ID: 902306920

View in Genome Browser
Species Human (GRCh38)
Location 1:15547895-15547917
Sequence CAGTGACATGAGAGGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902306920_902306926 -1 Left 902306920 1:15547895-15547917 CCCCACTACCTCTCATGTCACTG 0: 1
1: 0
2: 1
3: 18
4: 210
Right 902306926 1:15547917-15547939 GTGACATGAGACGGAGAGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 278
902306920_902306924 -10 Left 902306920 1:15547895-15547917 CCCCACTACCTCTCATGTCACTG 0: 1
1: 0
2: 1
3: 18
4: 210
Right 902306924 1:15547908-15547930 CATGTCACTGTGACATGAGACGG 0: 1
1: 2
2: 2
3: 16
4: 165
902306920_902306927 11 Left 902306920 1:15547895-15547917 CCCCACTACCTCTCATGTCACTG 0: 1
1: 0
2: 1
3: 18
4: 210
Right 902306927 1:15547929-15547951 GGAGAGGAAGGTGTTATCAGTGG 0: 1
1: 0
2: 2
3: 23
4: 282
902306920_902306925 -5 Left 902306920 1:15547895-15547917 CCCCACTACCTCTCATGTCACTG 0: 1
1: 0
2: 1
3: 18
4: 210
Right 902306925 1:15547913-15547935 CACTGTGACATGAGACGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 132
902306920_902306928 16 Left 902306920 1:15547895-15547917 CCCCACTACCTCTCATGTCACTG 0: 1
1: 0
2: 1
3: 18
4: 210
Right 902306928 1:15547934-15547956 GGAAGGTGTTATCAGTGGCATGG 0: 1
1: 0
2: 1
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902306920 Original CRISPR CAGTGACATGAGAGGTAGTG GGG (reversed) Intronic
900086342 1:899573-899595 CAGGGACATGAGAGAGAGTGGGG + Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902306920 1:15547895-15547917 CAGTGACATGAGAGGTAGTGGGG - Intronic
904943983 1:34185681-34185703 CAGTGAGAAGAGATGTGGTGAGG - Intronic
905562563 1:38939195-38939217 CAGTGTCTAGAGAGGTAGTTGGG + Intronic
907981259 1:59483801-59483823 CAGTGAAATGAGAAGTCCTGGGG + Intronic
909418155 1:75430890-75430912 AAGTTACAAGAGAGGTGGTGGGG - Intronic
910067815 1:83174512-83174534 GAGTGACATGAGGGGTGGGGTGG + Intergenic
910170951 1:84376458-84376480 TATTGACATGAAGGGTAGTGAGG - Intronic
910936972 1:92492158-92492180 CACAGACTTGAGAGGTAGTAAGG + Intergenic
911557996 1:99368967-99368989 CAGGGAGCTGAGAGGCAGTGAGG - Intergenic
914406777 1:147382809-147382831 CAGTGACCTGGGAGGGAGCGAGG - Intergenic
917393543 1:174566225-174566247 CAGTAACTGGAGAGGAAGTGAGG + Intronic
917641166 1:176984410-176984432 CAGTGCCTTGTAAGGTAGTGAGG + Intronic
918739218 1:188105903-188105925 AAGAGACATGGGAGGTGGTGTGG - Intergenic
918797284 1:188917487-188917509 CAGAGACTGGAGAGGTAGGGAGG + Intergenic
919994660 1:202737745-202737767 CAGTGACATGAGAAAAAGTGGGG + Intronic
921260345 1:213380839-213380861 CTGAGACATGAGAGGGAGAGAGG - Intergenic
921757215 1:218872717-218872739 CAGTGATATGAAAGGTAGCCAGG + Intergenic
923304771 1:232678382-232678404 CACTGACATGGGAGGTGGAGAGG - Intergenic
923843321 1:237698655-237698677 CAGTGAGATGGGAGGGAGAGGGG + Intronic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
1064183962 10:13144099-13144121 CTGTCACCTGAGAGGGAGTGGGG + Intergenic
1065050972 10:21790784-21790806 CAATGACATGAGAGGAAGAAAGG + Intronic
1065609717 10:27460934-27460956 CAGTGAGATGAGGGGTGGGGTGG + Intergenic
1066178655 10:32938513-32938535 CAGTGACATTTAAAGTAGTGTGG - Intronic
1070639918 10:78160835-78160857 CAGTGACATGGGAGGGATAGTGG - Intergenic
1071223523 10:83498232-83498254 CAGTGCCATGAGAAGTAGAGGGG + Intergenic
1075641292 10:124066426-124066448 CAGTTACATAAGAGGAGGTGTGG - Intronic
1078948120 11:16094810-16094832 CTTTGACATAAGAGGTAGAGAGG - Intronic
1080046043 11:27809449-27809471 CAGTGATCTGACAGGAAGTGGGG + Intergenic
1083700997 11:64477613-64477635 CAGTGAGAGGAGAGGATGTGAGG + Intergenic
1085101009 11:73799929-73799951 CAGTTTTTTGAGAGGTAGTGTGG + Intronic
1085707250 11:78797674-78797696 CAGTTGCCTGGGAGGTAGTGTGG - Intronic
1085851540 11:80125837-80125859 AAGTGACATAAGAGGTGGTTTGG + Intergenic
1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG + Intergenic
1087470829 11:98572194-98572216 TAGTGTCATAAGAGGTAGTTTGG + Intergenic
1089423167 11:118347171-118347193 AAAGGACAAGAGAGGTAGTGTGG - Intronic
1090167638 11:124567800-124567822 TAGTCACATGAGAGGAGGTGTGG + Intergenic
1090912451 11:131133395-131133417 CAGTGCCAGGAGAGGTGGTTTGG - Intergenic
1091209426 11:133843765-133843787 CAGAGCCACGAGAGGCAGTGGGG + Intronic
1093284370 12:17240142-17240164 CTGAGATATGAGAGGTAGTCAGG - Intergenic
1093699022 12:22196855-22196877 TTGTGACTAGAGAGGTAGTGTGG - Exonic
1096122036 12:49094551-49094573 AACTGACAGGAGAGTTAGTGAGG - Exonic
1099015949 12:77344407-77344429 CAGGGACAGGGGAGGTAATGAGG - Intergenic
1099117453 12:78645227-78645249 GAGTGAGAAGAGTGGTAGTGCGG - Intergenic
1100270587 12:93020808-93020830 CAGTGAAATGTGAGGGAGTGGGG - Intergenic
1102299992 12:111764670-111764692 CTCAGACATGACAGGTAGTGGGG + Intronic
1103401027 12:120642615-120642637 CAGAGCCGTGAGAGTTAGTGAGG + Intronic
1106635870 13:31527885-31527907 CAATGACATGAGAGTTTGTTAGG - Intergenic
1108178659 13:47819799-47819821 CAGTGACATTAGTGGCAGAGTGG + Intergenic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1108719392 13:53115534-53115556 AAGTGACCTGAGAGGCAGCGAGG + Intergenic
1111043325 13:82780703-82780725 GAGTGACATGAGAGGTATGAGGG + Intergenic
1112375917 13:98840643-98840665 CCATGACATCAGAGGTAATGTGG + Intronic
1112926659 13:104683676-104683698 CAGGGACAAGAGAGTTAGTGAGG - Intergenic
1113508801 13:110835118-110835140 AAGTGAAAGGAGAGGAAGTGTGG - Intergenic
1113734721 13:112670423-112670445 CAGTGACATGAGAGTGGATGGGG + Intronic
1118130008 14:62952332-62952354 CAGTGACATGAGATGTTGGAAGG + Intronic
1119578406 14:75750929-75750951 CAGTGAGATGAGATGAAGTGAGG + Intronic
1119947450 14:78709939-78709961 CAGTGACATGAGAGTTGCTCTGG - Intronic
1120595695 14:86432464-86432486 CAGTGAAGTGGGATGTAGTGAGG - Intergenic
1121008831 14:90508014-90508036 CAGTGGCTTGGGAGGTATTGTGG - Intergenic
1122112800 14:99513788-99513810 CAGTGGCATGAGCGGATGTGGGG + Exonic
1122157299 14:99757394-99757416 CAGTGACAGCACAGGTTGTGTGG + Intronic
1125434878 15:39634016-39634038 TAGTGACATGAGGGATGGTGGGG - Intronic
1126503233 15:49371042-49371064 CAGTGACAAGACATGTTGTGAGG + Intronic
1127263929 15:57346265-57346287 CAGCCACATCAGAGGTGGTGGGG - Intergenic
1127440554 15:59002739-59002761 CAATGACATCAGAAGTAGTCAGG - Intronic
1128084380 15:64875708-64875730 CAGTGGCATTAGGGGTAGAGTGG + Intronic
1128749867 15:70141148-70141170 CAGTGACCTTAGAGGGAGAGGGG - Intergenic
1128797205 15:70474647-70474669 TAGTGACTTGAGAGGGAGGGAGG + Intergenic
1129871951 15:78946182-78946204 CAGGGACATGAGGGGGTGTGAGG - Intronic
1130937464 15:88482441-88482463 CATTCACAGGAGAGGAAGTGAGG + Intergenic
1135406955 16:22205701-22205723 CTGTGGCATGAGTGGTAGAGTGG - Intergenic
1137466961 16:48718497-48718519 CAGTGCCCTGAGAGGGAGTCAGG - Intergenic
1137670625 16:50276206-50276228 CAGGGCCATGAGTGGCAGTGTGG - Intronic
1138158486 16:54729317-54729339 GAGTGAGATGGGAAGTAGTGTGG - Intergenic
1138266883 16:55665842-55665864 CAGTGGGATGGGAGGCAGTGTGG + Intronic
1139144564 16:64308140-64308162 CAGTGCCATGATCGGAAGTGTGG + Intergenic
1139508669 16:67413573-67413595 CAGTGACTTGAGAGGTCTTTGGG - Intronic
1140195228 16:72849524-72849546 TAGTGCCATGAGTGGCAGTGTGG - Intronic
1142887899 17:2924597-2924619 CAGTGGCATTAGAGGTGGAGGGG + Intronic
1142930186 17:3277958-3277980 CACTGACCTGAGAGGTAATGGGG - Exonic
1143371186 17:6440609-6440631 CTGTGACATGACAGGCACTGGGG + Intergenic
1143518206 17:7430404-7430426 CAGGGACAGGAGTGGTAGTCAGG - Intergenic
1143612325 17:8025905-8025927 CAATGAGCTGTGAGGTAGTGTGG - Intergenic
1149429651 17:56587496-56587518 CAGTGGGATGAGAGGATGTGGGG + Intergenic
1150291873 17:63987100-63987122 CAGGGACAGTAGAGGTGGTGGGG - Intergenic
1152473921 17:80505292-80505314 CAGTGTCTGGAGAGGCAGTGAGG + Intergenic
1152978685 18:251256-251278 AAGAAACATTAGAGGTAGTGTGG - Intronic
1153711580 18:7805263-7805285 CAGAGACATCAGAGATAATGAGG - Intronic
1159703505 18:71659003-71659025 CATAGACATGGGAGGTAATGTGG - Intergenic
1161480271 19:4506904-4506926 CAGTGACATGAGGTGTCCTGAGG + Intronic
1163374633 19:16922656-16922678 CAGGGACCTCAGATGTAGTGTGG - Intronic
1163579187 19:18128264-18128286 CAGTGTCATGAGAGCTGGTCAGG + Intronic
1165747411 19:38238201-38238223 CATTGACAGGAGAGAGAGTGAGG + Intergenic
1167902818 19:52634911-52634933 AAGTGAGATGAGAGGGACTGAGG + Intronic
1167952000 19:53035402-53035424 AAGTGAGATGAGAGGGACTGAGG + Intergenic
1167966699 19:53153579-53153601 AAGTGAGATGAGAGGGACTGAGG + Intronic
1167969903 19:53182732-53182754 AAGTGAGATGAGAGGGACTGAGG + Intronic
1167973082 19:53201147-53201169 AAGTGAAATGAGAGGGACTGAGG - Intergenic
1167992532 19:53372423-53372445 AAGTGAGATGAGAGGGACTGAGG - Intronic
925789509 2:7469705-7469727 CAGTGACATGATTGGGTGTGAGG + Intergenic
928604859 2:32936270-32936292 CAGTGGCATGGGGGGTAGGGGGG - Intergenic
930104783 2:47631326-47631348 AAAGGACATGAGAGGTGGTGAGG + Intergenic
931090792 2:58883786-58883808 CAGAGAAATGAGAGAGAGTGGGG + Intergenic
931187575 2:59968439-59968461 CAGTGACTTGAGAAAAAGTGTGG - Intergenic
931193027 2:60023888-60023910 CAGTGAAATCAGAGGAGGTGAGG - Intergenic
935290865 2:101610020-101610042 CAGTCACATCTGAGGTACTGTGG - Intergenic
936084274 2:109455907-109455929 CACTGGCATGAGAGGTAGAAGGG + Intronic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
938786356 2:134633323-134633345 CAGAGACATGAGCGGTTGGGAGG + Intronic
940252606 2:151695963-151695985 CAGTGACAAGAGAGACAGGGCGG - Intronic
947109017 2:226698714-226698736 AAGTGACAAAAGAGGGAGTGGGG - Intergenic
947346221 2:229191787-229191809 CAGGCTCATGAGAGATAGTGAGG + Intronic
948107472 2:235427238-235427260 CAGAGACAGGGGAGGCAGTGCGG - Intergenic
1171312791 20:24159181-24159203 CAGTGAGATGTGTGGTAGAGAGG + Intergenic
1172832647 20:37849077-37849099 CAGAGATATGAGAGGTAAAGCGG - Intronic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1173637208 20:44570791-44570813 AAGTGACATGATAGGTAGATGGG + Intronic
1175158371 20:56989797-56989819 CAGAAAAATGAGAGTTAGTGAGG + Intergenic
1175759090 20:61549305-61549327 GGGTGACATGGGAGGGAGTGAGG - Intronic
1177909116 21:27008964-27008986 CAGGGACATGAGCGGGACTGGGG - Intergenic
1178563643 21:33662744-33662766 GTGTGACATGAGGGGCAGTGTGG - Intronic
1181275693 22:21686431-21686453 CAGTGCCATGGGAGGCAGTTGGG - Intronic
1182408438 22:30159112-30159134 CAGTGAAATGAGAGACAATGCGG + Intronic
1183225147 22:36544730-36544752 CAGAGACAGGGGAGGTAGAGTGG - Intergenic
1183759653 22:39804701-39804723 CAGTGACATGTGGAGTTGTGGGG - Intronic
950126547 3:10513390-10513412 AAGGGACAGGAGAGGCAGTGGGG + Intronic
950920415 3:16688626-16688648 CAGGGAAATTAGAGGTTGTGGGG - Intergenic
951843917 3:27064949-27064971 CAGTGACATGTGAGGTTAAGTGG - Intergenic
953949216 3:47175486-47175508 GAGGGACATGAGATTTAGTGGGG + Intergenic
955487152 3:59446834-59446856 CAGGGAGATGGGAGGTAGGGAGG - Intergenic
957711067 3:83860096-83860118 CAGTGACCTGAGATGTATTTAGG + Intergenic
959633624 3:108536678-108536700 CAGTGACAAAAGAGTAAGTGGGG + Intergenic
960315038 3:116166092-116166114 CAATGACATGACAGGTATTATGG - Intronic
960529115 3:118743373-118743395 CAGTAATAGGAGAGGTAATGAGG - Intergenic
965142542 3:164857841-164857863 AAGCTACATGAGAGCTAGTGGGG + Intergenic
965886816 3:173456269-173456291 CAGTGACAAGACAGGAGGTGAGG + Intronic
966579496 3:181544437-181544459 CAGTGCCATGAAACATAGTGAGG + Intergenic
967778043 3:193404975-193404997 GAGAGGCATGAGAGGTAGTGTGG - Intronic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
971947109 4:33294995-33295017 CAGTGAGCTGAGAGGGAGGGAGG - Intergenic
972260908 4:37407554-37407576 CAGTGACGTGAGAGGGAGTGGGG + Intronic
972342793 4:38167051-38167073 CAGTGACAGGAAAGGAAGTGAGG + Intergenic
975642042 4:76510753-76510775 AATTGACCAGAGAGGTAGTGTGG + Intronic
975920796 4:79384210-79384232 CAGTAACATGAGTGGGACTGGGG + Intergenic
980063336 4:128155511-128155533 CAGCAACATGAGTGGCAGTGAGG + Intronic
980210063 4:129775357-129775379 CAGTGCCATGGCAGGTAGAGAGG + Intergenic
981214131 4:142143305-142143327 AAGGGAGAGGAGAGGTAGTGTGG - Intronic
982849897 4:160299864-160299886 CACTGAGATGAGAAGAAGTGTGG - Intergenic
983232471 4:165143067-165143089 CAGTTACAAGGGAGGTAATGTGG + Intronic
986203929 5:5605363-5605385 CAGTGACATGTGTGGGAGAGGGG - Intergenic
986336558 5:6759795-6759817 CAGTGACATGGCAGGATGTGTGG - Intergenic
986772918 5:10989631-10989653 CAGTGACATGAGAGGTGCCTTGG - Intronic
986837594 5:11657115-11657137 CTGTGACATGAAAAGTGGTGAGG - Intronic
986978149 5:13416356-13416378 CACTCACTTCAGAGGTAGTGAGG - Intergenic
987828587 5:23065022-23065044 CAGTGAAAAAAGAGGTTGTGAGG - Intergenic
987830421 5:23088023-23088045 CAGAGAGATGAGAGACAGTGGGG + Intergenic
989433249 5:41380184-41380206 CAGGGACTTGGGAGGAAGTGGGG - Intronic
992023410 5:72647646-72647668 CAGTGAGATGAGGGGGAGGGAGG + Intergenic
992413715 5:76532874-76532896 CTGGAACATGAGAGGCAGTGTGG - Intronic
992658304 5:78932248-78932270 CAGTCACATGGGAGGTAAAGCGG - Intronic
996755628 5:126932182-126932204 CATTAACATGAGAGGCAGAGTGG + Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000265630 5:159633570-159633592 CAGTGACACGAGAGATACTGTGG - Intergenic
1002467454 5:179414655-179414677 CAGTGACTTCAGAGTTAATGGGG + Intergenic
1003285793 6:4732876-4732898 CAGGGACAACAGAGGTGGTGAGG + Intronic
1007829314 6:44626511-44626533 CAATGACAGGAGATGAAGTGTGG + Intergenic
1008015743 6:46517460-46517482 CTGTCACATGAGAGGTACAGTGG - Intergenic
1008055053 6:46937284-46937306 CAGTGACATGGGAGAAAGAGGGG - Intronic
1008076264 6:47149142-47149164 CACTGTCAAGATAGGTAGTGTGG - Intergenic
1008486003 6:52036492-52036514 CAGATACAAGAGAGGCAGTGAGG + Intronic
1008867308 6:56228285-56228307 CAGTCAAATGAGAGGCAGTAAGG + Intronic
1010739507 6:79483419-79483441 CAGTGACATAAGAAGGAGAGGGG - Intergenic
1012437333 6:99228023-99228045 CACTGTCATGAGAGGTAAGGAGG + Intergenic
1013078403 6:106791073-106791095 CAGTGACATGGGGGATAGGGTGG - Intergenic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1018715184 6:166526894-166526916 GAGTGACTTGAGCAGTAGTGAGG - Intronic
1018756269 6:166852472-166852494 CAGAGACATGAGAGGCAACGTGG + Intronic
1018903110 6:168060937-168060959 GAGTGGCGTGAGAGGCAGTGGGG + Exonic
1019280305 7:196449-196471 CAGTGCTTGGAGAGGTAGTGAGG + Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1021404312 7:20246477-20246499 CAGGGACATGTAAGGTAGGGAGG + Intergenic
1021626640 7:22600050-22600072 CAGTGAGGAGAGAGGGAGTGGGG + Intronic
1023006119 7:35869197-35869219 CAGGGATATGAGAGGTAGAGAGG + Intronic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023533017 7:41178980-41179002 CAGTGACATGATAATTTGTGTGG - Intergenic
1027276281 7:76560249-76560271 GAGTGACATGAGGGGTGGGGTGG - Intergenic
1031120212 7:117713615-117713637 TAGTGACATGCCAGTTAGTGAGG - Intronic
1033164558 7:139028605-139028627 CAGTGACATGAAAGTGAGTCTGG - Intronic
1036234038 8:7022755-7022777 CAGAGCGCTGAGAGGTAGTGAGG + Intergenic
1036993764 8:13630776-13630798 CAGTGGAGTGACAGGTAGTGAGG + Intergenic
1037443600 8:18942516-18942538 CAGTTACATTTGAGGTACTGGGG - Intronic
1038471392 8:27825999-27826021 CAATGACATGAGTGGATGTGGGG - Intronic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1041374805 8:57202839-57202861 CTGTGACATGAGAGTGACTGTGG + Intergenic
1044236697 8:89839552-89839574 CAGAGACATGGGTGGGAGTGAGG - Intergenic
1046519069 8:115301496-115301518 CAATAAAATGAGAGGTAGAGAGG + Intergenic
1053590592 9:39510652-39510674 CAGTGGAATGATAGGCAGTGGGG + Intergenic
1053848453 9:42266041-42266063 CAGTGGAATGATAGGCAGTGGGG + Intergenic
1054575710 9:66854637-66854659 CAGTGGAATGATAGGCAGTGGGG - Intergenic
1057222046 9:93262706-93262728 CAGAGCTGTGAGAGGTAGTGTGG + Exonic
1057774197 9:97992507-97992529 CTGTGAGCTGAGAGGCAGTGTGG + Intronic
1058194566 9:101956700-101956722 CAATGAAGTGGGAGGTAGTGGGG + Intergenic
1059653275 9:116334754-116334776 CAGTGACATGAAAGGGTCTGGGG + Intronic
1060279982 9:122209281-122209303 CAGTGAGATGATGGGAAGTGGGG + Intronic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060891505 9:127192194-127192216 CAGTGACAAGAGAGGTGGGCAGG + Intronic
1061415067 9:130443139-130443161 CAGTGACATGAGGGACAGTGAGG - Intergenic
1061779736 9:132988510-132988532 CAGTGAGTTGAGAGGGAGTGCGG - Intronic
1062239499 9:135528066-135528088 CTGTGACATGAGGCATAGTGGGG - Intergenic
1062239515 9:135528164-135528186 CTGTGACATGAGGCATAGTGGGG - Intergenic
1062239531 9:135528262-135528284 CTGTGACATGAGGCATAGTGGGG - Intergenic
1188712343 X:33415974-33415996 CTGTGTCCTCAGAGGTAGTGTGG + Intergenic
1189597351 X:42583553-42583575 CAATGACATGTGAGGCAATGTGG - Intergenic
1192630718 X:72776245-72776267 CAGTGACATGAGAGTAAGAGAGG + Intergenic
1192650992 X:72944559-72944581 CAGTGACATGAGAGTAAGAGAGG - Intergenic
1193011752 X:76683455-76683477 CAGTAACATGAGTAGTACTGGGG - Intergenic
1195152073 X:102082252-102082274 CAGGGACAAGATAGGGAGTGGGG - Intergenic
1195528637 X:105924872-105924894 CAGTGAAAGAAGAGGCAGTGAGG + Exonic
1197174526 X:123471189-123471211 CAGTCACTTGAGAGAAAGTGAGG - Intronic
1197253579 X:124239500-124239522 CAGTGAAGTGGGAGGTAGAGAGG - Intronic
1197767985 X:130071378-130071400 CAGTGACAGGTGAGGTACTTCGG + Exonic
1199601371 X:149543342-149543364 GAGTGCCCTGAGAGGAAGTGTGG + Intronic
1199649006 X:149936142-149936164 GAGTGCCCTGAGAGGAAGTGTGG - Intronic
1201767540 Y:17586636-17586658 CAGTGAAATGAGAGATGGTTTGG - Intergenic
1201834013 Y:18319349-18319371 CAGTGAAATGAGAGATGGTTTGG + Intergenic