ID: 902290431

View in Genome Browser
Species Human (GRCh38)
Location 1:15431464-15431486
Sequence GGATGTGGATGTTCCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902290431_902290446 19 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290446 1:15431506-15431528 GGCTTCGGGGAGAAGGGACGGGG 0: 1
1: 0
2: 0
3: 35
4: 326
902290431_902290440 6 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290440 1:15431493-15431515 TCCTGCTGGAAAGGGCTTCGGGG 0: 1
1: 0
2: 1
3: 10
4: 152
902290431_902290445 18 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290445 1:15431505-15431527 GGGCTTCGGGGAGAAGGGACGGG 0: 1
1: 0
2: 1
3: 65
4: 489
902290431_902290442 12 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290442 1:15431499-15431521 TGGAAAGGGCTTCGGGGAGAAGG 0: 1
1: 0
2: 2
3: 40
4: 368
902290431_902290434 -3 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290434 1:15431484-15431506 TCCCTGATATCCTGCTGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 154
902290431_902290433 -8 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290433 1:15431479-15431501 CCACATCCCTGATATCCTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 191
902290431_902290443 13 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290443 1:15431500-15431522 GGAAAGGGCTTCGGGGAGAAGGG 0: 1
1: 0
2: 2
3: 19
4: 367
902290431_902290438 4 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290438 1:15431491-15431513 TATCCTGCTGGAAAGGGCTTCGG 0: 1
1: 0
2: 3
3: 10
4: 142
902290431_902290444 17 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290444 1:15431504-15431526 AGGGCTTCGGGGAGAAGGGACGG 0: 1
1: 1
2: 6
3: 72
4: 859
902290431_902290436 -2 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290436 1:15431485-15431507 CCCTGATATCCTGCTGGAAAGGG 0: 1
1: 0
2: 0
3: 13
4: 163
902290431_902290439 5 Left 902290431 1:15431464-15431486 CCAAGAGAGGAACATCCACATCC 0: 1
1: 0
2: 1
3: 18
4: 201
Right 902290439 1:15431492-15431514 ATCCTGCTGGAAAGGGCTTCGGG 0: 1
1: 0
2: 1
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902290431 Original CRISPR GGATGTGGATGTTCCTCTCT TGG (reversed) Intergenic
901038542 1:6350493-6350515 GGATGAAGTTGTTCCTCTTTGGG - Intronic
902290431 1:15431464-15431486 GGATGTGGATGTTCCTCTCTTGG - Intergenic
903065637 1:20697775-20697797 GGCTGTGGAAGTCCCGCTCTGGG + Intronic
905513374 1:38542328-38542350 GGAAGGGGATGTTCCTCTGAAGG - Intergenic
909518259 1:76536808-76536830 GAATCTGGATGCTCCTCTATTGG - Intronic
910147756 1:84102550-84102572 GGATGTGGCTTTTTGTCTCTTGG + Intronic
910892066 1:92028850-92028872 GGAGGTTGATCTTCCTGTCTTGG - Intergenic
913431109 1:118791541-118791563 GAATCTGGGTGTTCCACTCTTGG - Intergenic
915081319 1:153354638-153354660 GGATGGGGGTCTTCCCCTCTGGG - Intergenic
915667587 1:157459004-157459026 GTATATGGATGGACCTCTCTGGG - Intergenic
916244577 1:162674779-162674801 GGATATAGAGTTTCCTCTCTAGG + Intronic
916568628 1:166005769-166005791 GGATCTGGGTGTTCCTGTGTTGG + Intergenic
920722155 1:208397918-208397940 GTATGTGGCTATTCCTCTCCTGG - Intergenic
1062785211 10:259275-259297 GGATGTGGAAGTCCCTTGCTGGG - Intergenic
1063273857 10:4541931-4541953 CAATGTTGATGTTCCTCTCCTGG + Intergenic
1063769588 10:9182620-9182642 GGATGAGCATGTTCTTTTCTAGG + Intergenic
1064013416 10:11754721-11754743 GAGTGTGGATTTTTCTCTCTGGG - Intronic
1065620011 10:27571270-27571292 GGAAGAGGATGTTCCTGTCATGG - Intergenic
1065969911 10:30798110-30798132 GGCTGTGGGTGCCCCTCTCTTGG - Intergenic
1067127391 10:43531137-43531159 GAATGTGGATGCTCCTGTATTGG + Intergenic
1069599454 10:69694012-69694034 GGAGGTAGTTGTCCCTCTCTGGG - Intergenic
1069868776 10:71520617-71520639 GGATGAGGGTGCTCCCCTCTGGG + Intronic
1070262798 10:74873708-74873730 GGAGGTAGATGTTCCCCACTTGG + Intronic
1083347077 11:62001176-62001198 GGCTGTGGATGTTACTCCCCAGG - Intergenic
1084899731 11:72300624-72300646 GGATCTGGATCTTCCTGGCTTGG + Intronic
1086415204 11:86582221-86582243 GCATGTGGTAGTTCCTCTGTTGG + Intronic
1087485088 11:98750321-98750343 GAATCTGGATGTTCCTGTATTGG - Intergenic
1089194989 11:116689100-116689122 GGCTGTGGATGCTCTTCCCTTGG - Intergenic
1091145148 11:133273118-133273140 GAAAGTGGATGTCCCTCCCTAGG + Intronic
1091447686 12:553420-553442 GAATGTGGCTGGTCCTCCCTGGG - Exonic
1091703563 12:2679370-2679392 GGCTGTGGAGGCTGCTCTCTGGG + Intronic
1094809047 12:34120221-34120243 GTATGTGCATGTTCCTAACTTGG + Intergenic
1097531923 12:60812245-60812267 GAATGTGGATGCTCCTGTATTGG + Intergenic
1098313815 12:69173503-69173525 GGATATGGTTGCTCCTATCTTGG - Intergenic
1100136528 12:91559256-91559278 GAATCTGGATGCTCCTCTATTGG - Intergenic
1100232049 12:92618574-92618596 GTATGTGGATAAACCTCTCTGGG + Intergenic
1104148171 12:126055507-126055529 GGATGTGGTTGCATCTCTCTGGG - Intergenic
1104301548 12:127569410-127569432 GGAAGTGGATATTCCCTTCTAGG + Intergenic
1106363730 13:29057465-29057487 GAATCTGGATGTTCCTGTGTTGG + Intronic
1106653225 13:31714855-31714877 GAATGTGGATTTTCCTCACAAGG - Intergenic
1108079322 13:46717971-46717993 GGATGTGGACGTTTGTCTGTAGG + Intronic
1109291080 13:60475667-60475689 GTATGTGTATTTTCCTTTCTTGG + Intronic
1109317141 13:60763600-60763622 GAATCTGGGTGTTCCTCTGTTGG + Intergenic
1109437714 13:62327953-62327975 GGAGATGGCTGCTCCTCTCTAGG - Intergenic
1110573895 13:77034795-77034817 GGCTGTGGATGGCCCTGTCTTGG + Intergenic
1113161915 13:107391453-107391475 GGATGTGGATTTTTCTCACAAGG - Intronic
1113677922 13:112221082-112221104 CTCTGTGGATGTTCCTGTCTTGG + Intergenic
1114933421 14:27504603-27504625 GAATGTGGGTATTCCTGTCTTGG + Intergenic
1114973497 14:28064338-28064360 AGAAATGGATGTTCTTCTCTAGG - Intergenic
1115786876 14:36836575-36836597 GGATGTGAGTGTTGATCTCTGGG + Intronic
1116091766 14:40317007-40317029 GGATGAGGATTTGCCTCTTTTGG + Intergenic
1117796804 14:59403378-59403400 GAATCTGGATGTTCCTGTATTGG + Intergenic
1118060985 14:62137220-62137242 GGATGTGTATGTTACTGTCTTGG - Intergenic
1120879053 14:89400609-89400631 GGAAGGGGATCTACCTCTCTGGG - Intronic
1125550707 15:40542451-40542473 GTTTGTCGATGTTCCTCTGTAGG + Intronic
1126622486 15:50653973-50653995 GGATGTGGACCTTCCTCTTAAGG - Intronic
1126809996 15:52392781-52392803 CGATGTGGATGTTGCCCTCATGG + Intronic
1126846921 15:52769019-52769041 GGATGTGGAGGTTCATATCTAGG - Intronic
1130755715 15:86760842-86760864 AGTTGTGGCTTTTCCTCTCTAGG - Intronic
1131226226 15:90626525-90626547 GGACTTGGGTGTTACTCTCTGGG + Intronic
1136613795 16:31383099-31383121 GGTTGTGAATATCCCTCTCTTGG + Intergenic
1141045760 16:80715004-80715026 GTCTGTTGATGTTTCTCTCTGGG - Intronic
1141415329 16:83867387-83867409 GGATATGGTTGTTCCTATATTGG + Intergenic
1143375154 17:6462942-6462964 GGCTGTGGTCCTTCCTCTCTGGG - Intronic
1144121056 17:12152924-12152946 GGATCTGGGTGTTCCTGTATTGG - Intergenic
1144181810 17:12759149-12759171 TGATGTAAATGTTCTTCTCTGGG - Intronic
1144345575 17:14346215-14346237 GGATGTGGATGTCCCTGTAAAGG - Exonic
1146373645 17:32280512-32280534 GGGTGTGGCTGACCCTCTCTGGG - Intronic
1148644242 17:49210317-49210339 GGAGGTGGATTTTCCACTCATGG - Exonic
1150604378 17:66678321-66678343 TGATGTGGATGTTGGACTCTTGG + Intronic
1151565856 17:74897808-74897830 GTATGTGCATTTTCCTGTCTAGG + Intergenic
1155773980 18:29736014-29736036 GAATGTGGATGCTCCTGTATTGG + Intergenic
1157487782 18:48100842-48100864 GGATGCAGATGAGCCTCTCTGGG + Intronic
1159076796 18:63689339-63689361 GGTCGTTTATGTTCCTCTCTAGG - Intronic
1159896310 18:74000172-74000194 GGATGTCGATATTTTTCTCTAGG + Intergenic
1160392009 18:78540925-78540947 GTGTGTGGACGTTCCTCACTGGG - Intergenic
1162258413 19:9512356-9512378 GGATGTGGAGGTTCATCTGAGGG + Intergenic
1164954753 19:32372721-32372743 GGATGTTGGTGTTTTTCTCTCGG - Intronic
1165306399 19:35005392-35005414 GGATGTGGATGTGGATGTCTGGG + Intronic
1165738536 19:38192603-38192625 GGATGTGGCTGTTTCTATCCTGG - Intronic
1166260432 19:41636355-41636377 GAATCTGGATGTTCCTGTATTGG + Intronic
1167769008 19:51502102-51502124 GGCTGTGGATGTCTCTCTGTAGG + Intergenic
1167772943 19:51532008-51532030 GGATGAGGCTGTGACTCTCTGGG - Intergenic
1168707425 19:58477936-58477958 GAATGTGGATGTCCCTGTCTGGG + Intronic
925109545 2:1322363-1322385 GGATGTGGATTTTCCCTCCTAGG - Intronic
925768171 2:7258000-7258022 GGATGTGTCTGTTCCTGTGTTGG + Intergenic
926259413 2:11243626-11243648 GGATGTGGATGCTCCTCTGTAGG - Intronic
929358761 2:41057563-41057585 GAATCTGGATGTTCCTGTATTGG - Intergenic
930719961 2:54629279-54629301 GGATGTAAATGATCCTCTCACGG - Exonic
931131781 2:59344315-59344337 GGATGTGGAAATTGATCTCTGGG - Intergenic
931875040 2:66503254-66503276 GGTTGTGGGTGTTCATCCCTAGG - Intronic
933127774 2:78632450-78632472 GAATGTGGAAGTTCCCCTGTAGG - Intergenic
934725018 2:96610862-96610884 GGATGTAGATGATCCCCTCTTGG - Exonic
935853489 2:107248891-107248913 TGATGAGCATGTTTCTCTCTGGG + Intergenic
936249187 2:110854358-110854380 GGATGTGGAGGTTCCACACCAGG + Intronic
936949641 2:117965201-117965223 GGGTGGGGGTGTTCCTCTCTTGG - Intronic
937113564 2:119386539-119386561 GGATGTGAAGATTTCTCTCTGGG - Intergenic
942581857 2:177427996-177428018 GGATCTGGGTGCTCCTCTATTGG + Intronic
942862978 2:180637669-180637691 GGATGTTGAGGTCCTTCTCTAGG - Intergenic
943234495 2:185300410-185300432 GGATGTGGGTGTGCCTCACTTGG - Intergenic
945145543 2:206734351-206734373 TGATGTGGCCTTTCCTCTCTTGG - Intergenic
945734338 2:213580146-213580168 GGATAAGGATATTCCTCTCTGGG - Intronic
947316557 2:228865878-228865900 CGATGGAGATGTTCCTGTCTTGG - Intronic
948318722 2:237051910-237051932 ATATGTGGATGCCCCTCTCTGGG + Intergenic
949038465 2:241832574-241832596 GGACGTGCGTGTTCCTCCCTTGG + Intergenic
949039936 2:241843596-241843618 GGATGTGGAGGGTCCTCTGGAGG - Intergenic
1169493614 20:6092120-6092142 GGTTGTGGATATTCCCCTCTAGG + Intronic
1169706614 20:8513555-8513577 CAATGGGGATGTTTCTCTCTTGG - Intronic
1170113265 20:12828150-12828172 GGATGTGGTTGTTCATCACTGGG - Intergenic
1172973989 20:38893346-38893368 GAGTGTGGATTTTCTTCTCTTGG + Intronic
1173643816 20:44621443-44621465 GGAGGGGGATGTTGCTTTCTTGG - Intronic
1175141574 20:56864741-56864763 GGAAGTGGCTGACCCTCTCTGGG - Intergenic
1177099413 21:16881284-16881306 GAATCTGGATGTTCCTGTATTGG - Intergenic
1177321669 21:19529656-19529678 GGCTGTGGATGAACCTCTCTGGG - Intergenic
1178056356 21:28803268-28803290 GGATGTGTATGTTAATCCCTTGG - Intergenic
1179711548 21:43266413-43266435 GGATGTGGATTTACCTTCCTGGG + Intergenic
1180705494 22:17807528-17807550 GGATGTGGATGTTCTTGGTTTGG - Intronic
1181028447 22:20138678-20138700 GGATGGGGATGTGCCTGACTGGG + Intronic
1182621716 22:31622033-31622055 TGATGTGGCTGTTTCTCACTGGG + Intronic
1183980090 22:41534243-41534265 GGATGTGGTTGTTCCAGCCTGGG - Intronic
1184893907 22:47396089-47396111 GGCTGTGGTGGTTCGTCTCTCGG - Intergenic
1185299379 22:50071686-50071708 GGATCTGTAGGTTCCTCTGTTGG + Intronic
1185398810 22:50605595-50605617 GGATGTGGATGACCCTGTGTTGG + Exonic
950667431 3:14505879-14505901 GGAGGTCGTTGCTCCTCTCTGGG + Intronic
951171977 3:19553286-19553308 GAATGTTGATGTCCTTCTCTAGG + Intergenic
953470062 3:43158868-43158890 GAAAGTGAATGTTTCTCTCTAGG + Intergenic
953749472 3:45598140-45598162 GGAGGTGGGGGGTCCTCTCTAGG + Intronic
956129645 3:66040804-66040826 GGATGTTGATGCTTCTCTCTTGG + Intergenic
956713706 3:72060289-72060311 GTGTGTGGATGTTAGTCTCTGGG - Intergenic
960161085 3:114351090-114351112 TGATGTGGATGTTGCCCACTAGG + Exonic
961392262 3:126559101-126559123 AGATGTGGATGCTTCTGTCTGGG - Intergenic
961614160 3:128165512-128165534 TAATGTGGGTGATCCTCTCTTGG + Intronic
966490198 3:180518936-180518958 GAATCTGGATGTTCCTATGTTGG - Intergenic
970422339 4:15916924-15916946 GGAAGGGGGTGTTCCTCTGTGGG - Intergenic
973095228 4:46189392-46189414 AGATGTGGATGTGACTCACTTGG + Intergenic
977701659 4:100029239-100029261 GTATGTGGATAGACCTCTCTAGG - Intergenic
978001852 4:103565204-103565226 GAATCTGGATGTTCCTATGTTGG - Intergenic
978313502 4:107411725-107411747 GAATGTGAATGCTCCTCTATTGG - Intergenic
983543547 4:168937784-168937806 GAATCTGGATGTTCCTGTATTGG - Intronic
984163927 4:176285696-176285718 AGATGTGGATGTCCCTTTTTTGG + Intergenic
984665345 4:182421355-182421377 GGCTGTGGTTATTGCTCTCTTGG - Intronic
985924111 5:3002348-3002370 GAAAGTGAGTGTTCCTCTCTGGG + Intergenic
987269947 5:16296887-16296909 GAATCTGGATGTTCCTGTGTTGG + Intergenic
988798402 5:34673837-34673859 GGAGGTAGACCTTCCTCTCTGGG - Intronic
989148037 5:38268249-38268271 CAAAGTGGATGTTCCTTTCTAGG + Intronic
993473064 5:88330599-88330621 CAATGTGGATGTTCCTGGCTAGG + Intergenic
994621069 5:102163427-102163449 GAATCTGGATGCTCCTCTATTGG - Intergenic
995673539 5:114635316-114635338 GAATGTGGAAATTCCACTCTTGG - Intergenic
996825654 5:127678481-127678503 GTATGTGGATGGACCTCTCTGGG + Intergenic
997874082 5:137532784-137532806 GGATGTGGATGTATCTTTTTGGG - Intronic
998044412 5:138974708-138974730 GGAAGTCAATGCTCCTCTCTCGG + Intronic
998425940 5:142028694-142028716 GGATGAAGCTGTTCCCCTCTGGG - Intergenic
999298763 5:150477185-150477207 GGAAGTTGCTGTACCTCTCTGGG + Intergenic
1000133410 5:158321349-158321371 ACAACTGGATGTTCCTCTCTGGG + Intergenic
1003480653 6:6529302-6529324 GGATGTGCCTGTTCATATCTAGG - Intergenic
1007636896 6:43305087-43305109 GCATGTGGCTTTCCCTCTCTGGG + Exonic
1007826782 6:44606806-44606828 CGATGTGGATGTTGCTCTGCAGG - Intergenic
1009286669 6:61827335-61827357 GGATGTGAGTGTTGCTCTTTGGG + Intronic
1010209091 6:73348821-73348843 GGGTGTGGGTGTTCCTCGCAGGG - Intergenic
1010343391 6:74783060-74783082 GGATGTTGATTTTTTTCTCTAGG - Intergenic
1010412031 6:75571392-75571414 GAATCTGGATGTTCCTATATTGG - Intergenic
1012207146 6:96475772-96475794 GAATCTGGATGCTCCTCTATGGG + Intergenic
1012551313 6:100466803-100466825 CGGTGTGGAAGTGCCTCTCTGGG + Intergenic
1012679854 6:102166530-102166552 GGATGTGGCTGCTCCTGTATTGG + Intergenic
1012784364 6:103604598-103604620 GAATGTGGATGCTCCTGTATTGG + Intergenic
1013183832 6:107740297-107740319 GGATGTGGGTGGTCATCTGTTGG - Intronic
1013398582 6:109768941-109768963 CGATGAGGATTCTCCTCTCTGGG - Intronic
1013653976 6:112226098-112226120 GGATCTTGGTGTTTCTCTCTCGG + Intronic
1015044844 6:128764638-128764660 GAATATGGATGTTCCTGTGTTGG - Intergenic
1015211562 6:130704086-130704108 GGATCTGGATGCTCCTGTATTGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020714489 7:11653415-11653437 GGATCTCGGTGTTCCTCTCTGGG - Intronic
1020920002 7:14252022-14252044 GGATGTTCATTTTCCTCTCCAGG + Intronic
1022326330 7:29335385-29335407 GGAAGTGGGTGCTCCTCTCTGGG - Intronic
1022384977 7:29891384-29891406 TCAGGTGGATGTTCATCTCTGGG + Intronic
1023467166 7:40468942-40468964 GGAAGGGGATCTTCATCTCTGGG - Intronic
1024137581 7:46426306-46426328 GGAAGTGCAGGTTCCCCTCTTGG - Intergenic
1024587388 7:50853801-50853823 GGGTTTGCATTTTCCTCTCTGGG + Intergenic
1024877681 7:54044965-54044987 GAATCTGGATGCTCCTCTATTGG + Intergenic
1026159236 7:67854029-67854051 GGATGTGGATGCTGCTGTCTGGG - Intergenic
1026616887 7:71913106-71913128 GGATGTGCATGATCCACTCAGGG + Intronic
1028442757 7:90882417-90882439 GAATCTGGATGTTCCTGTATTGG - Intronic
1030029976 7:105360048-105360070 GAATCTGGATGTTCCTGTATTGG + Intronic
1031676647 7:124619005-124619027 GTATGTGGATTGACCTCTCTGGG + Intergenic
1033466985 7:141601516-141601538 GGATGTGGAATTACATCTCTTGG + Intronic
1033532183 7:142275441-142275463 GGATCTGGATGCTCCTGTGTTGG - Intergenic
1033720127 7:144050463-144050485 GGATTCAGATGCTCCTCTCTGGG + Exonic
1034751353 7:153571758-153571780 GTAAGTGGATGTACCTTTCTGGG - Intergenic
1034925725 7:155119981-155120003 GGATGTGGAAGTTGCATTCTTGG - Intergenic
1035332714 7:158106829-158106851 GGAAGTGACTTTTCCTCTCTGGG - Intronic
1037238257 8:16747190-16747212 GAAAATGCATGTTCCTCTCTTGG + Intergenic
1037584403 8:20266805-20266827 GGAGGTGAAAGTTACTCTCTTGG + Intronic
1037813606 8:22100641-22100663 GGCTGTGGATGATCCCCTCGTGG - Exonic
1040748470 8:50675330-50675352 GAATCTGGATGCTCCTCTATTGG + Intronic
1041323080 8:56635022-56635044 GAATCTGGGTGTTCCTCTATTGG + Intergenic
1042356642 8:67835655-67835677 GCATGTGGGTCTTCATCTCTGGG - Intergenic
1043367065 8:79544803-79544825 GGATGTTGATATTTTTCTCTAGG - Intergenic
1043727284 8:83627139-83627161 GAATCTGGATGTTCCTTTGTTGG + Intergenic
1043789178 8:84441890-84441912 GGCTTTGGAAATTCCTCTCTGGG + Intronic
1044127944 8:88481652-88481674 GAATCTGGGTGTTCCTCTCTTGG - Intergenic
1044150884 8:88773713-88773735 GTATGTGGATGGACCTCTCTGGG + Intergenic
1044260562 8:90114892-90114914 GGAAGTCTATGTTCCTTTCTTGG + Intergenic
1048759310 8:137774503-137774525 TGGGGTGGATTTTCCTCTCTGGG + Intergenic
1050416750 9:5426450-5426472 AGATGAGGATGTTTCTCTCTAGG + Intronic
1051852397 9:21524841-21524863 GAATCTGGATGCTCCTCTGTTGG + Intergenic
1053749650 9:41239099-41239121 GGATATGGATGTCTTTCTCTAGG + Intergenic
1054255152 9:62803436-62803458 GGATATGGATGTCTTTCTCTAGG + Intergenic
1058079905 9:100690604-100690626 GGATGTGGATGGACATCTGTGGG + Intergenic
1058115807 9:101082842-101082864 TGATGTGAATGTTCCTCTTAGGG + Intronic
1058642184 9:107098499-107098521 GGATGTGCATCAGCCTCTCTAGG - Intergenic
1060410929 9:123399725-123399747 GGATGTGGAGCTGTCTCTCTGGG + Intronic
1062272534 9:135716370-135716392 GGATGGGCATGGTTCTCTCTAGG - Intronic
1187453450 X:19419510-19419532 GAATGTGGGTGTTCCTGTATTGG - Intronic
1193763499 X:85495857-85495879 GGATGTGGAGGTCCATCGCTTGG - Intergenic
1193859161 X:86642428-86642450 GAATCTGGATGTTCCTGTGTTGG - Intronic
1193907006 X:87256025-87256047 GAATGTGGGTGTTCCTGTATTGG - Intergenic
1194348439 X:92795092-92795114 GGATGTTGATATTTTTCTCTAGG - Intergenic
1198852197 X:140976623-140976645 GGAGGTGGATGTTGCTTTCCTGG + Intergenic
1200281814 X:154783561-154783583 AGATACGGATTTTCCTCTCTCGG + Intronic
1200598721 Y:5180593-5180615 GAATCTGGATGTTCCTATATTGG + Intronic
1200656768 Y:5911723-5911745 GGATGTTGATATTTTTCTCTAGG - Intergenic