ID: 902286362

View in Genome Browser
Species Human (GRCh38)
Location 1:15410669-15410691
Sequence CAGCCTCGGTGTGTGCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902286362 Original CRISPR CAGCCTCGGTGTGTGCGGTG TGG (reversed) Intronic
900630268 1:3631413-3631435 CAGCCTTGCTGTGTGCAGTCTGG - Intronic
901819631 1:11819375-11819397 CAGCCTCCGTATGTGCAGTGGGG + Intronic
902286362 1:15410669-15410691 CAGCCTCGGTGTGTGCGGTGTGG - Intronic
903296926 1:22349902-22349924 CAGCATCTGTGTGTGCTTTGGGG + Intergenic
904041996 1:27590497-27590519 CAGGCTGGGTGTGTGCTGAGGGG - Intronic
904676889 1:32204256-32204278 CAGCCTGGATGTGTGTGGGGAGG + Exonic
908124281 1:61014665-61014687 CAGCCTCTGTGCCTGGGGTGAGG + Intronic
912707405 1:111925128-111925150 CAGCCTAGGTGTGGGGAGTGAGG - Intronic
915659235 1:157388635-157388657 CAGAGTGGGTGTGTGCGCTGGGG + Intergenic
915699798 1:157781052-157781074 CAGCCTTGGTGTCTGAGGGGAGG + Intergenic
916874327 1:168952922-168952944 CAGGCCCTGTGTGTGTGGTGGGG + Intergenic
919915827 1:202138495-202138517 CAGCCTCTTGGTCTGCGGTGGGG - Intronic
922798451 1:228353099-228353121 CAGCCTGGGTCTGGGCCGTGGGG - Intronic
1063042825 10:2360267-2360289 AATCCTCGGTGTTGGCGGTGGGG + Intergenic
1063167398 10:3476236-3476258 CACCCGTGGTGTCTGCGGTGAGG + Intergenic
1071566445 10:86673706-86673728 CAGCCTGGGAGTGTGGGGAGGGG + Intronic
1076819657 10:132931997-132932019 CAGCCTCTGTGTGGGGAGTGTGG - Intronic
1077118489 11:896168-896190 CAGCCTCGTTGTGTCTGGGGTGG - Intronic
1077118520 11:896285-896307 CAGCCTCGTTGTGTCTGGGGTGG - Intronic
1077900323 11:6482140-6482162 CAGCCTCGTAGTCTGCGATGCGG - Exonic
1078469413 11:11575196-11575218 CAGTCTCTGTGGGTGGGGTGTGG + Intronic
1078778304 11:14413671-14413693 AAGCCTCTGTGTGGGCGGTATGG - Intergenic
1079105985 11:17572748-17572770 CAGCATGGGTGTATGAGGTGAGG - Intronic
1084043807 11:66557614-66557636 CAGCCTGGGTGTGGGTGGAGAGG + Intronic
1084968597 11:72757290-72757312 AAGCCTCGTTGTGTCCAGTGGGG - Intronic
1087936129 11:104036627-104036649 CAGCCTCAGTGCCTGCTGTGTGG - Exonic
1088749830 11:112834323-112834345 CAGCCTGAGTGGGTGAGGTGAGG - Intergenic
1089785404 11:120903689-120903711 CAGCCCTGCTGTTTGCGGTGGGG + Intronic
1090352199 11:126114778-126114800 AAGTCTGGGTGTGTGTGGTGGGG + Intergenic
1091590983 12:1842828-1842850 CAGCCTTGGGGTGGACGGTGTGG + Intronic
1096600082 12:52722921-52722943 CAGCCTTGGTTTGTGCTGTCAGG - Intergenic
1096870755 12:54590670-54590692 CAGCCTGGATGTCTGGGGTGGGG - Intergenic
1098751132 12:74293903-74293925 CAGCTTTGGTGTGTGCAGTGAGG - Intergenic
1101854360 12:108429882-108429904 AAGCCTGGCTGCGTGCGGTGGGG - Intergenic
1103331190 12:120155193-120155215 CAGTCTGGGTGTGTGCGGTTGGG - Intronic
1103364244 12:120370120-120370142 CAGCCTCGGTGTGGTGGGGGTGG - Intergenic
1104755959 12:131269506-131269528 CAGCCTCCCTGTGTCAGGTGGGG - Intergenic
1104777754 12:131401175-131401197 CAGCCTCCCTGTGTCAGGTGGGG + Intergenic
1105307877 13:19181705-19181727 CAGCCTGGGCGTCTGCGGGGTGG + Intronic
1106299573 13:28451597-28451619 CAGCATAGCTGTGTGCGGGGCGG + Intronic
1112357989 13:98690725-98690747 CAGCCTGGGTGTGTGGTGGGTGG - Intronic
1113742128 13:112718515-112718537 CCTCCGAGGTGTGTGCGGTGGGG + Intronic
1114314301 14:21495292-21495314 CAGCCTCGATGTGTGAGGTCTGG + Exonic
1116196545 14:41734534-41734556 CAGTCTCTGTGTGTGCAGAGAGG + Intronic
1116509514 14:45726504-45726526 CAGCCTCAGTGTGTTCAGTTGGG + Intergenic
1122315775 14:100825405-100825427 CAACCCTGGTGTGTGTGGTGGGG + Intergenic
1123055090 14:105565844-105565866 CAGCCCCTGGGTGTGGGGTGGGG + Intergenic
1123079538 14:105685688-105685710 CAGCCCCTGGGTGTGGGGTGGGG + Intergenic
1124079347 15:26476824-26476846 CAGACAGGGTGTGTGGGGTGAGG - Intergenic
1124404269 15:29379962-29379984 CATCCTCGGGGTATGCAGTGTGG - Intronic
1125509340 15:40284182-40284204 GAGCCTGGGTGTGGGTGGTGGGG + Intronic
1125535076 15:40437861-40437883 CAGTCTGGTTGTGTGTGGTGGGG + Intergenic
1129157720 15:73729087-73729109 GGGCCCCAGTGTGTGCGGTGAGG + Intergenic
1129514928 15:76151573-76151595 CAGGCTATGTGTGTGGGGTGGGG - Intronic
1132511239 16:342628-342650 CAGTCACGGTGCGTGCGCTGGGG - Intronic
1132645413 16:997233-997255 CTGCCTGGGTGTGTCCAGTGGGG - Intergenic
1132815958 16:1826697-1826719 AGGCCTCGGTGGGTGCGGCGGGG - Exonic
1138275318 16:55730116-55730138 CAGCCAGGGTATGTGCAGTGGGG + Intergenic
1138602392 16:58063792-58063814 CAGCCTCTGTCTGTGGGATGAGG - Intergenic
1141126615 16:81405041-81405063 CAGCAGCGGGGTGTGAGGTGAGG - Intergenic
1141787677 16:86212781-86212803 GAGCCACGGTCTGTGTGGTGTGG - Intergenic
1143173994 17:4946122-4946144 CAGCCTGCCTGTGTGTGGTGGGG - Intronic
1143682565 17:8488232-8488254 CAGCCTCCTAGTGTGCAGTGGGG + Intronic
1146810466 17:35899104-35899126 CAGCATTGGTGTTTGCAGTGGGG + Intergenic
1148767175 17:50046205-50046227 CAGCCTGGCTTTGTGCGGTCAGG - Intergenic
1150438733 17:65174279-65174301 CTGCCTCGGTGACTTCGGTGTGG - Intronic
1151207256 17:72516931-72516953 CAGCCTGTGTGTGTCCTGTGGGG - Intergenic
1151367732 17:73628242-73628264 CAGCCACGGTGTGTGCTGGGTGG - Intronic
1151961866 17:77409793-77409815 CAGCCATGCTCTGTGCGGTGTGG + Intronic
1152280337 17:79381572-79381594 CAGGCCCGGTGTGTGGGTTGAGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152597497 17:81244979-81245001 CAGCCTCGGTGGATGCTGTTTGG - Exonic
1152759461 17:82100396-82100418 CAGCCTTTGTCTGTGTGGTGTGG + Intergenic
1152779022 17:82218288-82218310 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152779067 17:82218407-82218429 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152779080 17:82218446-82218468 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152917773 17:83051056-83051078 CAGACCAGGTGTGTGGGGTGCGG + Intronic
1155899936 18:31376712-31376734 CAGCCTGGGAGTTTGGGGTGGGG + Intergenic
1159424220 18:68263584-68263606 AAGCCTAGGTGTATGAGGTGTGG - Intergenic
1160150050 18:76391803-76391825 CAGCCTCATTGTGTGCTTTGGGG + Intronic
1160190560 18:76711160-76711182 CAGCCTAGCTGGGTGGGGTGGGG + Intergenic
1160330558 18:77987708-77987730 CAGACTGGGTGTGTGTGTTGGGG - Intergenic
1161052358 19:2171201-2171223 CAGCCTCAGGCTGTGTGGTGGGG + Intronic
1161278479 19:3432607-3432629 CTGCCTCGGTGTGTGATCTGGGG - Intronic
1161570953 19:5030692-5030714 CAGCCCAGCTGTGTGCCGTGTGG + Intronic
1161851060 19:6738333-6738355 AAGCCTCAGTGTGTGGTGTGGGG - Intronic
1163849481 19:19655129-19655151 CAGCCTGGTGGTGCGCGGTGTGG - Exonic
1166232534 19:41433522-41433544 TAACCTCCGTGAGTGCGGTGGGG - Exonic
1167358952 19:49019792-49019814 CAGCCGCGGTGTCTGAGCTGCGG + Intergenic
1167377238 19:49118786-49118808 CGGCCTCTGTGTGGGCGGGGCGG + Exonic
1167423055 19:49415032-49415054 CAGCCTCTGTGGGTGTGGAGTGG - Intronic
1167508623 19:49884128-49884150 CAGCCTCGGGGTTTGCTCTGGGG - Intronic
1167727125 19:51223897-51223919 CAGCATGTGTGTGTGTGGTGAGG + Intergenic
1168335044 19:55592782-55592804 CAGCCACGGTGAGGGCGGCGGGG - Exonic
925391968 2:3501356-3501378 CAGTCTCGTTGTGTGAGGTTGGG - Intronic
925874851 2:8302878-8302900 CAGCCTCACTGTGTGCTGAGAGG + Intergenic
927268065 2:21175141-21175163 CAGACTTGGTGTGTGCTGGGGGG - Intergenic
928806442 2:35162290-35162312 CAGTCTCTGTGTGTGTGGTGGGG - Intergenic
929769460 2:44879668-44879690 CAGCCTCAGTGTGCCCTGTGGGG + Intergenic
936598598 2:113873701-113873723 CAACCTCAGTGTGTGAGATGGGG + Intergenic
946250201 2:218406757-218406779 TTCCCTGGGTGTGTGCGGTGGGG - Intergenic
948074754 2:235157098-235157120 CAGCCTGGGAGAGTGAGGTGGGG - Intergenic
948711772 2:239829581-239829603 AAGCCTCCGGGGGTGCGGTGGGG + Intergenic
1172093264 20:32448227-32448249 CAGCCTCGGTGTCTGGGCTGGGG - Intronic
1172303592 20:33866072-33866094 GAGCCTGGCTGTGTGCGGTCAGG + Intergenic
1175278497 20:57787764-57787786 CAGCCTGGGTGTCTGGGGAGGGG - Intergenic
1175624836 20:60481559-60481581 CAGGCTCTGGGTGTGCCGTGAGG - Intergenic
1177781066 21:25622738-25622760 CAGCCTCGGTGGGGATGGTGGGG + Intergenic
1177805688 21:25872514-25872536 CTGCCTCTGTGAGTGCTGTGTGG + Intergenic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
1183211773 22:36455506-36455528 CTGACTCGGTTTGTGCTGTGTGG + Intergenic
950135236 3:10576288-10576310 AAGCCTCGGAGTGTGGAGTGAGG - Intronic
950687539 3:14629179-14629201 CAGCCTCTGTCTGTGCTCTGTGG - Intergenic
953003865 3:38959496-38959518 CAGCCTCACTGTGTGTGATGTGG + Intergenic
953432502 3:42851467-42851489 CATACTCGGGGTGTGGGGTGGGG + Intronic
960569645 3:119173215-119173237 CAGCATCGCTGTGAGCGGTCAGG + Intronic
961338816 3:126203658-126203680 CAGCCTAGGTGTGTGTGTGGGGG - Intergenic
968903872 4:3443042-3443064 CGTCCTCGGTGAGTGCTGTGGGG - Exonic
968962419 4:3752405-3752427 CAGCCTCGGGATGTGAGCTGGGG + Intergenic
972228773 4:37045624-37045646 CAGCCTAGCTGTGTGCATTGTGG - Intergenic
978771171 4:112457628-112457650 CAGCCTCGATGTGTGATGTCTGG + Intergenic
984702664 4:182828168-182828190 CAGCCTGCGTGTGTGTGCTGGGG - Intergenic
986746297 5:10747920-10747942 CAGCCCCTGGGTGTGGGGTGGGG + Intronic
993386446 5:87268181-87268203 GAGTGTGGGTGTGTGCGGTGAGG + Exonic
993620436 5:90161730-90161752 TAGCCACGTTGTGTGTGGTGTGG - Intergenic
996507067 5:124279372-124279394 AAGCCTCGCTGTGTGAGCTGTGG + Intergenic
997242041 5:132314848-132314870 CAGCCTCAGTGTCTGCAGAGGGG + Intronic
997454404 5:134006260-134006282 CAGTCTCAGTGTGCGGGGTGGGG - Intergenic
999266496 5:150270082-150270104 CTACCTCTGTGTGTGCAGTGGGG + Intronic
1001419197 5:171573953-171573975 CAGCCTGGGTCTGTGTGGGGTGG + Intergenic
1004340661 6:14804834-14804856 CTGCCTCGGCGTTTGGGGTGGGG - Intergenic
1007745283 6:44039674-44039696 CTGCCTGTGTGTGTGTGGTGGGG - Intergenic
1010870849 6:81036109-81036131 CAGCATAGGTGTGTGCTGAGGGG - Intergenic
1013588777 6:111602858-111602880 CAGCCTCAGTCTGTGGGGTGCGG + Intronic
1016286436 6:142478337-142478359 CAGATTTGGTGTGTGTGGTGAGG - Intergenic
1018827974 6:167422697-167422719 GAGCCGCCGTGTGTGTGGTGGGG - Intergenic
1018928340 6:168222562-168222584 CAGCTTCTGAGTGTGGGGTGAGG + Intergenic
1019770628 7:2881910-2881932 CACCATCGGTGTGTCCTGTGGGG + Intergenic
1022230995 7:28411543-28411565 AACCCTCGGTGTGGGGGGTGGGG + Intronic
1025053363 7:55745773-55745795 CAGCCTGGAAGTGTGCTGTGAGG + Intergenic
1026092033 7:67308315-67308337 CAGCCTGGTTGTGTGAGGTGTGG + Intergenic
1028937912 7:96486527-96486549 CAGCCTCCTTGAGTGAGGTGGGG + Intronic
1029377461 7:100188191-100188213 CAGCCTGGTTGTGTGAGGTGTGG + Intronic
1033499712 7:141935749-141935771 CAGCCTCAGTGGGTGGGATGGGG - Intronic
1039079473 8:33721410-33721432 AAGCTTCGGTGTGTGCGGTGAGG + Intergenic
1039470382 8:37809775-37809797 CAGCCTCTGTGTGTGCTGGGAGG - Intronic
1041406701 8:57507443-57507465 CAGCCTCTCTGTGTGAGATGAGG - Intergenic
1042670266 8:71254847-71254869 CAGACTCTGTGTGTGTGGTGGGG - Intronic
1047291745 8:123537912-123537934 CATCCTGGGGGTGGGCGGTGAGG + Intronic
1053593141 9:39533757-39533779 CCGCCTCGGTGTCTGGGGAGGGG - Intergenic
1054573166 9:66831520-66831542 CCGCCTCGGTGTCTGGGGAGGGG + Intergenic
1056779513 9:89538852-89538874 GAGCCTCAGTGTGTGCAGTGGGG + Intergenic
1057847642 9:98537945-98537967 CAGCCTGGGGGTGAGTGGTGAGG - Intronic
1058952678 9:109918007-109918029 CTGCCTGGGAGTGTGTGGTGGGG - Intronic
1059441427 9:114309197-114309219 AACCCTCGGTGTGGGGGGTGTGG + Intronic
1062474458 9:136720329-136720351 CATCCTTGGTGTGTGGGGGGCGG + Intronic
1185649297 X:1637069-1637091 CAGCCTCTGTGTGTGAGATAAGG + Intronic
1185649326 X:1637232-1637254 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649370 X:1637474-1637496 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649385 X:1637557-1637579 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649399 X:1637639-1637661 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649414 X:1637722-1637744 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649428 X:1637804-1637826 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649443 X:1637887-1637909 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649458 X:1637970-1637992 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649472 X:1638052-1638074 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649487 X:1638135-1638157 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649502 X:1638218-1638240 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649516 X:1638300-1638322 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649531 X:1638383-1638405 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649545 X:1638465-1638487 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649560 X:1638548-1638570 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649590 X:1638711-1638733 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649604 X:1638793-1638815 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649620 X:1638876-1638898 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649633 X:1638958-1638980 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649648 X:1639041-1639063 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649662 X:1639123-1639145 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649678 X:1639206-1639228 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649691 X:1639288-1639310 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649705 X:1639371-1639393 CAGCCTCTGTGTGTGAGATAAGG + Intronic
1185649734 X:1639534-1639556 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649748 X:1639616-1639638 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649764 X:1639699-1639721 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649777 X:1639781-1639803 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649792 X:1639864-1639886 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649806 X:1639946-1639968 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649822 X:1640029-1640051 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649835 X:1640111-1640133 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649851 X:1640194-1640216 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649866 X:1640276-1640298 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649882 X:1640359-1640381 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649896 X:1640441-1640463 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649925 X:1640604-1640626 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649940 X:1640687-1640709 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649954 X:1640769-1640791 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649970 X:1640852-1640874 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649983 X:1640934-1640956 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185649999 X:1641017-1641039 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650014 X:1641099-1641121 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185650030 X:1641182-1641204 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650044 X:1641264-1641286 CAGCCTCTGTGTGTGAGATAGGG + Intronic
1185650059 X:1641347-1641369 CAGCCTCTGTGTGTGTGATAGGG + Intronic
1185650090 X:1641512-1641534 CAGCCTCTGTGTGTGTGTTGGGG + Intronic
1185650106 X:1641595-1641617 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650122 X:1641677-1641699 CAGCCTCTCTGTGTGAGATGGGG + Intronic
1185650230 X:1642257-1642279 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650291 X:1642586-1642608 CAGCCTCTATGTGTGTGATGGGG + Intronic
1185650305 X:1642668-1642690 CAGCCTCTGAGTGTGTGATGGGG + Intronic
1185706003 X:2266659-2266681 CTCCCTCTGTCTGTGCGGTGTGG - Intronic
1192552882 X:72068177-72068199 CAGGCTCTGTGTGAGCGTTGGGG - Intergenic
1194702991 X:97137226-97137248 CAACCTCTGTGTGTGTGGTGGGG + Intronic
1195884427 X:109624675-109624697 CAGCCTCGGCGTCGGCGGTCAGG + Exonic
1196541002 X:116908207-116908229 CAGCATGGGTGTGTGTGGTTTGG + Intergenic
1196919359 X:120569764-120569786 CAGCCTAGGAGGGTGAGGTGGGG + Intronic
1200085094 X:153600149-153600171 CGGACTGGGTGTGTGGGGTGGGG - Intergenic