ID: 902297704

View in Genome Browser
Species Human (GRCh38)
Location 1:15479759-15479781
Sequence AACCTTGAGCAGAGACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902297703_902297704 -8 Left 902297703 1:15479744-15479766 CCTCATGGAGAAGGCAACCTTGA 0: 1
1: 0
2: 2
3: 22
4: 274
Right 902297704 1:15479759-15479781 AACCTTGAGCAGAGACTGACAGG 0: 1
1: 0
2: 0
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902297704 Original CRISPR AACCTTGAGCAGAGACTGAC AGG Intronic
902168289 1:14590346-14590368 AACCTTTTGCAGAGAGTGAAGGG + Intergenic
902297704 1:15479759-15479781 AACCTTGAGCAGAGACTGACAGG + Intronic
904820804 1:33242746-33242768 AACCAGGAGCAGAGAGTGAGGGG - Intergenic
905811770 1:40918360-40918382 AACATTGATCAGAGACTGATTGG + Intergenic
914371239 1:147026103-147026125 AACCTAGAGCAGAGCTTGTCTGG + Intergenic
920341359 1:205276893-205276915 AACCTTCAGCTGAGGCTGGCAGG - Intergenic
921213603 1:212919795-212919817 AACCTTGAGCAGGGAGTGGCTGG + Intergenic
922586806 1:226739282-226739304 AGCCCGGAGCAGACACTGACAGG - Intronic
923024463 1:230193965-230193987 TCCCTTGAGCAGAGAGTGGCTGG - Intronic
1063323233 10:5071856-5071878 AAGGCTGAGCAGAGACTGAGTGG - Intronic
1064272863 10:13880749-13880771 ATCATTGAGCAAAGACTGAAAGG - Intronic
1064324106 10:14332940-14332962 AACCCTGAGGAGAGACAGGCAGG + Intronic
1064798631 10:19042923-19042945 AACCTGGAACATAGAATGACAGG - Intergenic
1067814232 10:49459955-49459977 ATTCTTGAGCAGAGAAAGACAGG + Intronic
1075517317 10:123119273-123119295 GACCTTGACCACAGACTGCCTGG + Intergenic
1076624590 10:131813891-131813913 AACACTGAGCAGACACTCACAGG + Intergenic
1084586901 11:70067668-70067690 AACCTTGAGAAGATGCTCACAGG + Intergenic
1095799476 12:46257214-46257236 AGCCATCAGCAGAGACTGCCAGG + Intronic
1096490251 12:52009125-52009147 GTCCTTGAGCAGACACTGAGAGG - Intronic
1101698143 12:107146269-107146291 AACTTGGAGCAGAGAATGTCAGG - Intergenic
1102652113 12:114449366-114449388 AACCTTTAGCACAGACCTACTGG - Intergenic
1103737998 12:123072667-123072689 AACCTTGAGCAGCTGTTGACAGG - Intronic
1104188404 12:126454677-126454699 AACCTTGTGGAGAGAGAGACGGG + Intergenic
1104289571 12:127455635-127455657 AGCCCGGAGCAGAGACTGAGCGG - Intergenic
1105484210 13:20811120-20811142 GACCTGGAGCAGAGAGTGATGGG + Intronic
1106258438 13:28042835-28042857 AGCCTTGAGCACAGACAGAAAGG - Intronic
1106330082 13:28732145-28732167 AAGCTTGAGCAGAGACTTGCCGG + Intergenic
1106561643 13:30851808-30851830 AATCCTGAGCAGAGACTGTGTGG + Intergenic
1106893691 13:34274885-34274907 AACAGTGATCAGAGACTGACAGG + Intergenic
1110187799 13:72694992-72695014 AAACTGGAGCACAGACTGACTGG + Intergenic
1112153535 13:96791821-96791843 AACCCTTAGCAAAGACTTACAGG - Intronic
1116214035 14:41987489-41987511 AACCTTGTGCAGAGCCTCAGTGG + Intergenic
1117201311 14:53392879-53392901 AACCTGGAGCACAAAGTGACTGG + Intergenic
1117830066 14:59741300-59741322 CAGCTTGAGCAGAGACTGAATGG - Intronic
1117959737 14:61150971-61150993 AACCTTTAGCAAAGCCTGCCTGG - Intergenic
1118323459 14:64766706-64766728 AAACGAGACCAGAGACTGACCGG + Exonic
1121510050 14:94505723-94505745 ACCCTGGAGCAGAGAGTGTCTGG - Intronic
1123156531 14:106232686-106232708 GACCTTGAGTAGAGCCTGTCTGG - Intergenic
1125110262 15:36024139-36024161 AATTTTGAGCAGATTCTGACAGG + Intergenic
1125472776 15:40020879-40020901 AACCTGGATCAGAAACAGACCGG - Exonic
1125655137 15:41350205-41350227 AGCCTTGAACAAAGACTGAGCGG + Intronic
1125795607 15:42402104-42402126 AACCTTGAGAAGAAACAGAAAGG - Exonic
1132687088 16:1166875-1166897 AACCTGGAGCAGGGACGGCCCGG - Intronic
1134251545 16:12577779-12577801 AACCTTGATGACTGACTGACAGG + Intergenic
1135221069 16:20614411-20614433 AGCCTGGATGAGAGACTGACTGG + Intronic
1138590818 16:57998814-57998836 ACCCTTTAGCTGAGACTCACAGG + Intronic
1138835366 16:60428404-60428426 AAGTTTGAGCAGAGACCTACAGG - Intergenic
1139328700 16:66171147-66171169 ACCCTTGAGCAGAGGCTGGGCGG + Intergenic
1140768553 16:78182495-78182517 ACCCTTGAACAGAGACTCACAGG - Intronic
1141504295 16:84464424-84464446 AACTTTTAGTAGAGACAGACAGG - Intergenic
1142546551 17:707979-708001 CACAGTGAGCAGAGACTCACAGG - Intronic
1145116042 17:20211445-20211467 CCCCTTGAGCAGAGGCTTACTGG - Intronic
1145899733 17:28482793-28482815 AACCTTGAGCGGGTACTGAGGGG - Intronic
1146193218 17:30788553-30788575 AAGCTTCAGCAGGGACTGACTGG + Intronic
1147268927 17:39253204-39253226 GTCCCTGAGCAGAGTCTGACAGG + Intergenic
1148663923 17:49361329-49361351 AATCTTCAGCAGAGCCTGATTGG + Intronic
1149340886 17:55685244-55685266 AGACTGGAGCAGAGAGTGACAGG - Intergenic
1149563370 17:57625277-57625299 GACCTAGAGCAGAAACTCACGGG - Intronic
1153503670 18:5773255-5773277 AACGTTGAGCAGTGACTGATTGG - Intergenic
1155854119 18:30810731-30810753 AGCCTGGAGCTAAGACTGACAGG + Intergenic
1156492969 18:37507189-37507211 GGCCTTGAGCAGTGACTGAGGGG - Intronic
1157314455 18:46576254-46576276 ATCCTGGATCAGAGGCTGACTGG - Intronic
1157802861 18:50635167-50635189 ATCCATGAGGAGATACTGACAGG - Intronic
1160075714 18:75674732-75674754 AACCTGGGGCAGAGACTGTTGGG + Intergenic
1160135181 18:76265778-76265800 CACCATTAGCAGAGACTCACAGG + Intergenic
1161523602 19:4739420-4739442 AACTTTTAGTAGAGACTGGCCGG - Intergenic
1162479473 19:10920298-10920320 ACCCTGGAGCAGAGACAGGCTGG - Intronic
1165339598 19:35201530-35201552 AAGTTTGAGCAGAGACTTAAAGG - Intergenic
927464135 2:23324380-23324402 ATCCTTCAGCAGAGACTTACTGG - Intergenic
928274535 2:29887953-29887975 AACCTTTGGCAGAGAATGTCAGG + Intronic
928379422 2:30804811-30804833 AACCTTGAGGAGAGATGGAATGG + Intronic
932929373 2:76015700-76015722 AACCTTGAGAGGAGACAGGCAGG - Intergenic
936666982 2:114608263-114608285 AGCTTTGAGCAGAGATTGAATGG - Intronic
944122848 2:196259629-196259651 AACCTTAAGCAGAGAGAGGCTGG - Intronic
945981842 2:216318544-216318566 AAATTTGAGCAGAGACTGGAAGG + Intronic
946346961 2:219118640-219118662 AACCCTGTGCAGAGAAGGACAGG + Intronic
946662544 2:222016561-222016583 AGACTTGAGCAAAGACTGAAAGG - Intergenic
948564226 2:238873407-238873429 ACGCTTGAGCAGAGAATGAATGG + Intronic
1172818988 20:37715211-37715233 AGCCTTAGGCATAGACTGACGGG + Intronic
1175202075 20:57284969-57284991 AACTTTGAGCAGAGAGGGAAGGG + Intergenic
1175734591 20:61376487-61376509 AACCTGCAGCAGGGACTGAGAGG + Intronic
1179299763 21:40096353-40096375 CACCTTGAGCACATACTGTCAGG + Intronic
1183476449 22:38038599-38038621 AACTTGGAGCAGAGAGAGACAGG - Intronic
1184073737 22:42163075-42163097 CTCCTTGAGCAGAGCCTGGCAGG - Intronic
1185149388 22:49155292-49155314 CACTTTGAGAAGGGACTGACAGG + Intergenic
952102839 3:30034861-30034883 ATCCTAGAGAACAGACTGACAGG - Intergenic
952699677 3:36312710-36312732 AACCTTGAGCAAAGACTTAAAGG - Intergenic
952818682 3:37467421-37467443 AGCCTAGAGCCAAGACTGACAGG - Intronic
952965869 3:38620926-38620948 AATCTTGACCAGAGACTCAAAGG + Exonic
957336999 3:78843561-78843583 AACCTTCAGCTGAGACAAACAGG - Intronic
960055603 3:113274449-113274471 AACCCTGAGCAGATGCTGAGGGG + Exonic
960786930 3:121383819-121383841 AAGCTTGGGCAGAGACTCATGGG - Intronic
962429664 3:135307442-135307464 AGCCCTGAGAAGAGTCTGACAGG - Intergenic
962843253 3:139254030-139254052 AAGGTTGGGCAGAGAATGACAGG - Intronic
964106230 3:153043012-153043034 AACGTTGAGCAAAAACTGAGAGG + Intergenic
969444893 4:7239157-7239179 AACCTTCTGCAGAGAGTGGCAGG - Intronic
974463733 4:62225713-62225735 CACCTAGTGCAGAGTCTGACAGG + Intergenic
974869497 4:67622220-67622242 GAATTTGAGCAGAGACTGAAAGG - Intronic
975821877 4:78279126-78279148 AACTTTGAGCAGAGCCTGAAGGG + Intronic
975923647 4:79423109-79423131 ACATTTGAGCAGAGACTGAAAGG + Intergenic
976311539 4:83618078-83618100 CACCTTGAGAGGAGACTAACTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
977997356 4:103510993-103511015 AACCTTGGGCAGAGACTATGAGG + Intergenic
978678529 4:111349469-111349491 AACATTAAGAAGAGACTGCCAGG - Intergenic
981020755 4:140025630-140025652 AACCTGGACCAGAGACAGACAGG + Intronic
981854774 4:149275329-149275351 AACCTTTAGCAGAAAATGCCCGG - Intergenic
984456499 4:179975935-179975957 AGCATTGAGCAGAGGCTGAAGGG - Intergenic
984677558 4:182567660-182567682 AACATTGAGCAAAGACTGAATGG - Intronic
985950156 5:3216960-3216982 GACCTAGAGCAGAGACAGTCTGG + Intergenic
986251938 5:6068108-6068130 AAGCTTTAGCAGAGAATCACCGG + Intergenic
987061266 5:14246448-14246470 GACCAAGAGCAGAGACAGACAGG - Intronic
990444384 5:55880662-55880684 ACCCCTTAGCAGAGGCTGACTGG - Intronic
992247123 5:74837326-74837348 AACTTTGAACAGAAACTGAAGGG - Intronic
996183253 5:120446515-120446537 AAACTTGCTCAGAGGCTGACTGG + Intergenic
997157129 5:131573060-131573082 AGCTTGGAGCAGAGACTGAAAGG - Intronic
997438132 5:133889863-133889885 GACATTGAGCAGACACTGAAGGG - Intergenic
997943401 5:138178633-138178655 AACCCTGAGGAGAGACGGTCTGG + Exonic
998527954 5:142859769-142859791 AACCTAGGACAGAGACAGACTGG - Intronic
998658399 5:144207236-144207258 CACCTTGGGCAGAGAGGGACAGG + Exonic
998695520 5:144633803-144633825 AACCTTCAGTAGAGGCAGACAGG + Intergenic
999111568 5:149125898-149125920 GATCTTGAGCAGAGATTGATAGG + Intergenic
1001968972 5:175938494-175938516 AACCTTGTGGAGACACTGACTGG - Intronic
1002095527 5:176828613-176828635 AAGCTAAAGCAGAGAGTGACAGG - Intronic
1002248472 5:177905251-177905273 AACCTTGTGGAGACACTGACTGG + Intergenic
1002877617 6:1225577-1225599 AACCAGGAAAAGAGACTGACAGG + Intergenic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1003665724 6:8109544-8109566 GACCCTGAGCAGAGTCTGAAAGG - Intergenic
1004444385 6:15684892-15684914 ACCCTTGACCAGTGACAGACAGG - Intergenic
1007736807 6:43987102-43987124 AACCTTGAGTAGGGGCTGAGGGG - Intergenic
1009050939 6:58275860-58275882 CACCTTGTGCCGAGACTGAATGG + Intergenic
1009239483 6:61166524-61166546 CACCTTGTGCTGAGACTGAATGG - Intergenic
1009563052 6:65273794-65273816 AACCTTGAACAAAGACAGAGTGG - Intronic
1010108858 6:72200828-72200850 AATCTTGAGAAGAGATTGAAAGG + Intronic
1013517693 6:110903491-110903513 GACTTTGAGCAAAGACAGACTGG - Intergenic
1015207898 6:130661412-130661434 AACCATTAGCAGAGACTGTAAGG + Intergenic
1015851039 6:137572974-137572996 GACCTTGAGCACAGAGTGAAAGG + Intergenic
1017246925 6:152237028-152237050 AACTTTAAGGAGAGACTGTCAGG - Intronic
1017518023 6:155175064-155175086 AGCCTTTAGCAGAGAGTGTCCGG + Intronic
1020004871 7:4777293-4777315 GACCTTGAGCAGAATGTGACTGG - Intronic
1020711903 7:11617205-11617227 AACATTCATCAGAAACTGACAGG + Intronic
1024922705 7:54576264-54576286 ACCCTCGAACAGTGACTGACAGG - Intergenic
1027486063 7:78763071-78763093 AACCATGACCAGTGACTGGCAGG - Intronic
1031288151 7:119898967-119898989 AACCTTGTGTAGAGTCTGGCAGG - Intergenic
1037156840 8:15711204-15711226 AACATCGAGGAGAGACTTACAGG - Intronic
1037252872 8:16918031-16918053 GACCTTGAGCAAAGACTGGAAGG + Intergenic
1040275252 8:46010530-46010552 GACCCTGTGCAGAGACTGATGGG + Intergenic
1040275338 8:46010934-46010956 CACCTTGTGCAGGGGCTGACAGG + Intergenic
1044397034 8:91725158-91725180 AGCCATCAGCAGTGACTGACAGG + Intergenic
1044730004 8:95221934-95221956 ACATTTGAGCAGAGACTGAAGGG + Intergenic
1045638486 8:104221024-104221046 AATCTTTAGGAGAGTCTGACTGG + Intronic
1048198384 8:132351453-132351475 AACCTCACTCAGAGACTGACGGG + Intronic
1048440331 8:134454976-134454998 AACCTGGTGCAGAGCCTGGCAGG + Intergenic
1048453381 8:134554222-134554244 CACATTGTGCAGACACTGACAGG + Intronic
1049249655 8:141581531-141581553 AAACTTGGGGAGAGACAGACAGG + Intergenic
1053282727 9:36831578-36831600 AACCTAGAGCTGAGACTCCCAGG + Intergenic
1054762795 9:69018239-69018261 AATCTTGAGCAGAGACACAGGGG + Intergenic
1056806532 9:89733235-89733257 ACCCTGGGGCAGAGACTGTCAGG + Intergenic
1061324176 9:129852731-129852753 AAAGCTGAGCAGAGACTGTCAGG - Intronic
1187757638 X:22545176-22545198 GTCCTTGAGCAGAGCCTGGCTGG - Intergenic
1188242902 X:27810686-27810708 AACCCAGAGCAAAGACTGAAGGG + Intronic
1189096984 X:38150926-38150948 AATCTGGAGAAGAGACTGAGTGG - Intronic
1189560531 X:42187444-42187466 AACATTCAGAAGAGACTGAATGG - Intergenic
1190964572 X:55286758-55286780 AACTTTGAGAAGAGACTAAAAGG - Intronic
1195964706 X:110419355-110419377 AACGTTAAGCTGAGACTGAAAGG - Intronic
1200048002 X:153412810-153412832 AACTGTGAGCAGAGAAGGACAGG + Intergenic