ID: 902304686

View in Genome Browser
Species Human (GRCh38)
Location 1:15526977-15526999
Sequence GACGCGCGGAACCGCGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902304675_902304686 20 Left 902304675 1:15526934-15526956 CCGGTTGGGCCGGTGTACTTTCC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG 0: 1
1: 0
2: 0
3: 9
4: 50
902304677_902304686 11 Left 902304677 1:15526943-15526965 CCGGTGTACTTTCCCGGTAACTC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG 0: 1
1: 0
2: 0
3: 9
4: 50
902304680_902304686 -2 Left 902304680 1:15526956-15526978 CCGGTAACTCCTTCCCGGCGTGA 0: 1
1: 0
2: 1
3: 4
4: 49
Right 902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG 0: 1
1: 0
2: 0
3: 9
4: 50
902304679_902304686 -1 Left 902304679 1:15526955-15526977 CCCGGTAACTCCTTCCCGGCGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG 0: 1
1: 0
2: 0
3: 9
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902304686 Original CRISPR GACGCGCGGAACCGCGGACG CGG Intronic
902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG + Intronic
908474136 1:64471404-64471426 GACGCGAGGACGCGAGGACGCGG - Intronic
924801573 1:247332175-247332197 GACGCCCGGAACGGCCGACCGGG + Intergenic
1065687638 10:28302584-28302606 GACGCGCGGGACTCCGGGCGGGG - Intronic
1077065041 11:637310-637332 GAACCGCAGCACCGCGGACGCGG + Exonic
1079035153 11:17014289-17014311 GGCGCGAGGACCCGGGGACGCGG - Intronic
1081173184 11:39893436-39893458 GACGTGCTGAACCGCTGACCGGG - Intergenic
1083800132 11:65041724-65041746 GGCGCGGGGACCCGCGGACCCGG + Exonic
1085400959 11:76235199-76235221 GACGCGCAGAACTGCAGACCAGG - Intergenic
1089596532 11:119584449-119584471 GCCGCGCGGAGCCGCGGAAGAGG - Intergenic
1092155429 12:6278893-6278915 CACGCGCGGAAGCGCAGCCGGGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1113120241 13:106917578-106917600 GACGCGCGGGGCCGGGGCCGGGG + Intergenic
1119330138 14:73787303-73787325 GGCGCGCGGAGCCGGGGGCGCGG - Intronic
1128161037 15:65422956-65422978 GAGGCGCGGCGCCGCGGGCGGGG + Exonic
1133188406 16:4116202-4116224 AGCGCGTGGAACCACGGACGCGG + Intergenic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1146126539 17:30235828-30235850 GGAGCGCGGAGCCGCGGCCGCGG - Exonic
1149685379 17:58531858-58531880 GACCCGCGGCACCGCAGCCGCGG - Intronic
1149993592 17:61396048-61396070 CACCCGCGGAACCGCGGCCCGGG + Intergenic
1158259054 18:55587946-55587968 GAGGCGCGGAGCCGCGTGCGGGG + Intronic
1159040668 18:63320353-63320375 GGCGCGCGGGGCCGCGGCCGGGG + Intergenic
1160968602 19:1757570-1757592 GCCGCGCGGCCCCGCGGCCGCGG + Intronic
1165227539 19:34365424-34365446 GGCGCCCGGAACCGGGCACGCGG + Intronic
926013058 2:9423497-9423519 GAGGCGCGGCCCGGCGGACGTGG - Intronic
931321342 2:61177309-61177331 GACGCGGGGACGCGCGGGCGGGG - Intergenic
948368914 2:237475265-237475287 GGCGCGCGGAACTGCGGCCGGGG + Intergenic
1170972202 20:21126286-21126308 GCCCCGGGGAACCTCGGACGGGG - Intronic
1174804521 20:53593968-53593990 GACACGGGGAGCCGCGGGCGAGG + Intronic
1176550194 21:8217424-8217446 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176569122 21:8400462-8400484 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176577036 21:8444694-8444716 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176733461 21:10521810-10521832 GACACGGGGAGCCGCGGGCGAGG - Intronic
1203255089 22_KI270733v1_random:133762-133784 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203263145 22_KI270733v1_random:178841-178863 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
949414693 3:3801047-3801069 CCCGCGCGGAAACGCGGACCAGG + Intronic
950940348 3:16884989-16885011 GACGCGGGGACGCGAGGACGCGG + Intronic
968434173 4:576368-576390 GGCGCGCGGGGCCGCGGGCGGGG - Intergenic
977055205 4:92182786-92182808 AATGGGCGGAACCGTGGACGCGG - Intergenic
981997561 4:150990964-150990986 GAGGCGCTGAACCTCGGACAGGG + Intronic
984698209 4:182800018-182800040 GACGCGCAGGTTCGCGGACGTGG + Exonic
985545353 5:506318-506340 GACGCGCGGAACCCGGGCTGCGG + Intronic
988577713 5:32443868-32443890 GACGCGCGGAGGCGGGGACTGGG + Intronic
1002405045 5:179023989-179024011 GACGCCCGGAGCCGGGGACTCGG - Intronic
1002927772 6:1614746-1614768 GGCGCGCGGTGCCGGGGACGGGG + Intergenic
1032092139 7:128916229-128916251 GACGCGGGGACGCGGGGACGCGG + Intergenic
1032092142 7:128916237-128916259 GACGCGGGGACGCGGGGACGCGG + Intergenic
1034435173 7:151059889-151059911 GGCGCGGGGAACCGCGGTCTTGG + Intronic
1035050857 7:155998478-155998500 GGCGCGTGGAACCGCGGGGGTGG + Intergenic
1035573325 8:688255-688277 GACGGGCGGAACTGGGGGCGGGG - Intronic
1041108961 8:54467507-54467529 GGCGCCGGGAACCCCGGACGTGG + Intergenic
1049676577 8:143891924-143891946 GAGGCCGGGAACCGCGGACTCGG + Intergenic
1056475303 9:86946824-86946846 GGCGCGGGGAGCGGCGGACGCGG + Exonic
1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG + Intergenic
1060727402 9:126015680-126015702 GAGGCGGGGGACCGGGGACGTGG + Intergenic
1203471487 Un_GL000220v1:116899-116921 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203479308 Un_GL000220v1:160871-160893 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1187900906 X:24025749-24025771 GACGCGGGGCGCCGCGGGCGCGG - Intronic
1190303975 X:49072187-49072209 GACGCCCGGTAACGGGGACGTGG + Intronic