ID: 902302903

View in Genome Browser
Species Human (GRCh38)
Location 1:15515284-15515306
Sequence CTGCATTTGCTTGAAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902302903_902302907 20 Left 902302903 1:15515284-15515306 CCTTACACTTCAAGCAAATGCAG 0: 1
1: 0
2: 0
3: 18
4: 163
Right 902302907 1:15515327-15515349 TGTCTGTTTCTCTGCTTTAGTGG 0: 1
1: 0
2: 2
3: 64
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902302903 Original CRISPR CTGCATTTGCTTGAAGTGTA AGG (reversed) Intronic
900034251 1:393711-393733 AAGCATTTGCTTAAAGTGTTGGG - Intergenic
900055086 1:623601-623623 AAGCATTTGCTTAAAGTGTTGGG - Intergenic
902170063 1:14602912-14602934 CTGCATTTGTTAGAAGGGGATGG + Intronic
902302903 1:15515284-15515306 CTGCATTTGCTTGAAGTGTAAGG - Intronic
902616365 1:17625616-17625638 CTGCATTTAGTTTAAGTGGAGGG + Intronic
903033555 1:20480215-20480237 CAGGATATGCTTGAAGTGTCCGG - Intergenic
910557043 1:88545641-88545663 CAGCATTTTCTGGATGTGTATGG - Intergenic
913162250 1:116154825-116154847 CTGAGTTTGGCTGAAGTGTAAGG - Intergenic
913558607 1:119995542-119995564 CTGCATTTGTTTGCATTTTAAGG - Intronic
918005368 1:180536844-180536866 TTCCATTTGCTAGAAGTGGACGG - Intergenic
918828692 1:189362714-189362736 CTCCAATTGCTTAAAGTTTATGG + Intergenic
919196690 1:194295809-194295831 GTGCATTTGCTTGATGTGTCTGG + Intergenic
919946443 1:202322548-202322570 CTCCAGTTGCTTGAAGTATAAGG + Intergenic
920215107 1:204357481-204357503 CTGAATGTGCTTTAAGTGTTTGG + Intronic
921426624 1:215009852-215009874 CTTCATTCTCTTGAAGTGTCTGG - Intronic
921667099 1:217885931-217885953 TTGCATTTACTTAAAGTCTATGG + Intergenic
921837158 1:219790131-219790153 CTGGATATGCTTCAAGTGGAAGG - Intronic
922256607 1:223897880-223897902 AAGCATTTGCTTAAAGTGTTGGG - Intergenic
924337813 1:243000739-243000761 AAGCATTTGCTTAAAGTGTTGGG - Intergenic
1062917260 10:1250476-1250498 ATGCATTTCCTTGAAGACTAAGG - Intronic
1064995168 10:21290410-21290432 CTGCATGTGCTTGGCTTGTAGGG - Intergenic
1066563021 10:36690969-36690991 CTGCTTTTGCTTGATAGGTAAGG - Intergenic
1068460225 10:57320739-57320761 TTGTATTTTCTTGAAGTCTATGG - Intergenic
1069104626 10:64368238-64368260 CTGCATTTGCCAGCACTGTAAGG + Intergenic
1070536885 10:77385753-77385775 GACCATTTGCTTGAAGTGTTTGG + Intronic
1072566181 10:96618569-96618591 TTACATTTTCTTGTAGTGTAAGG - Intronic
1073010488 10:100355421-100355443 GTCCTTTTGCTTGAAGTATAGGG + Intronic
1074549592 10:114430176-114430198 CTGCCTTTGCTGGGAGTGGAAGG - Intergenic
1074799495 10:116985030-116985052 CTGATTTTGCATGAAGTATATGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1080067680 11:28038421-28038443 ATACCTTTGCTTGGAGTGTACGG + Intronic
1080230401 11:30013398-30013420 CTGCATTTCCTTGATTTCTATGG - Exonic
1080284907 11:30599061-30599083 CAGCATTTGATTGAATTGAAAGG + Intergenic
1082970057 11:59011182-59011204 CTGCACATGCTTGCTGTGTAAGG + Intronic
1085548278 11:77341718-77341740 TTGCATTGGCTTGAACTGTGTGG + Intronic
1085662881 11:78385632-78385654 CTGCATATGCTACAAGTATAAGG - Intronic
1086876733 11:92105675-92105697 CAGCACTTGCTGGAAGTGCATGG - Intergenic
1093391811 12:18633030-18633052 CTGTCTTTACTTGAAGAGTAAGG - Intronic
1094535842 12:31322780-31322802 CTGCATTTGAATCATGTGTAAGG - Intronic
1096160473 12:49372619-49372641 CTGCCTTTGATTGAAATTTAGGG + Intronic
1097313710 12:58149932-58149954 CTGCATTATTTTGAAGTATACGG + Intergenic
1103968611 12:124655647-124655669 ACGCATATGCTTCAAGTGTATGG - Intergenic
1105236184 13:18555525-18555547 CTGCCTTGGCATAAAGTGTAGGG + Intergenic
1105792780 13:23819027-23819049 CTGCATATTCACGAAGTGTAAGG - Intronic
1107035975 13:35902763-35902785 CTGAAATTGCTAGAAGTGTTAGG - Intronic
1109008289 13:56907112-56907134 CTGCATTTGCCTGATCTGTCAGG - Intergenic
1109323995 13:60845749-60845771 CTGCATTTTCAATAAGTGTAGGG - Intergenic
1111082588 13:83331020-83331042 CTGCATTTTCTTGATGATTAGGG - Intergenic
1111421964 13:88023071-88023093 ATGTATTTGCATGAACTGTAAGG - Intergenic
1112220680 13:97486714-97486736 CTGCATTTTCTTGGAGGGAAAGG - Intergenic
1115056494 14:29134341-29134363 CTGAAGTTGCTTGTAGTTTAAGG + Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1117493689 14:56277876-56277898 CTCCATTTGCCTGAATTGGAAGG - Intronic
1118624645 14:67646747-67646769 ATGCATTTGGCTGAAGTTTAGGG + Intronic
1119037328 14:71241380-71241402 CTGCCTTTGCTGGAAGGGAAAGG + Intergenic
1119173466 14:72552258-72552280 CTGCATTTCCTGGAAATGAAGGG + Intronic
1120963028 14:90142166-90142188 TTGCATTTTCTAGAATTGTACGG + Intronic
1123673174 15:22681075-22681097 CTGCATTTGGGCGTAGTGTAAGG - Intergenic
1124210951 15:27764589-27764611 ATGCATTTGCTTGCTGTCTACGG + Intronic
1124325229 15:28754368-28754390 CTGCATTTGGGCGTAGTGTAAGG - Intergenic
1125426602 15:39555473-39555495 TTGCATTTGCTAGATGTGTATGG - Intergenic
1126648451 15:50898194-50898216 CTGCACCTTCTTAAAGTGTACGG + Intergenic
1126652998 15:50944966-50944988 CTTCATGTGCTTGTATTGTATGG - Intronic
1127298865 15:57633279-57633301 CTGTATTTGCCAGAAGTGTAAGG - Intronic
1128052230 15:64674583-64674605 CTGAATTTGCTTGAAGGAGAAGG - Exonic
1128541958 15:68542334-68542356 CTGTAATTACTTGAAATGTAGGG - Intergenic
1133080752 16:3317792-3317814 CTGCATATGCTACAAGTATATGG - Exonic
1135555612 16:23433796-23433818 CTGCCTTTCTTTGAAGTGAATGG - Intronic
1136363421 16:29796711-29796733 CTGCACTTGCTTGTAGAGCAGGG + Intronic
1142387490 16:89775188-89775210 CTGGTTTTTCTTGAAGTGTGTGG - Intronic
1143173204 17:4942070-4942092 TTGCATTAGCTTGCAGTATAGGG + Intronic
1146553961 17:33807092-33807114 CTGCATTTTCCTGGAGTGTAGGG - Intronic
1146566190 17:33915123-33915145 CTCCATTTCCTTGAAGGGTTAGG + Intronic
1150202538 17:63372276-63372298 TTGCATTTGCTAGCAGTGAACGG + Intronic
1151001565 17:70382594-70382616 CTGCATTTCCTTCTAGAGTAGGG + Intergenic
1156403590 18:36761940-36761962 CTGCATTTCTGTGATGTGTATGG - Intronic
1156847023 18:41677686-41677708 CTGCATTGTCTTCATGTGTATGG - Intergenic
1158752321 18:60276846-60276868 CTGAATCTGGTTGAAGAGTATGG + Intergenic
1162350880 19:10148694-10148716 CTGGAGTTGCTTTAAGTGTGTGG - Intronic
1163091763 19:15024920-15024942 CTCCATTTGCAAGAAGTTTAAGG + Intergenic
925615695 2:5742890-5742912 CTTCATTTGATGGAAGTTTATGG + Intergenic
929560638 2:42954333-42954355 CTGCTTTTGCTTAAAGTGACTGG - Intergenic
929754977 2:44756850-44756872 TTGCATTTGCTGGAAGTGCACGG - Intronic
929980972 2:46679860-46679882 CAGCATTTGGTTGGAGTATAAGG + Intergenic
930195472 2:48505704-48505726 CCACATTTGCTAGAAGTGTCAGG - Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
935315009 2:101824086-101824108 TTCCATTTGCTTGAATTGTAAGG + Intronic
935786020 2:106549634-106549656 TTGCATTTCCTTGAATTTTATGG - Intergenic
938513602 2:131979084-131979106 CTGCCTTGGCATAAAGTGTAGGG - Intergenic
938626291 2:133112927-133112949 ATCCATTTGCTAAAAGTGTAAGG - Intronic
939634380 2:144563380-144563402 GTGTACTTGCTTGAAATGTATGG + Intergenic
942735368 2:179104890-179104912 CTGCTTTTTCTTGAAGTAGAGGG + Exonic
943779999 2:191813051-191813073 CTATCTTTTCTTGAAGTGTAAGG + Intergenic
946959492 2:224968932-224968954 CTCTGTTTGGTTGAAGTGTAGGG - Intronic
947139328 2:227007149-227007171 CAGCATTTGCTTAATGTGTAAGG + Exonic
947374865 2:229485356-229485378 ATGCATTTCCTTCAAGTGTCTGG - Intronic
948736186 2:240007260-240007282 CTACATTTGATTCATGTGTAAGG - Intronic
1169138236 20:3210551-3210573 CTACATTTGCCTGTAGTGTAGGG + Intronic
1174266956 20:49338867-49338889 CTGCCTTGGCTTAAAGTGTGGGG + Intergenic
1176780181 21:13183810-13183832 CTGCCTTGGCATAAAGTGTAGGG + Intergenic
1177977835 21:27872828-27872850 CTGCCTTGGCATAAAGTGTAGGG + Intergenic
949333407 3:2947245-2947267 CTGTATTTTCTTGAAGTGTGTGG - Intronic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
950686445 3:14621872-14621894 CTGCACCTTCTTGAGGTGTAGGG + Intergenic
954287168 3:49627114-49627136 CAGCATTTGTTTGAAGTATTTGG - Intronic
957865974 3:86023697-86023719 TTGCATTTGTTTTAAGAGTAAGG - Intronic
960266554 3:115626856-115626878 CTGCCTTTCCTTGCAGTGTTGGG + Intronic
965011129 3:163093353-163093375 CTGCATTTTATTGCAGTGTTAGG + Intergenic
965101278 3:164301912-164301934 CTTCATTTCCTTTAAGTGAAAGG - Intergenic
965515299 3:169615134-169615156 CTGCTTTTCCTTTAAGTATAGGG - Intronic
965619427 3:170627696-170627718 TTGCATTTATTTTAAGTGTATGG + Intronic
965711472 3:171560054-171560076 CTGCATCTGGTTGAACTGAAGGG - Intergenic
965727393 3:171732695-171732717 ATGCATTTGTATGAATTGTATGG - Intronic
966626548 3:182022974-182022996 CTGAATTTGTTTGAGCTGTATGG - Intergenic
971632872 4:29017484-29017506 ATGCATTTGTATGAAGTTTAGGG + Intergenic
976390931 4:84502792-84502814 ATGCAGTTGCTTGAAGTGTCTGG + Intergenic
979239327 4:118434577-118434599 AAGCATTTGCTTAAAGTGTTGGG + Intergenic
981601607 4:146495231-146495253 CTGCTTTGGCTTGTAGTGGAAGG - Intronic
982186277 4:152803809-152803831 CTGCAGTTGTTGGAAGTGAAGGG + Intronic
983728280 4:170958186-170958208 ATGCAATGGCTAGAAGTGTATGG + Intergenic
984548514 4:181133876-181133898 CTGCTTTAGCTTGAAGTGAGAGG + Intergenic
986387821 5:7253204-7253226 CTGCATTTTCTTAATGAGTATGG + Intergenic
987372061 5:17202573-17202595 CTTCATGTGCTTGTATTGTACGG - Intronic
989483447 5:41960823-41960845 CTGTATTTTCTTGAAGTTTATGG + Intergenic
990631518 5:57675530-57675552 CTGAAATTGCTAGAAGTGGAGGG - Intergenic
994056531 5:95422879-95422901 CTGCTTTTGATTGAAGGGGAAGG - Intronic
995995886 5:118298918-118298940 GTGCATTTTCTTGAAAGGTAGGG - Intergenic
996945989 5:129068152-129068174 CTGGATGTCCTTGAAGTCTAAGG + Intergenic
997544385 5:134693499-134693521 CTGCATGTGCAAGAACTGTAAGG + Intronic
997699538 5:135887273-135887295 CTGCTTTTGCTTTTAGTCTATGG + Intronic
999169126 5:149578386-149578408 CTTCTTTTGCCTGAGGTGTATGG - Intronic
999234171 5:150080560-150080582 ATGCATTTTCTAGAAGTGCAGGG - Intronic
999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG + Intergenic
1000187138 5:158870134-158870156 TTGCCTTTGGTTGAAGTGGAGGG - Intronic
1000500527 5:162043512-162043534 TTGCATTTGCTTGCAATGCAGGG - Intergenic
1000611197 5:163377085-163377107 ATGCGTTTGCTTGAAGTGAGGGG - Intergenic
1001775247 5:174324037-174324059 CTGCATTTGTTTCAAGGGTGAGG + Intergenic
1002739569 5:181425157-181425179 AAGCATTTGCTTAAAGTGTTGGG + Intergenic
1004640463 6:17510288-17510310 CTGGAAATGGTTGAAGTGTATGG + Intronic
1006822046 6:36904713-36904735 TTGCATTTACTTTAAATGTATGG - Intronic
1011517820 6:88171317-88171339 CTGCATCTGTGTTAAGTGTATGG + Intergenic
1011640130 6:89411047-89411069 CTGCATTTTCTTAAGGTGTAAGG - Intronic
1013857860 6:114596066-114596088 CTGCATTTGCTGAAAATGTCAGG + Intergenic
1018246779 6:161831532-161831554 ATGCATTTCCTTGAAATGCATGG - Intronic
1019244686 6:170700744-170700766 AAGCATTTGCTTAAAGTGTTGGG + Intergenic
1024753690 7:52502543-52502565 CTGCACTTGCTTCATGTGAACGG + Intergenic
1024848936 7:53686525-53686547 CTGCACTTTCATGAACTGTAAGG - Intergenic
1026655882 7:72256136-72256158 ATGGAATTTCTTGAAGTGTAGGG - Intronic
1031417375 7:121509864-121509886 CAGCATTTGCTTGAAGGGGAGGG + Intergenic
1032257866 7:130311458-130311480 CTGCATCTGCCTGAGGTTTAAGG - Intronic
1033102008 7:138481890-138481912 CTGCAGTTGATTTATGTGTATGG + Intronic
1033424129 7:141227952-141227974 CAAGATTTCCTTGAAGTGTAGGG + Intronic
1035317357 7:158004730-158004752 ATGCATTTGCTTGAAGGAGATGG - Intronic
1035503441 8:107444-107466 AAGCATTTGCTTAAAGTGTTGGG - Intergenic
1036010489 8:4716241-4716263 TGGCATTGTCTTGAAGTGTAAGG - Intronic
1037606057 8:20437999-20438021 CTGCTTTTCCTTGAAGCCTATGG + Intergenic
1038766270 8:30431054-30431076 TTGCATTTCCTTGAATTGAATGG + Intronic
1039226043 8:35389377-35389399 CTGCATTTCTTTGAAGTTCAAGG + Intronic
1040775754 8:51041526-51041548 CTCAATTTGGTTGAAGTGTTGGG + Intergenic
1041819208 8:62010474-62010496 CTGCATTTGCTGGATGGGGATGG - Intergenic
1044107193 8:88224055-88224077 CTGCATTAGGTTGCATTGTAGGG + Intronic
1045576030 8:103421010-103421032 CTTCATGTGCTTGTATTGTACGG - Exonic
1046182291 8:110666748-110666770 ATGAATTTACTGGAAGTGTAAGG - Intergenic
1049275150 8:141716658-141716680 CTGCCTTTCCCTGAAGTGTCTGG + Intergenic
1051639307 9:19209933-19209955 CTACATTGGCATGAAGTGTGGGG - Intergenic
1052676725 9:31635390-31635412 CTGCTTTTGCTTTAACTGTTTGG + Intergenic
1054764345 9:69030959-69030981 CTGCATTTGCTTGGATTGATTGG - Intergenic
1056878771 9:90367574-90367596 CTTCATTTGCTAGAGGTGTTTGG + Intergenic
1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG + Intronic
1058832903 9:108835322-108835344 AGGCATTTGGTTGAATTGTAGGG + Intergenic
1060052625 9:120388087-120388109 TTGCACTTGCTGGAAGCGTAGGG - Intergenic
1203604875 Un_KI270748v1:49964-49986 AAGCATTTGCTTAAAGTGTTGGG + Intergenic
1185767550 X:2737798-2737820 CTGCATTTGTTTGATGAGTTTGG + Intronic
1186441148 X:9587660-9587682 CTGCAAATGCGTGAATTGTATGG - Intronic
1187196677 X:17092613-17092635 CTGCAATTGCTTGACGAATATGG + Intronic
1190014591 X:46816016-46816038 CTTTGTTTGTTTGAAGTGTAGGG - Intergenic
1191780082 X:64855437-64855459 CAGCTTTTTCTTGAAGGGTAAGG - Intergenic
1192037290 X:67577719-67577741 TTGCATTTCCTTGAAGAGTAAGG + Intronic
1192441020 X:71173816-71173838 ATGCATGTGCTTCAATTGTATGG + Intergenic
1202088488 Y:21163659-21163681 CTGCATTTACTTGCAGGGTATGG + Intergenic
1202387060 Y:24336360-24336382 AAGCATTTGCTTAAAGTGTTGGG + Intergenic
1202483726 Y:25333768-25333790 AAGCATTTGCTTAAAGTGTTGGG - Intergenic