ID: 902300001

View in Genome Browser
Species Human (GRCh38)
Location 1:15494968-15494990
Sequence CGTGCCTCAGGGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902300001_902300007 7 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300007 1:15494998-15495020 TTCCCCTGCTAAAGATGCGAAGG 0: 1
1: 0
2: 1
3: 6
4: 77
902300001_902300015 29 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300015 1:15495020-15495042 GCAGAGGCAGGGTCAGGCAGAGG 0: 1
1: 0
2: 15
3: 144
4: 960
902300001_902300011 13 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300011 1:15495004-15495026 TGCTAAAGATGCGAAGGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 229
902300001_902300012 17 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300012 1:15495008-15495030 AAAGATGCGAAGGCAGAGGCAGG 0: 1
1: 0
2: 3
3: 43
4: 433
902300001_902300014 23 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300014 1:15495014-15495036 GCGAAGGCAGAGGCAGGGTCAGG 0: 1
1: 1
2: 32
3: 72
4: 877
902300001_902300013 18 Left 902300001 1:15494968-15494990 CCCATGGAAACCCCTGAGGCACG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 902300013 1:15495009-15495031 AAGATGCGAAGGCAGAGGCAGGG 0: 1
1: 0
2: 2
3: 47
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902300001 Original CRISPR CGTGCCTCAGGGGTTTCCAT GGG (reversed) Intronic
902300001 1:15494968-15494990 CGTGCCTCAGGGGTTTCCATGGG - Intronic
905314499 1:37073333-37073355 GGTGCCTCAGGGGCTGCCTTGGG - Intergenic
907219004 1:52891476-52891498 AGTGCTCCAGAGGTTTCCATAGG + Intronic
916171358 1:162003693-162003715 CTTGCCTGAGGGGTTGGCATGGG - Intronic
920849128 1:209616763-209616785 TGTGGCTCAGGGGTTTCAATAGG - Intronic
921245232 1:213231738-213231760 TGTGTCTCAGGAGTTTGCATTGG + Intronic
1070615681 10:77967734-77967756 CGTCTCCCAGGGGTCTCCATGGG + Intergenic
1074186402 10:111102629-111102651 TGGGCCTCAGGGGTGACCATGGG + Intergenic
1082087083 11:48058959-48058981 CCTGCCTCTGGGCTTTGCATGGG + Intronic
1084536252 11:69758940-69758962 CGTGCCACTGAGGTTTGCATCGG - Intergenic
1084758556 11:71253584-71253606 CATGCCTGAGAGGTTTGCATGGG + Intergenic
1090956010 11:131513344-131513366 CCATCCTCTGGGGTTTCCATAGG + Intronic
1092152423 12:6259856-6259878 CGTGCCTCAGGCCTTTGCATTGG - Intergenic
1099909854 12:88816248-88816270 CTTGCTTCAGAGGTTTCCACTGG + Intergenic
1106127400 13:26911634-26911656 CGTGGGTCATGTGTTTCCATAGG + Intergenic
1106670485 13:31899518-31899540 CCTTCCTCAGGGGTTTCCTTAGG - Intergenic
1106832578 13:33601437-33601459 AGTGCCTCAGGGGTTTCTTGGGG + Intergenic
1112813691 13:103248948-103248970 GGTGCCTCTGGGGTTCCCACAGG + Intergenic
1114239736 14:20855528-20855550 CCTATCTCAAGGGTTTCCATGGG - Intergenic
1125609545 15:40961142-40961164 CTTGCCTCAGGCATTTCCTTGGG + Intergenic
1126881669 15:53105620-53105642 AGTGCCTCAGGTGGTTCCAATGG + Intergenic
1129603449 15:77013387-77013409 GCTGCCTCTGGGGTCTCCATGGG + Intronic
1130370643 15:83283570-83283592 CTTCCTTCAGGGGTTTGCATGGG - Intronic
1137532888 16:49293900-49293922 CGTGCCTCAGAGGAAACCATAGG + Intergenic
1142179033 16:88658266-88658288 CGTGCCCCAGGGGCTCCCCTGGG - Intronic
1147944973 17:44075759-44075781 CGTGACTCAGGGGCTGCCCTGGG + Exonic
1148226422 17:45900845-45900867 CCTGTCTCACGGGTTGCCATGGG + Intronic
1151620654 17:75242960-75242982 GGAGCCTCTGGGGTTTCCCTGGG - Intronic
1152083784 17:78205179-78205201 CCAACCTCAGAGGTTTCCATGGG + Exonic
1152320917 17:79608558-79608580 CGTGCGGCAGGGGTTGCCACTGG - Intergenic
1155545032 18:26905930-26905952 TCTGCCTCAGGGCTTTCTATGGG - Intergenic
1163777737 19:19227863-19227885 CGGGCCTCAGGGGTATCCCGGGG + Exonic
1165454768 19:35904034-35904056 CCTGCTTCAGGGGTTTCCTCAGG - Intronic
1168346103 19:55650919-55650941 CCTGCCTCCTGGGTTTCCAGAGG + Intronic
1168701158 19:58440362-58440384 GGTGCCTCAGGGCTGGCCATTGG + Intergenic
927151584 2:20199298-20199320 CTTGCCTCAGGGGTTTTGCTTGG - Intergenic
931248926 2:60513460-60513482 CCTGCCAAAGGGGTTCCCATGGG - Intronic
931362450 2:61589529-61589551 TGTGCCTCCAGTGTTTCCATCGG - Intergenic
938131828 2:128722728-128722750 AGTGCCCCAGGGGATTCCAAGGG - Intergenic
938169055 2:129058591-129058613 TCTGCCTCAGGGCTTTCCACCGG + Intergenic
948095732 2:235332672-235332694 CCTGCCTCAGGGGATGCCGTAGG - Intergenic
948542586 2:238701238-238701260 TGTGCCTCAGTGCTGTCCATAGG + Intergenic
948624768 2:239262068-239262090 GGTCCCTCAGGGCTTTCCCTTGG - Intronic
1170079997 20:12464225-12464247 CATGCCTCAGGGCTGCCCATGGG - Intergenic
1174214971 20:48909476-48909498 CTTGCCTCAGGGGCTGCCACTGG - Intergenic
1174288362 20:49488657-49488679 CATTCCTCAGGGGTTTCACTGGG - Intergenic
1179909635 21:44441077-44441099 CGTGCCTCGAGGGCTTCCAAGGG + Intronic
1184057226 22:42060627-42060649 CGTTCCTCACAGTTTTCCATGGG - Intronic
952979004 3:38720076-38720098 TGTGCTTCAGGGCTTTCCATGGG + Intronic
955499756 3:59572081-59572103 CATTCCTCAAGAGTTTCCATAGG - Intergenic
961781424 3:129322995-129323017 CATTCCTCTGGTGTTTCCATAGG - Intergenic
967869471 3:194218162-194218184 CCTGCCTCAGGGGTTTCTGTAGG + Intergenic
968282084 3:197484815-197484837 ATTGCCTCAGGGATTTACATAGG + Intergenic
970340709 4:15103706-15103728 CTTGCCTCAGGGTTTTCTATTGG - Intergenic
972246457 4:37249853-37249875 CATGCCTTTGGGGTCTCCATAGG + Intronic
977756907 4:100682557-100682579 AGGGTCTCAGGGGTTTCTATAGG - Intronic
978108205 4:104930478-104930500 AGTCCCTCAGGGCTTTCCTTGGG - Intergenic
978884999 4:113758549-113758571 CGTGTCTGAGGTATTTCCATGGG - Intronic
980053988 4:128062198-128062220 CCTGCCTCCAGGGTTTCCAGCGG - Intronic
989609130 5:43274583-43274605 AGTGCCTCAAGGATTGCCATTGG + Intronic
995798788 5:115968995-115969017 CAAGGCTCAGTGGTTTCCATTGG - Intronic
1001481004 5:172089187-172089209 CCTGGCTCAGGGGCTTCCCTTGG + Intronic
1002348024 5:178561490-178561512 CTGGCCTCAGGGGTGCCCATAGG - Intronic
1002900664 6:1407324-1407346 TGGGCCTCAAGGGTTTCCATGGG - Intergenic
1006843620 6:37047984-37048006 TGTGGCTCAGGTGTTGCCATGGG + Intergenic
1013021565 6:106226032-106226054 AGAGCCTCAGGGTTTCCCATAGG - Intronic
1019561680 7:1662434-1662456 GGGGCCTCAGGGCTTTCCTTAGG - Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022599564 7:31744571-31744593 AGTGGCTCAAAGGTTTCCATAGG - Intergenic
1022841522 7:34168531-34168553 AGTGCATCAGTGGTTTCCAGGGG - Intergenic
1023172362 7:37402054-37402076 CGTGCCACAGGAGTCTTCATAGG - Intronic
1028582457 7:92422065-92422087 CTTGCCTTAGGGCTTTCCATGGG - Intergenic
1029418419 7:100458504-100458526 AGTGGCTCAGTGGTTTCCAGGGG - Intronic
1031883318 7:127220828-127220850 CTTGCCTCAGTGGTTACAATGGG - Intronic
1032728460 7:134614220-134614242 AGAGGCTCAGGGGTTTCCTTTGG - Intergenic
1033347424 7:140536385-140536407 CGTGTCTGAGAGGTTTCCAGTGG + Intronic
1040992396 8:53366740-53366762 CCTGCCTCAGGGCTTTGCACTGG - Intergenic
1048083014 8:131149095-131149117 CGTGTCTCTGGGGTTTTTATAGG + Intergenic
1049463968 8:142742730-142742752 TGTGCCTCTGGGGTTCACATAGG + Intergenic
1049809812 8:144561359-144561381 CGGGCCCCAGTGGTTTCCATCGG + Intronic
1049809849 8:144561563-144561585 CGGACCCCAGTGGTTTCCATCGG + Intronic
1049809860 8:144561603-144561625 CGCGCTCCAGTGGTTTCCATCGG + Intronic
1049809904 8:144561835-144561857 CGGGCTCCAGTGGTTTCCATTGG + Intronic
1049809971 8:144562199-144562221 CGGGCTCCAGTGGTTTCCATTGG + Intronic
1049809986 8:144562283-144562305 CGTGCTCCAGTGGTTTCCATCGG + Intronic
1049810009 8:144562403-144562425 CGCGCTCCAGTGGTTTCCATCGG + Intronic
1049810013 8:144562423-144562445 CGGACCCCAGTGGTTTCCATCGG + Intronic
1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG + Intronic
1051681996 9:19616939-19616961 CCTGCCCCAGGTTTTTCCATAGG - Intronic
1051715384 9:19977649-19977671 CCTGCTTCAGGGATTTTCATAGG + Intergenic
1054766539 9:69047113-69047135 CGTGCCTGACAGCTTTCCATGGG - Intronic
1059134891 9:111795385-111795407 CGTGCCTCAGGGGTCTGGCTAGG + Intergenic
1189724824 X:43957879-43957901 CGTGCCTCAGTGGTGTGCAAGGG - Intronic
1192194106 X:69017203-69017225 TGTCCCTCAGCTGTTTCCATTGG - Intergenic