ID: 902292678

View in Genome Browser
Species Human (GRCh38)
Location 1:15445564-15445586
Sequence CCGGGAGGGCATAAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902292678_902292685 -9 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292685 1:15445578-15445600 CCCTCCCGGTCTGGTGCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 184
902292678_902292683 -10 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292683 1:15445577-15445599 GCCCTCCCGGTCTGGTGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 187
902292678_902292689 -2 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292689 1:15445585-15445607 GGTCTGGTGCAGGGGGACTCCGG 0: 1
1: 0
2: 0
3: 18
4: 276
902292678_902292692 21 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292692 1:15445608-15445630 TGGCCCACTGAACTGCCAGTTGG 0: 1
1: 0
2: 1
3: 3
4: 100
902292678_902292695 28 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292695 1:15445615-15445637 CTGAACTGCCAGTTGGAGAACGG 0: 1
1: 0
2: 1
3: 21
4: 180
902292678_902292690 1 Left 902292678 1:15445564-15445586 CCTGGTGGCTTATGCCCTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 902292690 1:15445588-15445610 CTGGTGCAGGGGGACTCCGGTGG 0: 1
1: 0
2: 2
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902292678 Original CRISPR CCGGGAGGGCATAAGCCACC AGG (reversed) Intronic
900298704 1:1965795-1965817 CTGTCAGGGCAAAAGCCACCTGG - Intronic
900315834 1:2055921-2055943 CGGGGAGGGCACAAGCAGCCAGG + Intronic
900655814 1:3756381-3756403 CCAGGAGGGGACAAGCAACCAGG + Intronic
900918924 1:5658648-5658670 CCTTGATGTCATAAGCCACCAGG - Intergenic
901501366 1:9654425-9654447 CTGGGAGGGCATCAGCCCCTGGG + Exonic
902292678 1:15445564-15445586 CCGGGAGGGCATAAGCCACCAGG - Intronic
902551959 1:17224487-17224509 GAGGGAGGGCACAATCCACCCGG - Intronic
903993602 1:27290570-27290592 CTGGGAGGGGGCAAGCCACCCGG + Intronic
906151983 1:43592791-43592813 CAGGGAGGGCAGCAGCCGCCTGG - Intronic
912385892 1:109271018-109271040 CCGAGACGGCAAAGGCCACCGGG - Exonic
913680897 1:121186478-121186500 CCGGGGAGGGACAAGCCACCAGG - Intronic
914032727 1:143974117-143974139 CCGGGGAGGGACAAGCCACCAGG - Intergenic
914156717 1:145093848-145093870 CCGGGGAGGGACAAGCCACCAGG + Intronic
919765549 1:201124915-201124937 CTGCGAGGGCCTCAGCCACCAGG - Intronic
920468210 1:206205002-206205024 CCGGGGAGGGATAAGCCACCAGG - Intronic
921648406 1:217647358-217647380 CCGGGATGGAATATGCCAACAGG + Intronic
921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG + Intronic
922729106 1:227940831-227940853 CCGGGAGGGCAACAGGCTCCTGG + Intronic
923699688 1:236288110-236288132 CCGGTAGGAAAAAAGCCACCTGG + Intergenic
1064523515 10:16229066-16229088 CCTGCAGGGCTTAAACCACCAGG + Intergenic
1067432996 10:46256237-46256259 CCGGTCTGGCATCAGCCACCAGG + Intergenic
1073441788 10:103556550-103556572 CCTGGAAGGGAGAAGCCACCTGG - Intronic
1076856530 10:133117999-133118021 CTGGGAGGGAATGAGCCAGCTGG + Intronic
1084173056 11:67409791-67409813 CCGGGCCGGCATCAGCCATCAGG - Exonic
1085446779 11:76606076-76606098 CCGAGAGGGCATAAGGCAGAGGG - Intergenic
1089706509 11:120281815-120281837 CTTGGAGAGCATAAGTCACCAGG - Intronic
1089993350 11:122882660-122882682 GCCGGAGGGCAGAGGCCACCCGG - Exonic
1091930250 12:4390167-4390189 CTGGAAGGGAATCAGCCACCTGG + Intergenic
1092259720 12:6946403-6946425 CCGGGAGAGGAGGAGCCACCTGG - Intergenic
1096145164 12:49273830-49273852 CCCGAAGTGCATGAGCCACCAGG - Exonic
1096157528 12:49348887-49348909 CCCAGAGGGCATAGGTCACCAGG - Exonic
1097423543 12:59412978-59413000 CCGGGAGGCCATAAGACAAGAGG - Intergenic
1107529713 13:41271589-41271611 CCGAGAGGGCTTAAAACACCTGG + Intergenic
1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG + Intergenic
1108575153 13:51784177-51784199 CCTTGAGGGCAGAATCCACCTGG - Intronic
1113903884 13:113810636-113810658 CCGGGAGTGCCTAGGCCACTGGG + Intronic
1115062681 14:29212546-29212568 CCTGGAGGTCATTATCCACCAGG - Intergenic
1121210801 14:92206935-92206957 CCGGGAGGGCCTATGCCAGGAGG + Intergenic
1122651198 14:103228165-103228187 CCTGGAGGGCATTGGCCACAGGG + Intergenic
1126940267 15:53759114-53759136 CCGGGTGGGCCTAAGCCTGCTGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1135614304 16:23897591-23897613 ACTGGAGGGCATAAGCTGCCAGG - Intronic
1138265325 16:55656126-55656148 CCGGCAGGGCGCAAGGCACCAGG + Intronic
1141545411 16:84764431-84764453 CAGGGAGAGAATAAGCCACGGGG - Intronic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1143571225 17:7759951-7759973 CGGGGAGGGCACAAGGCACAGGG + Intronic
1144639108 17:16927832-16927854 CTGGGAGGGCTGAGGCCACCTGG + Intergenic
1145273406 17:21416542-21416564 CCGGGACGGCCTCAGCCCCCAGG + Exonic
1145311595 17:21703986-21704008 CCGGGATGGCCTCAGCCCCCAGG + Exonic
1145711360 17:26982118-26982140 CCGGGACGGCCTCAGCCCCCAGG + Intergenic
1147164035 17:38584082-38584104 CAGGGAGGGCATGAGAGACCCGG + Intronic
1151763646 17:76121534-76121556 CCGGGAGGGCTTAAGCAGGCGGG + Intronic
1151813844 17:76461274-76461296 CCAGGAGTGCATAAGCCTCTTGG + Intronic
1152229880 17:79109180-79109202 CTCGGAGGGCATGAGCCCCCAGG + Intronic
1153911214 18:9708151-9708173 CCCGGACGGCGTCAGCCACCCGG - Exonic
1156410081 18:36819590-36819612 GAGGGAGAGCAGAAGCCACCTGG + Intronic
1159560123 18:69984608-69984630 CCAGGAGGGCAAAATGCACCAGG + Intergenic
1160824229 19:1071901-1071923 CCGGGAGGACAGAGGCCAGCGGG - Intronic
1162898467 19:13779527-13779549 CCAGGAGTGGATAAGCCACTAGG - Intergenic
1163423230 19:17226781-17226803 CCGGGTGGGCATCGGCCTCCGGG - Exonic
1164696814 19:30251116-30251138 TCGGTGGGGAATAAGCCACCAGG + Intronic
1166740203 19:45109959-45109981 ACAGGAGGCCATAAGCCAACAGG - Intronic
1168564589 19:57412396-57412418 CAGGGAGGGGATAAGCAAGCAGG - Intronic
928440457 2:31287825-31287847 CCTGGAGGGCACAAACCCCCAGG + Intergenic
937236790 2:120436069-120436091 CCTGCAGAGCATAAGCCAGCAGG - Intergenic
938094755 2:128454200-128454222 CAGAGAAGGCATCAGCCACCAGG - Intergenic
940276594 2:151946683-151946705 CCAGCAGGGCACAAGGCACCTGG + Intronic
948145820 2:235707527-235707549 CCGGGGGAGCACAACCCACCAGG - Intronic
948248097 2:236503479-236503501 CCCGGAAGGCTCAAGCCACCAGG - Intronic
949010752 2:241677019-241677041 TGGGGAGGGCATAAGCCCGCAGG + Intronic
1171403117 20:24892180-24892202 CCAGGAGGGCAAAGGCCAGCGGG + Intergenic
1173614380 20:44393274-44393296 CCCAGATGTCATAAGCCACCTGG + Intronic
1176229978 20:64027628-64027650 CCGAGAGAGCAAAAGCCACAGGG - Exonic
1176371216 21:6062238-6062260 GCGGCAGGACATAAGCCACCAGG - Intergenic
1179752303 21:43476303-43476325 GCGGCAGGACATAAGCCACCAGG + Intergenic
1180068525 21:45424677-45424699 GCTGAAGGGCAGAAGCCACCAGG - Intronic
1181306331 22:21919262-21919284 CCAGGAGGGTGTAGGCCACCAGG + Intergenic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
950102331 3:10365502-10365524 CCGGGACGACAGAAGCCCCCTGG + Intronic
954991165 3:54841862-54841884 CCTGGAGGCCAGAAGCCACGTGG - Intronic
956541223 3:70341710-70341732 CCACGAGGACATAAGCCAACAGG + Intergenic
986767295 5:10939537-10939559 CAGGGAGGGCATAAGCCAGTGGG + Intergenic
997355515 5:133260279-133260301 CAGGGAGGGGAGAAGCCACTGGG + Intronic
1007633252 6:43284177-43284199 GCGGGAGGGCAGCCGCCACCAGG + Exonic
1017156390 6:151325898-151325920 CAGGGAGGACAAAAGCGACCTGG - Intronic
1017672543 6:156779696-156779718 CCGGCGGGGTAGAAGCCACCCGG - Intronic
1018861284 6:167712512-167712534 CGGGGCGGGCAGAAGCCAGCAGG - Intergenic
1019729678 7:2623095-2623117 CGGGGAGGGCCTATGCCAGCCGG + Intergenic
1023984589 7:45087495-45087517 GCGGGAGAGCAGGAGCCACCAGG - Intronic
1027499282 7:78927909-78927931 TAGGGATAGCATAAGCCACCAGG - Intronic
1032395427 7:131586140-131586162 CAGGGAGGACAGAAGCCATCAGG + Intergenic
1034172275 7:149071709-149071731 CCAGGAGGGGAACAGCCACCAGG - Exonic
1053901143 9:42796526-42796548 CTGGGATGGCAAAAGCCAGCAGG - Intergenic
1054260502 9:62861038-62861060 CTGGGATGGCAAAAGCCAGCAGG + Intergenic
1057333913 9:94141523-94141545 CCAGGAGGGCAGATGTCACCGGG - Intergenic
1059175769 9:112168948-112168970 ACGGGAGGAAATAAGCCAACGGG + Intronic
1059311530 9:113391731-113391753 CCAGGAGGGCTCAAGCCCCCAGG + Intronic
1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG + Intronic
1060547015 9:124467848-124467870 GCGGGAGGGCCCAGGCCACCAGG - Intronic
1199575855 X:149312929-149312951 CTGAGAGAGCATATGCCACCTGG - Intergenic