ID: 902287173

View in Genome Browser
Species Human (GRCh38)
Location 1:15414161-15414183
Sequence CCCGCCTAGCACAGCCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902287167_902287173 14 Left 902287167 1:15414124-15414146 CCGTGGAATCTGAGGACGATGCC 0: 1
1: 0
2: 0
3: 4
4: 99
Right 902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 160
902287168_902287173 -7 Left 902287168 1:15414145-15414167 CCCTAGATCCCTGTCTCCCGCCT 0: 1
1: 0
2: 0
3: 14
4: 198
Right 902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 160
902287169_902287173 -8 Left 902287169 1:15414146-15414168 CCTAGATCCCTGTCTCCCGCCTA 0: 1
1: 0
2: 1
3: 21
4: 183
Right 902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 160
902287166_902287173 18 Left 902287166 1:15414120-15414142 CCTGCCGTGGAATCTGAGGACGA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902287173 Original CRISPR CCCGCCTAGCACAGCCTTGC AGG Intronic
900138567 1:1129103-1129125 CCTGGCCAGCACAGCCCTGCAGG - Intergenic
900218680 1:1495674-1495696 CCCTCCTACCCCTGCCTTGCCGG + Exonic
900234907 1:1583818-1583840 CCCGCCCTGCACACCGTTGCAGG + Intergenic
900348100 1:2220872-2220894 CCCGCCTTGGACAGCCGTGTTGG - Intergenic
900529993 1:3148414-3148436 CCAGCCCAGCCCAGCCCTGCCGG - Intronic
900594002 1:3472259-3472281 CCAGCCAAGCCCAGCCTTGGTGG + Intronic
900644686 1:3703528-3703550 TGCGCCTAGCACAGCCCAGCGGG - Intronic
901813343 1:11779882-11779904 CAGGCCCAGCACAGCCCTGCAGG - Exonic
901881820 1:12198621-12198643 CCCTCCTGGCCCAGCCCTGCTGG - Intronic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
902392184 1:16113138-16113160 CCCTCCTGCCACAGCCCTGCCGG - Intergenic
911855370 1:102869340-102869362 CCCTCCTATCACAGGCTTGGAGG - Intergenic
913522300 1:119656383-119656405 CCCACCTTTCACAGCATTGCAGG - Intergenic
918342967 1:183582293-183582315 CCAGCCCAGCAGAGCCCTGCAGG - Intronic
919785147 1:201254040-201254062 CCAGCCCAGCCCAGCCCTGCAGG + Intergenic
922342396 1:224668582-224668604 CCAGCCTAGCCCAGCTTTGGGGG - Intronic
922718142 1:227887449-227887471 CCCGCGGTGCACAGCCTTGCTGG + Intergenic
924421808 1:243917029-243917051 CCAGGCTATAACAGCCTTGCAGG - Intergenic
1064042488 10:11980142-11980164 CCTGCCTAGCACAGCACTCCAGG + Intronic
1065694101 10:28363897-28363919 CCTCCCTATCACAGCCTGGCTGG - Intergenic
1066350258 10:34630750-34630772 TCCTCCTAGCACAGCCTTGGAGG - Intronic
1067233460 10:44427560-44427582 CTCACCTCGCACAGTCTTGCAGG - Intergenic
1067655923 10:48191160-48191182 CCTGCCTTGCAGAACCTTGCTGG + Intronic
1069590115 10:69636192-69636214 CCCGCCTCTCAGAGCCTTTCAGG + Intergenic
1072314714 10:94190805-94190827 CCCGCCTTGCACTGCCTAGTAGG - Intronic
1075683653 10:124349478-124349500 CCCGGCTCGCACAGCCAGGCTGG + Intergenic
1075794610 10:125110144-125110166 CACTCCTAGCAGAGCCTTGAGGG - Intronic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076480943 10:130784983-130785005 CCCGCCCAGCTCAGCCTCTCTGG + Intergenic
1076683691 10:132187378-132187400 CCGGCCTTGCCCGGCCTTGCCGG + Intronic
1080693878 11:34584121-34584143 CATGCCCATCACAGCCTTGCCGG + Intergenic
1083631789 11:64099230-64099252 CCCGCCTTGCCCAGCCTTCGGGG - Intronic
1087126057 11:94626577-94626599 CCCTCCTAGCACAGTCTTGGAGG - Intergenic
1091221187 11:133930953-133930975 GCCGCCCGGCCCAGCCTTGCCGG + Intronic
1098183303 12:67870378-67870400 CCCACCAAGAACAGCTTTGCAGG + Intergenic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1104362582 12:128148083-128148105 TCCGCCTGTCTCAGCCTTGCTGG + Intergenic
1110472614 13:75876849-75876871 CCCGCCTTGCACAGTTTTCCTGG - Intronic
1111487668 13:88926081-88926103 CCAGCCAAGCACAGCCTGCCAGG - Intergenic
1117362966 14:54996490-54996512 CCCTCCTACCTCAGCCTCGCAGG - Intronic
1118310479 14:64688824-64688846 CCTCCCCAACACAGCCTTGCAGG - Intergenic
1121176900 14:91897269-91897291 CCCACCGAGCACAGCCTCCCAGG + Intronic
1121446868 14:93984244-93984266 CACTCCCAGCACAGACTTGCTGG + Intergenic
1121909650 14:97777273-97777295 CCCGGCTCCCACAGCCTTGCAGG - Intergenic
1122435293 14:101691200-101691222 CTCCCCTGGCAGAGCCTTGCAGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123025701 14:105422724-105422746 CCTGCCTAGCCCAACCTGGCAGG - Intronic
1123043998 14:105502684-105502706 CCAGCCCAGCACAGCCAGGCAGG - Intergenic
1129446785 15:75624718-75624740 CCCGCCAAGAACAGCCTTGAAGG - Exonic
1130108649 15:80947565-80947587 GAAGCCTAGCACAGGCTTGCTGG + Intronic
1131391918 15:92056747-92056769 CCTGCCTAAGAAAGCCTTGCTGG + Intronic
1132065897 15:98731014-98731036 CATTCCTAACACAGCCTTGCTGG - Intronic
1132268455 15:100501306-100501328 CTCTTCTAGCACAGCCTTTCTGG + Intronic
1132600602 16:770953-770975 CCCGCCTCCCACAGGCTGGCCGG - Exonic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1134868265 16:17628685-17628707 CCAGCCCAGCCCAGCCTTCCTGG + Intergenic
1135407175 16:22206697-22206719 CCAGCCCCCCACAGCCTTGCCGG - Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1137605304 16:49783183-49783205 CCCGCCCATCCCAGCCTGGCAGG - Intronic
1137811409 16:51356391-51356413 TCCGGCTAGCACAGCCTTCAAGG - Intergenic
1141179576 16:81743400-81743422 ACCGACTGGCACAGACTTGCTGG + Intronic
1142493299 17:292627-292649 CCTGGCTAGCACACTCTTGCAGG + Intronic
1142711240 17:1725022-1725044 CCCGCCAAGCCCAGACATGCAGG + Exonic
1144671134 17:17133237-17133259 CCCTCCTAAGACAACCTTGCGGG + Intronic
1147424396 17:40339138-40339160 CCTCACTATCACAGCCTTGCTGG - Intronic
1147653033 17:42072731-42072753 CCGGCCCAGGACAGCCTTGGCGG + Intergenic
1149386388 17:56146748-56146770 CCCTCCTATCACAGCCTTGGAGG - Intronic
1151310709 17:73291001-73291023 ACCACCCAGCACATCCTTGCGGG + Intronic
1151805876 17:76405095-76405117 CTTGCCAAGCACAGCCTTCCTGG - Intronic
1152121519 17:78421808-78421830 CCTGCCTAGGACAGCCTCGAAGG - Intronic
1154105028 18:11515366-11515388 CCTGCCTAGCACAGCCCTGATGG + Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157812999 18:50711000-50711022 CCCACCCAGCACGGGCTTGCTGG + Intronic
1158205913 18:54992288-54992310 CCCGCCCCCCACACCCTTGCTGG + Intergenic
1161280202 19:3441747-3441769 CCGGCTTGGGACAGCCTTGCAGG - Intronic
1161302622 19:3550203-3550225 TCCCCCTAGCTCAGCCATGCTGG + Intronic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1163411686 19:17158851-17158873 CCCACATAGCACGGGCTTGCCGG - Intronic
1166133239 19:40759546-40759568 CCCGCCTTGCACAGCCTTCTTGG - Exonic
1168084500 19:54035460-54035482 CCCACCAAGGACAGCTTTGCAGG + Intergenic
929582164 2:43088363-43088385 CCAGCCTAGCCCAGCCCTCCAGG - Intergenic
929828611 2:45329680-45329702 CCTGCCTGGCTCAGCCATGCAGG - Intergenic
931317090 2:61143148-61143170 CCCACAAAGCACAGCTTTGCAGG + Intergenic
931913198 2:66924793-66924815 CTGGCCAAGCACAGCCCTGCAGG - Intergenic
932218651 2:69983538-69983560 CCAGCCCAGCTCAGCCTAGCTGG - Intergenic
935612123 2:105036753-105036775 CCCTCCAAGGACAGCTTTGCAGG + Intergenic
936624694 2:114135981-114136003 CCTGACTATCACAGCTTTGCAGG + Intergenic
937164076 2:119795394-119795416 CCCGCTTAGCACTGGCCTGCAGG - Intronic
937451854 2:122008721-122008743 CCCCCTTTGCACAGCCCTGCAGG - Intergenic
938625973 2:133110080-133110102 CCTCCCTGCCACAGCCTTGCAGG + Intronic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
940694140 2:156958513-156958535 CGTGCCGAGCACAGCCTTCCAGG - Intergenic
941165852 2:162082336-162082358 CCTGCATTGCACAGCCTTGCAGG - Intergenic
1170884077 20:20323131-20323153 CTCGCCTAGCTGAGCCTTGGCGG - Intronic
1172274535 20:33672561-33672583 CCTGCCCAGCTCAGCCCTGCAGG + Intronic
1175971259 20:62687800-62687822 CCAGCCTAGCACAGCCTCCAGGG + Intergenic
1177357654 21:20030540-20030562 CCAGCCAAGCACAGCCTGCCAGG - Intergenic
1179430168 21:41316328-41316350 CCAGCCCAGCCCAGCCTAGCAGG - Intronic
1180083481 21:45497259-45497281 CCCTCCCAGCACAGCCGTCCAGG + Intronic
1180189023 21:46153946-46153968 CCCCCAGAGCACAGCCCTGCAGG + Intronic
1180630068 22:17222724-17222746 CAAGCATAGCACGGCCTTGCAGG + Intergenic
1180762544 22:18221019-18221041 CCAGCCATGCACAGCCTTCCAGG + Intergenic
1180773123 22:18403589-18403611 CCAGCCATGCACAGCCTTCCAGG - Intergenic
1180804478 22:18653138-18653160 CCAGCCATGCACAGCCTTCCAGG - Intergenic
1180806272 22:18716272-18716294 CCAGCCATGCACAGCCTTCCAGG + Intergenic
1181217219 22:21342053-21342075 CCAGCCATGCACAGCCTTCCAGG + Intergenic
1181594041 22:23902876-23902898 CCCGTCTAGCTCAGTCTTTCTGG + Intergenic
1181910284 22:26233320-26233342 CCCCCCTGGCACATCTTTGCAGG + Intronic
1184614144 22:45626440-45626462 CCCGGCCAGTACAGCCATGCCGG - Intergenic
1184979029 22:48082937-48082959 ACCGCCCAGCAGAGCATTGCAGG + Intergenic
1203234955 22_KI270731v1_random:144571-144593 CCAGCCATGCACAGCCTTCCAGG - Intergenic
950146031 3:10650637-10650659 CCCTCCTATCACAGGCTTGGAGG + Intronic
952454817 3:33463168-33463190 CCCACAAAGCACAGCTTTGCAGG - Intergenic
952886270 3:38013174-38013196 GCCGCCGAGCCCAGCCTTTCTGG + Intronic
961305924 3:125959123-125959145 CACGCCTGGCTCAGCCCTGCCGG + Intergenic
964172372 3:153785953-153785975 CAGGCCTAGCAGTGCCTTGCAGG + Intergenic
967445920 3:189566379-189566401 CCCACCTAGCCCAGACCTGCAGG - Intergenic
967874043 3:194254273-194254295 CCAGCCGAGCTGAGCCTTGCTGG - Intergenic
968170231 3:196503917-196503939 CCCGCCTAGTGCAGCCTGGGTGG + Intergenic
968871272 4:3243808-3243830 CTCGCCCATCACAGCCCTGCTGG - Exonic
974761683 4:66285033-66285055 TGAGCCTAGCACAGCCTTCCAGG - Intergenic
976178080 4:82374132-82374154 TCCGCGTTGCACAGCCTTGGGGG + Intronic
978498624 4:109385491-109385513 CGAGCCAAGCACAGCCTTTCAGG + Intergenic
981616984 4:146652675-146652697 CCCCCCCAGCACACTCTTGCAGG + Intergenic
985482864 5:128225-128247 CCCACCAAGGACAGCTTTGCAGG + Intergenic
985654385 5:1122258-1122280 CCCGCCTCGCACAGCCCTGCCGG - Intergenic
986506537 5:8457806-8457828 CCCGCCTAGCACTGGCCTGATGG + Intergenic
987881484 5:23750944-23750966 CCCTCCTATCACAGGCCTGCAGG - Intergenic
998353583 5:141516466-141516488 CCCCCCTAGGTCAGTCTTGCTGG - Exonic
1000060183 5:157648083-157648105 CCCACCTTGCACAGACATGCTGG + Intronic
1003164022 6:3660719-3660741 CCCGCCACTCACACCCTTGCTGG - Intergenic
1005870783 6:29972861-29972883 CCTGTGTAGCACAGCCATGCTGG - Intergenic
1006641831 6:35493377-35493399 CCTGCCTGGCACAGCCCTGGGGG + Intronic
1006908576 6:37549190-37549212 TCCGTCTAACACAGCCTTGCAGG + Intergenic
1007076225 6:39068298-39068320 CCCCACTCGCACAGCTTTGCTGG + Intronic
1007829034 6:44624407-44624429 CCCCCCAGGCACAGCCTAGCTGG + Intergenic
1009588772 6:65638796-65638818 CAAGCCAAGCACAGCCTGGCAGG + Intronic
1012948561 6:105493387-105493409 ACTGCTTAGTACAGCCTTGCTGG - Intergenic
1016862214 6:148732198-148732220 CCCTCCTATCACACCTTTGCAGG + Intergenic
1017034909 6:150258247-150258269 TCCTCCTAGCACAGCCTCCCAGG - Intergenic
1018154854 6:160976359-160976381 CCCACATAGGACAGCTTTGCAGG + Intergenic
1019587211 7:1812113-1812135 CCTGCCCAACACAGACTTGCAGG + Intergenic
1020111573 7:5450923-5450945 CCCACCCATCCCAGCCTTGCTGG - Intronic
1026143112 7:67722961-67722983 CCCACAAAGGACAGCCTTGCAGG - Intergenic
1035450917 7:158976356-158976378 CCCCCCTACCACATCCCTGCAGG + Intergenic
1035561937 8:611579-611601 CCCGGCTGGCACAGACTCGCTGG + Intergenic
1039786863 8:40841604-40841626 GCAGCCAAGCACAGCATTGCAGG - Intronic
1040292966 8:46134839-46134861 CCAGCCTAGGACAGCCCTGGGGG + Intergenic
1040298935 8:46178011-46178033 CCCTCCTGGGACAGCCCTGCAGG - Intergenic
1040299161 8:46179082-46179104 CCCACCTGGGACAGCCTTGAGGG + Intergenic
1040303137 8:46198409-46198431 CCCACCTGGGACAGCCTTGAGGG - Intergenic
1040304525 8:46205156-46205178 TCTGCCCAGCACAGCCTTGGGGG - Intergenic
1040305849 8:46211391-46211413 CCAGCCTGGGACAGCCTTGCGGG - Intergenic
1040307211 8:46218299-46218321 CCGGCCTGGGACAGCCTTGGGGG + Intergenic
1040314552 8:46254172-46254194 CCCGCCTGGGACAGCCCTGGGGG - Intergenic
1040329301 8:46377819-46377841 CCCGCCTGGGACAGCCCTGGGGG - Intergenic
1040334238 8:46408048-46408070 CCCGCCTGGTACAGCCCTGGGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040338062 8:46426234-46426256 CCCGCCTGGGACAGCCGTGGGGG - Intergenic
1043103821 8:76082928-76082950 CCCCCCTTTCACAGCTTTGCTGG + Intergenic
1047644426 8:126854954-126854976 CCAGCCTTGCACAGACTAGCCGG + Intergenic
1048886161 8:138911581-138911603 CCAGCCATGGACAGCCTTGCAGG + Intronic
1050830795 9:10009721-10009743 CCCGCAAAGGACAGCTTTGCAGG + Intronic
1053312866 9:37030317-37030339 ACCACCTAGCCCAGCCTTACAGG + Intronic
1055858850 9:80724405-80724427 CCCTCCTATCACAGGCCTGCAGG - Intergenic
1056077744 9:83058940-83058962 CTAGCCTAGCACTGCCTGGCAGG + Intronic
1057440711 9:95081186-95081208 CCCGCCTAGCACAGCACGGCAGG - Intronic
1061517479 9:131098053-131098075 CCCGCCTCCCACAGCCTTCTCGG - Intronic
1061857833 9:133452612-133452634 CACACCTAGCACAGCCTACCAGG + Intronic
1062009596 9:134259871-134259893 CCCGCCTCGCCCACCCCTGCTGG - Intergenic
1062626947 9:137447708-137447730 GCAGCCTGGCACAGCCTGGCAGG - Exonic
1062710643 9:137973375-137973397 CCAGCCTAGAGCAGCTTTGCAGG + Intronic
1190598295 X:52067218-52067240 CCGGCCCAGCACAGCCTTCCTGG - Exonic
1190610529 X:52186855-52186877 CCGGCCCAGCACAGCCTTCCTGG + Exonic
1192184624 X:68938740-68938762 CCCTCTTACCACAGCCTGGCTGG - Intergenic
1195275395 X:103276124-103276146 CCCGCCTCCCGCTGCCTTGCAGG + Intronic
1199760021 X:150898380-150898402 TCCGCCTCGCACAGCCGGGCCGG + Intronic
1202099184 Y:21287986-21288008 CCTCCCTAGCACAGGCCTGCAGG + Intergenic