ID: 902285850

View in Genome Browser
Species Human (GRCh38)
Location 1:15408380-15408402
Sequence TCTCCTGTATGCAGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902285850_902285852 7 Left 902285850 1:15408380-15408402 CCTTCAGGGCTGCATACAGGAGA No data
Right 902285852 1:15408410-15408432 GCCTGTCTTTTGCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902285850 Original CRISPR TCTCCTGTATGCAGCCCTGA AGG (reversed) Intergenic