ID: 902295509

View in Genome Browser
Species Human (GRCh38)
Location 1:15464120-15464142
Sequence TAGGAAGCCCAGAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902295501_902295509 20 Left 902295501 1:15464077-15464099 CCTACATCACAGAGTTGTCACGA 0: 1
1: 4
2: 8
3: 60
4: 416
Right 902295509 1:15464120-15464142 TAGGAAGCCCAGAATGGGGTAGG 0: 1
1: 0
2: 2
3: 26
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902295509 Original CRISPR TAGGAAGCCCAGAATGGGGT AGG Intronic
900623988 1:3599872-3599894 CAGGCAGCCCAGAAAGGGTTAGG + Intronic
900933738 1:5752612-5752634 TAGGAGGCCATGAATGGGGTGGG + Intergenic
900974857 1:6010695-6010717 GGGGAAGCCCAGGGTGGGGTGGG + Intronic
902295509 1:15464120-15464142 TAGGAAGCCCAGAATGGGGTAGG + Intronic
902537622 1:17130222-17130244 TAGGAACCCCAAAAATGGGTTGG - Intergenic
903141682 1:21342998-21343020 TGGAAAGGCCAGAATGGGGCTGG - Intronic
904945118 1:34193549-34193571 AAGGAAGCCCAGGCTGGGGGTGG + Intronic
905231084 1:36515339-36515361 CTGGCAGCCCAGAATAGGGTGGG - Intergenic
906255689 1:44348184-44348206 TAGGGAGGACAGAATGGGGTGGG - Intronic
907950679 1:59180355-59180377 GAGGAGGCCAAGAAAGGGGTAGG - Intergenic
912273605 1:108234062-108234084 TTGGAAGCACAGACAGGGGTGGG - Intronic
912294615 1:108460260-108460282 TTGGAAGCACAGACAGGGGTGGG + Intronic
915479117 1:156173187-156173209 TAGGAAGCTCAGAAAGGGTAGGG - Intronic
918304011 1:183229338-183229360 TATAAAGTCCAGAATGGGGCCGG + Intronic
919883864 1:201918562-201918584 AAGAGAGCCCAGCATGGGGTAGG - Intronic
920697119 1:208189406-208189428 CAGGAGGCCCAGAATAGGGAGGG + Intronic
920919394 1:210285833-210285855 TAGGAGGCACAGTCTGGGGTCGG + Intergenic
922501229 1:226098436-226098458 AAGGATGCCCAGAAAGGTGTGGG + Intergenic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
923329511 1:232909610-232909632 TGGAAAGCCCAGGTTGGGGTGGG - Intergenic
923434336 1:233954348-233954370 AAGGAATGCCAGAAAGGGGTGGG + Intronic
924246374 1:242089505-242089527 TAGGAAGCTTAGCATGAGGTGGG - Exonic
1066251009 10:33632722-33632744 AAAGAAGCCCCAAATGGGGTGGG + Intergenic
1067793024 10:49301935-49301957 AAGACAGCCCAGAGTGGGGTGGG - Intronic
1069611602 10:69776236-69776258 TAGGAAGCACAGAAGGGGAGGGG + Intergenic
1069626079 10:69868413-69868435 TAGGAAGCCCAGGGTGGGGCAGG + Intronic
1070289238 10:75103970-75103992 GTGGAAGCCCAGCGTGGGGTCGG - Intronic
1070546273 10:77455423-77455445 GAGGAAGCCTAGAATGGGCTGGG - Intronic
1071376750 10:85013493-85013515 TAAAAAGCTCAGAATGGGCTGGG - Intergenic
1074443845 10:113501793-113501815 TTGGAAGCCCAGAGTGTGGCTGG - Intergenic
1076360789 10:129887536-129887558 GAGGCAGCCCAGAATGACGTTGG + Intronic
1076564466 10:131388737-131388759 TTGGGAGGCAAGAATGGGGTGGG - Intergenic
1077111298 11:863404-863426 TGGGAAGCCCTGGATGGGTTGGG + Intronic
1077321007 11:1941974-1941996 TAGGAGGCCAAGAATGGTGGGGG + Intergenic
1077633079 11:3824193-3824215 TAGGAAGGTCCGAATGTGGTAGG - Intronic
1081542097 11:44042744-44042766 TGGAAAGACCAGGATGGGGTTGG - Intergenic
1081634797 11:44714004-44714026 CAGGAAGCCCTGAGTGAGGTAGG + Intergenic
1081835501 11:46150067-46150089 TGGGAAGCCCAGATGGAGGTTGG + Intergenic
1085768917 11:79307943-79307965 TGAGAAGCCCAGGATGGGGTAGG - Intronic
1089224752 11:116908403-116908425 TAGGAAGCCGAGACTGCTGTGGG + Intronic
1090458940 11:126872675-126872697 AAACAAGCCCAGGATGGGGTGGG - Intronic
1090829199 11:130409141-130409163 TAGAAAGCCCAGCATGCGGCTGG - Intronic
1095866022 12:46972907-46972929 TAGGAATACCAGAATGGTGGTGG + Intergenic
1096009037 12:48197784-48197806 TAGTAAGCCCAGAAAGGGGTAGG + Intergenic
1096878163 12:54646443-54646465 TGGGAAGCCCAGAAGAGGGAGGG + Intronic
1097153454 12:56995871-56995893 CAGGAAGCCCAGGATGGTGGTGG - Exonic
1097473126 12:60020998-60021020 TAGGTGGCTCAGAATGGAGTGGG - Intergenic
1098828357 12:75328781-75328803 TAGAAAGCCCACAATGTAGTAGG + Intronic
1100520812 12:95373959-95373981 CATGAAGTCCAGAAGGGGGTTGG + Intergenic
1100689814 12:97027845-97027867 TAGGAAGCCCAGGAAAGGGGAGG + Intergenic
1102522477 12:113487237-113487259 TTGGAAACCAAGTATGGGGTTGG - Intergenic
1103931442 12:124453052-124453074 TGGAAAGCCCAGAAGGGAGTGGG + Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115512097 14:34147578-34147600 TAGGATGCCCAGTCTGGTGTGGG + Intronic
1120212209 14:81644365-81644387 TAGGAGGCCCAGGTTGGGGTCGG + Intergenic
1122087756 14:99319124-99319146 TGGGAAGCCCAGACTGGAGATGG + Intergenic
1122387267 14:101357727-101357749 TAAGAAGCCCACAATTGTGTGGG + Intergenic
1125999890 15:44198767-44198789 TAGGATGCCCAGAATGGAAAGGG + Intergenic
1128342267 15:66830831-66830853 TAGAATGCCCAGCATGGGATGGG + Intergenic
1130088126 15:80795541-80795563 TAGGAAGACTAGAGTGGGTTTGG + Intronic
1131198582 15:90377094-90377116 AAGTCAGCCCAGAATGGAGTTGG - Intergenic
1131950905 15:97680924-97680946 TGGGAAGCACAGAAGGGAGTGGG + Intergenic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132760319 16:1505784-1505806 TAGGAGACCCAGACTGGGCTTGG + Intronic
1133545395 16:6801561-6801583 AAGGAAGCCCATAATTGGGGTGG + Intronic
1134128561 16:11632874-11632896 TAGGAGGCTCAGAGTGGGGTGGG - Intronic
1135539530 16:23319339-23319361 AAGGAAGCCCAGATTGGGCTGGG - Intronic
1136756409 16:32688757-32688779 TAGGGAGCCAAGGATGGGGATGG - Intergenic
1136811704 16:33181616-33181638 TAGGGAGCCAAGGATGGGGATGG + Intergenic
1136818180 16:33291696-33291718 TAGGGAGCCAAGGATGGGGATGG + Intronic
1136824744 16:33348225-33348247 TAGGGAGCCAAGGATGGGGATGG + Intergenic
1136829810 16:33446996-33447018 TAGGGAGCCAAGGATGGGGATGG + Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1140601735 16:76484566-76484588 GAGGAAGCCAAGAATGGGGGAGG + Intronic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1141437566 16:84009031-84009053 TGGGAAGCCCAGAAGGGAGTGGG - Intergenic
1141774224 16:86111491-86111513 TAGGAAGCCCAGGAGGGCTTAGG + Intergenic
1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG + Intergenic
1202990282 16_KI270728v1_random:4585-4607 TAGGGAGCCAAGGATGGGGATGG + Intergenic
1143118983 17:4595724-4595746 TGGGAGCCCCAGCATGGGGTTGG + Intronic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1145268082 17:21390055-21390077 GAGAAAGCCAAGAATGGGGCAGG - Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1148563540 17:48619954-48619976 TGGGTAGCCCAGGATGGGGCAGG + Intronic
1149553017 17:57554006-57554028 TAGGGAGCCCATAAAGGGGCAGG - Intronic
1149820967 17:59777115-59777137 CAGCAAGTCCAGAATGGAGTGGG - Intronic
1152660089 17:81537994-81538016 TAGGAAGCGGAGGGTGGGGTGGG + Intergenic
1153742670 18:8145263-8145285 TAGGAACTACAAAATGGGGTGGG + Intronic
1154502195 18:15002552-15002574 TGAGCAGCTCAGAATGGGGTAGG - Intergenic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1159625728 18:70691815-70691837 TAGGATGCCTAGAATGAGGCAGG - Intergenic
1159738042 18:72128223-72128245 TTGGAAGCCCACAGTGCGGTGGG - Intergenic
1159938680 18:74388938-74388960 GAGGAAGCCAAGGTTGGGGTTGG + Intergenic
1160829163 19:1094961-1094983 GAGGAAGCCGCGAATGGGGACGG - Intronic
1161208292 19:3053619-3053641 AGGGAAGCCGGGAATGGGGTAGG + Exonic
1161301325 19:3544407-3544429 TAGGAATCCCAGAAGGGTCTGGG - Exonic
1162487487 19:10970127-10970149 TAGATAGCCCAGGATGGGGCTGG + Intronic
1163343762 19:16727008-16727030 TGGGAAGGGCAGAATGGGGTGGG + Intronic
1163579658 19:18130833-18130855 CAGGAACCCCAGTCTGGGGTAGG + Intronic
1164426342 19:28145363-28145385 AAGGAAGCCCAAGATGGAGTGGG - Intergenic
1166046076 19:40231998-40232020 TGGGTAGCCCAGAATGAGGAGGG - Exonic
1166807476 19:45496218-45496240 TAGGAGGCCTGGAATGGTGTGGG + Intronic
1166924947 19:46260907-46260929 TTGGAAGCCCAGCTTGGGGAAGG + Intergenic
1166963678 19:46515106-46515128 GAGGAAGGCCTGAATGAGGTGGG + Intronic
1167141137 19:47651463-47651485 AAGGATGCCAAGAATGGGTTGGG - Intronic
1167667566 19:50831649-50831671 AAGGAAGCGCAGAGTGGGGTTGG - Intronic
925010562 2:482015-482037 CAGGAAGCCCAGGATGGGAAGGG - Intergenic
925553110 2:5097322-5097344 TAAGAAGCCTAGAAAGGGCTGGG - Intergenic
926722769 2:15973889-15973911 TAGGAACACCAAAAAGGGGTGGG - Intergenic
926961521 2:18363328-18363350 TATGATGCCCAGCATGTGGTGGG + Intergenic
927055957 2:19365616-19365638 TAGGAGGCCCACAGTGGGCTGGG + Intergenic
927552377 2:24010863-24010885 TAGGAAGCCCTGAACAGGCTGGG - Intronic
927861160 2:26561098-26561120 TGGGCAGCCCTGAATGGGGGAGG + Intergenic
927980264 2:27370504-27370526 TAGGGAGCCCAAAGTGGAGTTGG - Exonic
928102239 2:28445821-28445843 TGGGCAGCCCAGAAAGGTGTTGG + Intergenic
928639928 2:33287613-33287635 TAGGAAGCCAATAATTTGGTGGG + Intronic
929438816 2:41949364-41949386 AAGGAAGACTGGAATGGGGTGGG + Intronic
930919620 2:56736495-56736517 TAAAAAGCCCAGAATAGGGTTGG - Intergenic
931926430 2:67078010-67078032 TTGAAAGTCCAGAATTGGGTTGG + Intergenic
932576981 2:72968024-72968046 TAGGAAGACTAGATTTGGGTAGG - Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933828409 2:86185591-86185613 CAGGAAGCCCAAAATGGAGAAGG + Intronic
937265374 2:120611927-120611949 GAGGAGGCTCAGGATGGGGTTGG - Intergenic
937343230 2:121105102-121105124 GAGGAGGCCCACAGTGGGGTGGG + Intergenic
938100864 2:128497433-128497455 TGAAAAGCCCAGACTGGGGTGGG + Intergenic
938501370 2:131832724-131832746 TGAGCAGCGCAGAATGGGGTAGG - Intergenic
941417684 2:165242430-165242452 TAGAAAACCCATAAAGGGGTTGG + Intronic
942899895 2:181102914-181102936 AAGGAAGCCCAGCATGGGTGAGG - Intergenic
945816217 2:214608335-214608357 TTGGAAGCACAAAATGGGATGGG - Intergenic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
1174203284 20:48821815-48821837 TAAGAAGACGCGAATGGGGTTGG - Intronic
1175443133 20:59004543-59004565 TAGGGAGCCCAGAATTGGGGCGG + Intronic
1179509332 21:41862098-41862120 GAAGAAACCCAGAGTGGGGTGGG + Intronic
1180126067 21:45791032-45791054 TGGGATGCCCAGGATGGGGGTGG + Intronic
1182052281 22:27322719-27322741 ACGGAAGCCCAGAGTGGGGAAGG + Intergenic
1182953814 22:34402247-34402269 TGGGAAGCTAAGAAGGGGGTGGG - Intergenic
1183374691 22:37456474-37456496 GAGGAAACCCTGACTGGGGTTGG - Intergenic
949409934 3:3752798-3752820 GAGGATGCCCAGAATGATGTGGG - Intronic
949509407 3:4755132-4755154 TAGGAAGCCCCTGATGGTGTAGG - Intronic
949884349 3:8681773-8681795 TAGGACGCCCAGCACAGGGTGGG + Intronic
950042569 3:9929777-9929799 CAGAAAGACCAGAATGGGGCAGG - Intronic
950104161 3:10377732-10377754 GAGGAAGACAAGAATGGGTTTGG - Intronic
950620782 3:14203543-14203565 ATGGAAGCCCAGAATGGGCGAGG - Intergenic
951344923 3:21536463-21536485 GAGGAAGCCCAGTTTGGGGAGGG + Intronic
952863277 3:37832719-37832741 TGGGAAGCCCAGGCTGGGCTGGG - Intergenic
952955658 3:38555777-38555799 TGAGAACCCCAGAATGAGGTTGG - Intronic
953637158 3:44673170-44673192 AAGGAAGCCAAGAAGAGGGTTGG + Intergenic
955075247 3:55607361-55607383 TAGCCAGCCAAGACTGGGGTGGG + Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
958702875 3:97615835-97615857 TGGAGAGCCCAGAAAGGGGTGGG + Intronic
960877937 3:122315476-122315498 TGGGAAGGCCAGAAGGGGGCTGG - Intergenic
962921296 3:139952973-139952995 TAGCCAGCTCAGAATGGGGAAGG + Intronic
965837598 3:172868520-172868542 TAGAAAGCTCAGTTTGGGGTTGG - Intergenic
968077353 3:195823867-195823889 TAGGAAGGCCAGGAAGAGGTGGG + Intergenic
968085461 3:195872081-195872103 TAGGAAGCCCAGCCTGGTGGGGG - Intronic
968586131 4:1416963-1416985 TAGGAAGCCCAGCAAGGGAAGGG - Intergenic
969112401 4:4852107-4852129 TAGCAAACCCAGGTTGGGGTGGG + Intergenic
969164892 4:5299055-5299077 CAGGAAGCCCAGAAGGGGCTGGG - Intronic
969284765 4:6196280-6196302 TAGGAAGCCCTGTAGGAGGTGGG - Intronic
971823188 4:31586308-31586330 TAGAAAGCCCAGGATGGGGCCGG + Intergenic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973166520 4:47084655-47084677 TGGGAAGCTCAGAATCAGGTAGG - Intronic
975472088 4:74781577-74781599 CAGGAAGCCAACAATGGGGGTGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976474059 4:85462262-85462284 AAGCAAGCCCAGAATGGAGCAGG - Intergenic
978463729 4:108985229-108985251 GAGGAAGCACAGAAGTGGGTAGG - Intronic
978731453 4:112031877-112031899 TAAGAAGCCTAGAATGGGGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
986044316 5:4022781-4022803 AAGGAAGCTCAGAAGGGTGTTGG - Intergenic
989521852 5:42411633-42411655 GAGGTAGCCCAGGATGGTGTAGG + Intergenic
993306967 5:86286026-86286048 TTGGAAGCACAGACAGGGGTGGG + Intergenic
993587606 5:89750431-89750453 TAGAATGCTCAGAATGGGATGGG - Intergenic
994812546 5:104540119-104540141 TAGGATGCACAGAATGGAATAGG - Intergenic
995930529 5:117437000-117437022 TAGGATGCAGAGGATGGGGTAGG + Intergenic
996469686 5:123845253-123845275 TAGGAAACCCAGAATCAGGCTGG - Intergenic
996507848 5:124288104-124288126 TGGGGAGCCAAGAAGGGGGTAGG - Intergenic
997904511 5:137802748-137802770 TGAGGAGCCCAAAATGGGGTAGG - Intergenic
999626967 5:153531209-153531231 AAGGAAGCCCACATGGGGGTTGG + Intronic
999755313 5:154659790-154659812 TAGGAAGGACAGAATTGGGAAGG - Intergenic
1000005506 5:157179805-157179827 TAAGAATCTCAGAATGGGGGAGG + Intronic
1001089151 5:168724392-168724414 TAAGGAGCCCAGTATTGGGTGGG - Intronic
1006358407 6:33573953-33573975 TAGGAACCCGAGGAAGGGGTGGG + Intronic
1006516513 6:34548577-34548599 AATGAAGCCCAGAGTGGGGAAGG + Intronic
1006970010 6:38033183-38033205 TAAGAAGATCAGAAAGGGGTTGG + Intronic
1007899236 6:45394677-45394699 TAGGAAGGCCAGTAGGGGCTGGG + Intronic
1011184690 6:84661253-84661275 TAGGAAGGCAAGCAAGGGGTGGG - Intergenic
1013516269 6:110889156-110889178 TAGGAAGCAGAGAATGAGTTAGG + Intronic
1018185775 6:161264507-161264529 TAGGAAGCCCAGACTGGGCAGGG + Intronic
1021123611 7:16825527-16825549 AAGGAAGCACTGAAAGGGGTAGG + Intronic
1026124596 7:67568525-67568547 TAGGAAGCCCAGAAATGGCTCGG - Intergenic
1031787502 7:126052553-126052575 AAGGAGGCACAGAATGTGGTAGG + Intergenic
1032121820 7:129162329-129162351 GAGGAACCCCTGGATGGGGTGGG - Intronic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1039136096 8:34324127-34324149 TAGAAAGTCCAAAATGGGCTAGG + Intergenic
1039401327 8:37272134-37272156 TAGGAAGCCCACAACAGGTTGGG - Intergenic
1039668922 8:39573668-39573690 TAGAAAGCCCATATTGGGGCGGG + Intergenic
1041416973 8:57621560-57621582 AAGGAAGCCAAGTATGAGGTTGG + Intergenic
1042476061 8:69248911-69248933 TATGAAGCCCAGAGTGGTGGTGG - Intergenic
1043166423 8:76908558-76908580 TATGCAACACAGAATGGGGTGGG - Intergenic
1044547491 8:93476039-93476061 GAGGAAGCCCTGAATGAGGTGGG - Intergenic
1044723657 8:95174556-95174578 CAGGAACCCGACAATGGGGTGGG + Intergenic
1045902421 8:107299037-107299059 TAGGAAGGTGAGAATGAGGTGGG + Intronic
1046438697 8:114230484-114230506 TCGTAAGCACAGGATGGGGTGGG - Intergenic
1046850845 8:118971235-118971257 TAGCATGCCAAGGATGGGGTTGG - Intergenic
1047381656 8:124371039-124371061 AAAGGAGTCCAGAATGGGGTAGG - Intronic
1049547299 8:143239083-143239105 GAGGATGCCCAGGATGGTGTGGG - Intergenic
1049962224 9:747798-747820 AAGTAAGACCAGCATGGGGTTGG + Intergenic
1050150973 9:2619252-2619274 TAGGAAGCTCAGCATCTGGTAGG - Intergenic
1051488094 9:17630540-17630562 TGGGAAGGGCAGAATGTGGTAGG + Intronic
1052048209 9:23819818-23819840 GATAAAGGCCAGAATGGGGTAGG - Intronic
1052450099 9:28618204-28618226 AAGGAAGACCAGGTTGGGGTTGG - Intronic
1055664848 9:78542990-78543012 TAGGAAGGCCAGACTAGGCTTGG - Intergenic
1056243148 9:84669121-84669143 TAGGTGGCCCGGAATGGGGGCGG + Intronic
1056888563 9:90468180-90468202 TAGGAAGCCCAGACTTGCGGGGG + Intergenic
1060072814 9:120565179-120565201 TCTGAAGCCCAGACAGGGGTAGG - Intronic
1061236090 9:129343440-129343462 GAGGGAGCGCAGGATGGGGTGGG + Intergenic
1061822390 9:133235737-133235759 TAGGAAGCCCTCTCTGGGGTGGG + Intergenic
1061927466 9:133812994-133813016 GAGGAAGCCCAGTGTGGGGAGGG - Intronic
1187484937 X:19694473-19694495 TAGGAAGCACTGGAAGGGGTTGG - Intronic
1189561472 X:42195446-42195468 TAGGAAGCACAGAATGGGGGTGG + Intergenic
1190053457 X:47169003-47169025 TAGGAATCCCTGTATGGGGGCGG + Intronic
1190618991 X:52266399-52266421 AAGGAAGCCCAACATGTGGTAGG + Intergenic
1190949206 X:55125959-55125981 AAGAAAGCACAGAATGGGTTAGG + Intronic
1192070193 X:67930819-67930841 TGGGAAGGGCAGTATGGGGTTGG + Intergenic
1196247841 X:113421740-113421762 CAGGAACCCAAGAGTGGGGTTGG - Intergenic
1197765477 X:130057073-130057095 CAGGGAGGCCAGAACGGGGTGGG - Exonic
1198036100 X:132802955-132802977 GAGGAAGGACAGAATGGGGTTGG - Intronic
1199749048 X:150797746-150797768 TAGGAAGCCCAGAAATAGGCCGG + Intronic
1201554024 Y:15249668-15249690 TAGGAAGTCTAGAGTGGGGCTGG + Intergenic