ID: 902296839

View in Genome Browser
Species Human (GRCh38)
Location 1:15473380-15473402
Sequence TTTCCAATCCTGAAAGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902296834_902296839 29 Left 902296834 1:15473328-15473350 CCCAATGAATGGCCCTTTGGCTT 0: 1
1: 0
2: 0
3: 23
4: 167
Right 902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
902296835_902296839 28 Left 902296835 1:15473329-15473351 CCAATGAATGGCCCTTTGGCTTA 0: 1
1: 0
2: 0
3: 12
4: 140
Right 902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
902296837_902296839 16 Left 902296837 1:15473341-15473363 CCTTTGGCTTAAGCACAACTGAG 0: 1
1: 0
2: 0
3: 3
4: 109
Right 902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
902296836_902296839 17 Left 902296836 1:15473340-15473362 CCCTTTGGCTTAAGCACAACTGA 0: 1
1: 0
2: 0
3: 11
4: 109
Right 902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902296839 Original CRISPR TTTCCAATCCTGAAAGCGGC TGG Intronic
902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG + Intronic
907456148 1:54576858-54576880 TTTCCAATCCTGAAAGGGTTTGG - Intronic
909195699 1:72619714-72619736 TTTCCAATCCTGAAATCATTTGG + Intergenic
910065281 1:83143938-83143960 CTCCCAATCCTGAGAGCAGCAGG + Intergenic
915860306 1:159437256-159437278 CTTCCAATCCTGAATGCCACAGG + Intergenic
918381842 1:183963812-183963834 ATTCCAATCCTGGAAGAGGAGGG + Intronic
920933111 1:210407301-210407323 TTTCCAATCCTTATAGCTGAAGG - Intronic
1063778867 10:9297678-9297700 TTTGCAAACCTGAGAGCAGCTGG - Intergenic
1067184675 10:44016418-44016440 TTTCCAATGCAGGAAGCAGCAGG - Intergenic
1071230584 10:83580711-83580733 CTTCCCATCCTGAAGGCAGCAGG + Intergenic
1075697324 10:124446932-124446954 TTCCAAATCCTGAACGAGGCTGG - Intergenic
1081163132 11:39776081-39776103 TTTCCAACCCTGAAAGGGATTGG + Intergenic
1090530528 11:127586927-127586949 TTTTTAGTCCTGAAAGCTGCTGG - Intergenic
1090636056 11:128691282-128691304 TTTTAAATCCTGAAAGGGGATGG - Intronic
1092919469 12:13218233-13218255 TTTCCATGCCTGAAAGCCGGTGG - Exonic
1096517727 12:52166398-52166420 TTTGCTAGCCTGAAAGGGGCAGG + Intergenic
1098931990 12:76428595-76428617 TTTAAAATCCTTAAAGCAGCAGG + Intronic
1101349433 12:103915083-103915105 TTTTCAATCATTAAAGTGGCTGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1111263768 13:85778714-85778736 TTTAAAATTCTGAAATCGGCCGG - Intergenic
1111683709 13:91475953-91475975 TTTCAAATCTTGTAAGAGGCTGG + Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116589647 14:46755328-46755350 TTTACAATCCTCCAAGGGGCAGG + Intergenic
1117326466 14:54673506-54673528 TTTCCAGTGCTAAAAGCAGCAGG - Intronic
1126761817 15:51976646-51976668 TTTAAAATCCTGAAGGAGGCCGG + Intronic
1132294020 15:100721864-100721886 TTTCCACTCCTCAAACCGACAGG + Intergenic
1133745871 16:8686306-8686328 TGTCCAGTCCTGCAAGGGGCTGG + Intronic
1141603827 16:85142014-85142036 TTTGAAAGCCTGAAAGCTGCCGG + Intergenic
1143677250 17:8443447-8443469 TTTCCATGCCTGAAAGAGCCTGG + Intronic
1147371360 17:39995169-39995191 TTTCCTGTCCTGACAGCTGCAGG - Exonic
1149953339 17:61016222-61016244 TTTCAAATCCCGAAAGAGCCAGG - Intronic
1152868083 17:82736020-82736042 TTTCCTATCCAGCAAGCGTCGGG + Intronic
1157357195 18:46946761-46946783 TAGCCAATCCGGAAAGGGGCGGG + Intronic
1158125496 18:54095787-54095809 TTTCCAATTCTCCAAGCAGCTGG - Intergenic
1158647786 18:59263360-59263382 TTTCCAATCCTAACAGTGGCTGG - Intergenic
1162272895 19:9630756-9630778 TTTCCCATTAGGAAAGCGGCAGG - Intronic
927844180 2:26462911-26462933 TTTCCCATCCATAAAGCGGCAGG - Intronic
931249697 2:60519060-60519082 TTTTCAATCCTGATACCAGCAGG + Intronic
935518975 2:104080050-104080072 TGTCCAAAACTGAAAGCGCCAGG - Intergenic
937254020 2:120541963-120541985 TTTACGATCCTGCAAGCAGCAGG - Intergenic
941222582 2:162802257-162802279 TTTCCAATACTCAAATGGGCTGG + Intronic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
1169453835 20:5734751-5734773 TTACCAGTCCTTAAAGGGGCAGG + Intergenic
1169863915 20:10179793-10179815 TTCCCAAGACTGAAAGCTGCTGG - Intergenic
1175510765 20:59523995-59524017 TTTCCAAAACAGAAAGCAGCAGG + Intergenic
1176726417 21:10438730-10438752 TTTCCAAAACTGAAGGCAGCTGG - Intergenic
1180287963 22:10768356-10768378 TTTCCAAAACTGAAGGCAGCTGG + Intergenic
949805299 3:7949071-7949093 TTTCCAATCCTGGAAGCACAAGG + Intergenic
952093423 3:29919805-29919827 TGTACAATGCTGAAAGCAGCAGG - Intronic
953859610 3:46531780-46531802 TTTCCTTTCCTGAATGCTGCAGG - Intronic
954420778 3:50417997-50418019 TTTCCAAACCTGATACAGGCAGG - Intronic
955406222 3:58627277-58627299 TTTCCCTTCCTGAGAGAGGCAGG - Exonic
955566740 3:60255526-60255548 ATTCCATTCCTGAAAGCAGTTGG - Intronic
957547981 3:81664493-81664515 TGTCCAAACCTGAGAGCAGCTGG + Intronic
962137255 3:132747778-132747800 TTTAAAATGCTGAAAGAGGCTGG - Intergenic
965741880 3:171884116-171884138 TTTCCGATCCAGAATGCGGCTGG - Intronic
968896238 4:3405443-3405465 GTTCCAACCCTGACAGAGGCTGG - Intronic
970421818 4:15912082-15912104 TTTCCTATCCTGAAGTCGTCGGG + Intergenic
971478119 4:27091040-27091062 TTCCCAGCCCTGAGAGCGGCTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972567815 4:40285003-40285025 TTTCCCATCCTGGACGCAGCAGG + Intergenic
975303334 4:72817816-72817838 CTTCCAATTCTGAAAGCAGATGG - Intergenic
987913088 5:24175441-24175463 TTTCCAAACCTGAAAGCTTGGGG + Intronic
1001219455 5:169887122-169887144 TTTCCAGTCCTGAAGAAGGCAGG - Intronic
1001252880 5:170162118-170162140 TTTACAATCCTGAAAGGGTCTGG - Intergenic
1004701650 6:18085261-18085283 TTTCTAATCCTGAAGGAAGCTGG + Intergenic
1006090361 6:31625215-31625237 TTTCCGACCCTGCAGGCGGCTGG + Exonic
1007403558 6:41618744-41618766 TTTCCATTCCTGAAGGCAGTAGG + Intergenic
1011054094 6:83187103-83187125 TATCCCATCCTGAAACTGGCAGG + Intronic
1022992080 7:35718612-35718634 TTGCCAATCCTGATTGTGGCAGG - Intergenic
1023553624 7:41396647-41396669 CTTCCAAAACTGAAAGCAGCAGG - Intergenic
1027278826 7:76590809-76590831 CTCCCAATCCTGAGAGCAGCAGG - Intergenic
1028561293 7:92179137-92179159 TTTCCCAGGCCGAAAGCGGCCGG + Intronic
1030622733 7:111809095-111809117 TTTTGAATCCTGAAAGAGCCAGG + Intronic
1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG + Intronic
1034603685 7:152289233-152289255 TTTCCAAAACTGAAAGCAGTTGG + Intronic
1034882270 7:154771710-154771732 TTTCCAATTCTGAGAGCATCTGG + Intronic
1035893274 8:3369660-3369682 TTTGCACTCCTGAGAGCCGCTGG + Intronic
1038761498 8:30387402-30387424 TTTCTAACCCTGAAAGCCACAGG + Intronic
1040919274 8:52598954-52598976 CCTCTAATCCTGAAAGAGGCAGG + Intergenic
1056503102 9:87230224-87230246 GTCCCAACCCTGGAAGCGGCCGG - Intergenic
1061566489 9:131444229-131444251 TTTCCGACGCTGAAAGCAGCTGG + Exonic
1185448501 X:270976-270998 TTTCCATTCCAGGAAGCAGCTGG + Intergenic
1188111275 X:26198226-26198248 TTTCCAGGGCTGAAAGGGGCAGG - Intergenic
1190578130 X:51862080-51862102 TTTTCAATCCTGAAAGCTTTTGG + Intronic
1193017077 X:76746865-76746887 TTTCCATTCCTGAATTAGGCTGG - Intergenic
1196699519 X:118652974-118652996 TTTCCCAGCCTGAGAGCGGCTGG - Intronic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic