ID: 902314242

View in Genome Browser
Species Human (GRCh38)
Location 1:15605779-15605801
Sequence CAGATGAAACTGAAGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902314242_902314244 2 Left 902314242 1:15605779-15605801 CCTCTATCCTTCAGTTTCATCTG No data
Right 902314244 1:15605804-15605826 AAATGAAGATAATACCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902314242 Original CRISPR CAGATGAAACTGAAGGATAG AGG (reversed) Intergenic
No off target data available for this crispr