ID: 902304366

View in Genome Browser
Species Human (GRCh38)
Location 1:15525139-15525161
Sequence AGTCGCGGAGGTGCCGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902304366_902304371 -7 Left 902304366 1:15525139-15525161 CCCAAGGCGGCACCTCCGCGACT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 902304371 1:15525155-15525177 CGCGACTCGCCCCGCCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 114
902304366_902304390 29 Left 902304366 1:15525139-15525161 CCCAAGGCGGCACCTCCGCGACT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 902304390 1:15525191-15525213 CCGCATCACCTCCCCACTCCGGG 0: 1
1: 1
2: 0
3: 19
4: 247
902304366_902304370 -8 Left 902304366 1:15525139-15525161 CCCAAGGCGGCACCTCCGCGACT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 902304370 1:15525154-15525176 CCGCGACTCGCCCCGCCCCCAGG 0: 1
1: 0
2: 4
3: 39
4: 290
902304366_902304388 28 Left 902304366 1:15525139-15525161 CCCAAGGCGGCACCTCCGCGACT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 902304388 1:15525190-15525212 CCCGCATCACCTCCCCACTCCGG 0: 1
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902304366 Original CRISPR AGTCGCGGAGGTGCCGCCTT GGG (reversed) Intronic