG + Intergenic
1173622544 20:44447920-44447942 AAACTGTCCTCAGAGCAAACAGG + Intergenic
1174204800 20:48830395-48830417 ATTCTGTCCCCAGGGATATCTGG - Intergenic
1175328738 20:58148156-58148178 AGGCTGTCCCCAGGGAAGGCTGG - Intergenic
1175641622 20:60635105-60635127 ATGCTGCCCCCAGGAAAGACGGG - Intergenic
1175785079 20:61707194-61707216 GTGCTGTCCTCAGGGAGCTCAGG - Intronic
1177212535 21:18088175-18088197 CTCCGGTCCTCAGGGAAACCAGG - Intronic
1178083094 21:29085965-29085987 ATCCTGTTTTCAGTGAAAACAGG + Intronic
1179798321 21:43798557-43798579 TTGCTGTCCTCTGGGGAGACGGG - Intronic
1182174165 22:28266271-28266293 ATGTTGTCAGAAGGGAAAACGGG - Intronic
1182227770 22:28812922-28812944 ATGTTTGCCTCAGAGAAAACCGG + Intergenic
1182227995 22:28814859-28814881 ATGTTTGCCTCAGAGAAAACTGG - Intergenic
1183371734 22:37436378-37436400 ATGCTGGCTTCAGGGGAAGCTGG - Intergenic
1184631633 22:45785616-45785638 ATTCTGGCCTCATGAAAAACAGG - Intronic
1184960949 22:47928031-47928053 ATGCTGTCTCCTGGGGAAACAGG - Intergenic
949939476 3:9143792-9143814 GTTGTCTCCTCAGGGAAAACTGG - Intronic
950668178 3:14509772-14509794 ATGGTGGGCTCAGGGAACACAGG - Intronic
954633389 3:52058687-52058709 ATGCTGTCCTCAAGTGAGACTGG + Intergenic
955102824 3:55868716-55868738 AGGCTGACCTCAGCCAAAACGGG - Intronic
955526646 3:59827156-59827178 ATGCTGACCGCAGGTAACACAGG - Intronic
955684741 3:61538745-61538767 ACCCTGTCCTCAGGGAATCCTGG - Intergenic
960189019 3:114680794-114680816 ATGCTAGAGTCAGGGAAAACTGG + Intronic
960231247 3:115230041-115230063 ATGCTGTCCTAAGGGTAGAAAGG + Intergenic
960456465 3:117878746-117878768 ATGCTGACCTCAAGGGAAAGAGG + Intergenic
962059227 3:131907427-131907449 ATGCTGTACTCAGTTAAACCTGG - Intronic
962269129 3:133965317-133965339 GGGGAGTCCTCAGGGAAAACTGG + Intronic
963231249 3:142910675-142910697 ATGCTGTCCTCTCTGAAACCAGG + Intergenic
963399323 3:144777512-144777534 ATGGGGTGCTCAGTGAAAACTGG + Intergenic
963406501 3:144870337-144870359 ATGGTGCCCTCAGGGAAGATAGG + Intergenic
963892731 3:150653718-150653740 TTCCTGTCCTCAGGAAAAACAGG - Intergenic
964724134 3:159796488-159796510 CTGCTTTCCTCTGGGAAATCTGG - Intronic
964960513 3:162417886-162417908 ATCCTTTCCTCAGGGGAAAGGGG + Intergenic
965437189 3:168666775-168666797 GTCATGTCCTCAGGGAATACTGG + Intergenic
966378598 3:179322519-179322541 ATGCTGCCCTCAGGGCAAGAGGG - Intergenic
970079954 4:12271096-12271118 GGGCTATGCTCAGGGAAAACAGG - Intergenic
970291004 4:14572237-14572259 ATGTTTTCCTCAGGAAAATCAGG - Intergenic
975693747 4:76991289-76991311 ATTCTGCCCTCAGTAAAAACAGG - Intronic
975765739 4:77665862-77665884 ATGCTGACCTCATGGAAAAATGG + Intergenic
976407103 4:84672601-84672623 CTACTGTCATCAGGGAGAACTGG + Exonic
976593469 4:86872225-86872247 ATGCTGTCATCAGAGAGAATGGG - Intergenic
978207431 4:106094611-106094633 ATTCTGTCATCAGGGAAATCAGG - Intronic
978481088 4:109191551-109191573 ATGCACTCCTTATGGAAAACAGG - Intronic
978939947 4:114424085-114424107 ATCCTGTTCCTAGGGAAAACTGG + Intergenic
981816933 4:148841394-148841416 ATTCTGCCCTCAGGGAGACCAGG + Intergenic
982603639 4:157485277-157485299 AAACTGTCATCAGGGTAAACAGG - Intergenic
983149104 4:164255178-164255200 ATGTTGCCATCAGGGAAAGCTGG + Intronic
983640499 4:169940538-169940560 ATGGTGGCCTCAGGGGAAAAGGG + Intergenic
984058477 4:174960862-174960884 CTCCTGTCTTCAGGGAAAACTGG - Intronic
986497990 5:8366122-8366144 AAGCTGTCTTCAGGGAAAATCGG - Intergenic
986730389 5:10631099-10631121 AGGCTGGCCTTAGGGAAAAGGGG + Intronic
987345475 5:16975150-16975172 TTGCTTTCCCCATGGAAAACTGG - Intergenic
989519521 5:42384177-42384199 ATGCTGTCCTAAGTGAAATGTGG - Intergenic
994180378 5:96757504-96757526 AAGATATCCTCAGAGAAAACTGG - Intronic
995387228 5:111601390-111601412 ACGGTGTCCTGAGGAAAAACTGG - Intergenic
996240447 5:121193844-121193866 AGGCTGAACTCAGGGAACACTGG - Intergenic
998267181 5:140674862-140674884 CTGCTGTCCTCAGGGACAGAGGG + Intronic
999435739 5:151562048-151562070 ATGCTTTTCTCCTGGAAAACAGG - Intronic
1000256969 5:159548641-159548663 ATGCAGTTCTCAGGGAAGAGGGG + Intergenic
1001749217 5:174116053-174116075 ATGGTGTCCACATGGAAAATGGG - Intronic
1002425877 5:179175407-179175429 ATGCTGTCCTCATGGGAAGCTGG - Intronic
1004202188 6:13559122-13559144 ATGCTGTTCTCAGAGAAAAAGGG - Intergenic
1005480332 6:26249427-26249449 ACACTATGCTCAGGGAAAACGGG - Intergenic
1005961502 6:30696836-30696858 ATGCTGGCAACAGGGAGAACCGG - Intergenic
1006753777 6:36396750-36396772 ATGATGTCCTCAGGACAAAGAGG + Intronic
1008448050 6:51616671-51616693 ATTCTGGCCTCAGGGATCACAGG + Exonic
1008948576 6:57128668-57128690 ATCCTTTTCTCAAGGAAAACAGG + Intronic
1011228890 6:85137698-85137720 ATGATGTCTTCAGAGAAAGCAGG + Intergenic
1012614079 6:101253525-101253547 ATGTAGTCCTCAGGAAAAAAAGG + Intergenic
1015004197 6:128258602-128258624 TTGATGTCTTCATGGAAAACAGG + Intronic
1016300622 6:142627011-142627033 ATGCTCTCTTCAGGGTAAATTGG - Intergenic
1019322942 7:423843-423865 AGGCTGTCCTCAAGAAACACTGG + Intergenic
1019334523 7:476700-476722 CTGCTGTCCTCATGGAAAGGGGG + Intergenic
1021229770 7:18072195-18072217 ATGCTGTCTGCAAGGAAGACTGG - Intergenic
1025080507 7:55977981-55978003 ATGCTGTTGTCATGGAAAGCAGG + Intronic
1028140156 7:87264488-87264510 AAGTTCTCCTCAGGGAAATCAGG + Intergenic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1032522093 7:132553211-132553233 ATGCTGACCTCAGGGTGAGCAGG - Intronic
1032713485 7:134483747-134483769 AAACTGTACTCAGGGAAATCTGG + Intergenic
1035043781 7:155950982-155951004 TTGCTGACCTCAGGCAGAACAGG + Intergenic
1035287870 7:157817565-157817587 CATCTGTCCTCAGGGAAAAGAGG + Intronic
1035862771 8:3047580-3047602 ATGCTGTCCTGATGGAATCCAGG + Intronic
1036760455 8:11505386-11505408 ATGCTGTGCTCAGGGACAAGGGG - Intronic
1040576534 8:48656634-48656656 TTCCTGTCCTCAGGAAAAAGAGG + Intergenic
1042781283 8:72493868-72493890 CTGCTGTCCTCAGAGAGAACAGG - Intergenic
1044966058 8:97575182-97575204 ATGCCCTCCTCATGGAAATCAGG + Intergenic
1045223583 8:100222356-100222378 TTTCTGACCTCAGGGAACACCGG - Intronic
1046503213 8:115105590-115105612 ATGTTGCTCTCAGGGAAAAGGGG - Intergenic
1046989297 8:120431999-120432021 ATGCTGTTGTCAGGGAAATTAGG - Intronic
1051242871 9:15078832-15078854 TTGGTTTCCTCAGGGAAAATGGG - Intergenic
1051533577 9:18132179-18132201 GTGCTGTCCCCGGGGAAAAAAGG + Intergenic
1051700195 9:19814250-19814272 ATTCTGTCCTCAGGAAAGAATGG + Intergenic
1052672568 9:31577096-31577118 ACTCTGTGCTCAGGGAATACAGG - Intergenic
1056448268 9:86687977-86687999 ATGATGTCCGCAGGGGCAACTGG + Intergenic
1057410863 9:94815606-94815628 ATGCTGTCCTCACTGCAAGCAGG - Intronic
1057425979 9:94950148-94950170 ATGCTGTCATGGGGGAAAGCTGG - Intronic
1057746173 9:97753173-97753195 ATGTTAACCTCAGGGAAAGCTGG - Intergenic
1059831429 9:118100634-118100656 TAGCTGTCTTGAGGGAAAACGGG + Intergenic
1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG + Intronic
1061474549 9:130855588-130855610 ATGCAGTTTTCAGTGAAAACCGG + Intronic
1061970879 9:134044786-134044808 GAGATGTCTTCAGGGAAAACAGG - Intronic
1062154446 9:135038860-135038882 ATGCTGTCCTCAAGGAGCCCTGG - Intergenic
1187096286 X:16151869-16151891 ATGCTCTCCTGAGGAAAAAGGGG + Intronic
1188744372 X:33824709-33824731 AAACTGTCATCAGGGCAAACAGG - Intergenic
1189127604 X:38464392-38464414 ATGGTGTACTCAGGAAAAACTGG - Intronic
1189774112 X:44454995-44455017 ATGTTGTCCTCAGTGGAAATGGG + Intergenic
1190248364 X:48705422-48705444 TTGCTGGCCTCAGGGAAGAGGGG + Intronic
1193796939 X:85888491-85888513 TAGCTGTACTCAGGAAAAACCGG - Intronic
1193966758 X:87997287-87997309 ATAGTTTCCTCAGGGTAAACAGG - Intergenic
1194600989 X:95921530-95921552 ATGCTGCCCTGTGGAAAAACAGG - Intergenic
1195353090 X:104013160-104013182 AGGCTGTCCTCAGGTACACCAGG - Exonic
1195355318 X:104033929-104033951 ATAGTGTCCTCAGGGACAAGTGG + Intergenic
1197438067 X:126456632-126456654 ATGCTGGCCTCAGGTCTAACTGG + Intergenic