ID: 902318306

View in Genome Browser
Species Human (GRCh38)
Location 1:15640856-15640878
Sequence GAGGCGAGGTCATTGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902318301_902318306 17 Left 902318301 1:15640816-15640838 CCTGTGAGTAATATGAGCAGGAA 0: 1
1: 1
2: 0
3: 6
4: 168
Right 902318306 1:15640856-15640878 GAGGCGAGGTCATTGCAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902318306 Original CRISPR GAGGCGAGGTCATTGCAAAA GGG Intronic
900768623 1:4522312-4522334 GAGTTGAGTTCCTTGCAAAAGGG + Intergenic
902318306 1:15640856-15640878 GAGGCGAGGTCATTGCAAAAGGG + Intronic
906257392 1:44360653-44360675 GAGGCGAGGACATTGGGAATTGG - Intergenic
911238875 1:95442818-95442840 TAGGCTAGGTCATTCCTAAAAGG + Intergenic
915660239 1:157399553-157399575 GTGGGGAAGTTATTGCAAAAAGG - Intergenic
917316220 1:173728140-173728162 GAGACAAGGCCATTGCATAATGG + Intronic
917757955 1:178121917-178121939 GAGGTGATGTCAGTGAAAAATGG - Intronic
919600251 1:199613527-199613549 GAGGCGAGGGCAGTGAAAGAAGG - Intergenic
1063095898 10:2908699-2908721 ATGGCGAGGTCAATGCAGAAAGG + Intergenic
1066046937 10:31603025-31603047 GAGGCAAGGTCAGAGGAAAAGGG + Intergenic
1067172349 10:43918500-43918522 GAGACAAGGCCATTGCATAATGG - Intergenic
1072318170 10:94223362-94223384 GAGGTGAGGTGATTGGAGAATGG + Intronic
1076561992 10:131373016-131373038 AAGGCAAGGCCCTTGCAAAAGGG - Intergenic
1077450230 11:2637926-2637948 GAGACAAGGTCATTACATAATGG - Intronic
1078988138 11:16614230-16614252 GAGCCGAGGTCACCGCAGAAGGG - Intronic
1079477180 11:20843232-20843254 GTGGGGAGGTCAAAGCAAAATGG - Intronic
1080714400 11:34784768-34784790 GAGGTGTGGTAATTGCTAAAGGG + Intergenic
1083185512 11:61015676-61015698 GAGTCGAGGGCATGGCAAAGTGG - Intronic
1084735525 11:71102981-71103003 GAGGTGAGGTCACAGCAAGAAGG - Intronic
1088466587 11:110146581-110146603 GAAGCTAGGACATTGGAAAAAGG - Intronic
1088537524 11:110877265-110877287 GGGGAGAGGTAATTGCCAAAGGG - Intergenic
1089341283 11:117759511-117759533 GAGTCGAGGTCATAGCCAATAGG - Intronic
1089769346 11:120791988-120792010 CAGGCGAGGTCATTGCATTGGGG + Intronic
1091920900 12:4303736-4303758 GAGGCGAGCTCCTTGAAGAAGGG + Exonic
1107032674 13:35869369-35869391 GAGGCCAGGTCATTGCAAGGAGG + Intronic
1108448131 13:50529475-50529497 GAGGGGAGGTCCTTACAACATGG - Intronic
1110353497 13:74538620-74538642 GAGACAAGGTCATTACATAATGG + Intergenic
1112862575 13:103850766-103850788 GAGATGAGCTCATAGCAAAATGG - Intergenic
1117211117 14:53501209-53501231 GAGGGTAGGACATTACAAAAAGG + Intergenic
1119886267 14:78145537-78145559 GAGGCAAGGTTCTTGCAATAAGG - Intergenic
1121314683 14:92953843-92953865 GAGTCCAGGACATTTCAAAAGGG + Intronic
1121866898 14:97370881-97370903 TTGGCAAGGTCATTGGAAAAAGG - Intergenic
1125122862 15:36183446-36183468 GAGGCTAAGTCATTAAAAAAAGG + Intergenic
1127762335 15:62151545-62151567 GAGTCAAGGTCATTGGCAAAGGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1150026071 17:61675414-61675436 GAGACAAGGTCATTACATAATGG + Intergenic
1151247911 17:72809506-72809528 GAGTCCAGGTGATTGCAAAAGGG - Intronic
1151413093 17:73943936-73943958 GAGGCAAGTTCTTTGCAGAAGGG + Intergenic
1155657651 18:28210314-28210336 GAGGGGAGGTAATTCCCAAATGG + Intergenic
1156044728 18:32864805-32864827 GAAGTGAGGTCCTTGAAAAAAGG - Intergenic
1156140222 18:34099690-34099712 CAGGGGAGGTCAATGCAAAAGGG - Intronic
1159085205 18:63782363-63782385 CAAGGGAGGCCATTGCAAAATGG - Exonic
1160504714 18:79420518-79420540 CAGGCGAGGTCACTGCAAAGAGG + Intronic
1166163477 19:40969221-40969243 GAGACAAGGCCATTACAAAATGG - Intergenic
1166502736 19:43353598-43353620 GAGGGGAGGGCCTTGCAAAATGG - Intergenic
1167518355 19:49936948-49936970 AAGGTGAGGACATTGCAATAGGG - Intronic
926132172 2:10310537-10310559 GAGGCTAGGACAATCCAAAATGG - Intronic
927217585 2:20676791-20676813 GATGGGTGGTCATTGAAAAATGG + Intergenic
935182091 2:100700584-100700606 GAGAAGAGGCCATTGAAAAATGG - Intergenic
935839885 2:107097820-107097842 AAGGGGAGGACATTGCAAAAAGG + Intergenic
939167193 2:138652638-138652660 GAGTCCAGTTCATTGAAAAATGG + Intergenic
942018124 2:171838325-171838347 GAGCTGAGGTCATGGGAAAATGG - Intronic
944304452 2:198163792-198163814 CAGGGAAGGTCATTACAAAAAGG - Intronic
945306550 2:208264972-208264994 GAGGCAGAGTCATTGGAAAAGGG + Intronic
1174924245 20:54740058-54740080 GAGATGTAGTCATTGCAAAAGGG - Intergenic
1176451224 21:6863206-6863228 GAGACAAGGTCATTACATAATGG + Intergenic
1176829393 21:13728257-13728279 GAGACAAGGTCATTACATAATGG + Intergenic
1178302692 21:31466163-31466185 GTGTCAAGGTCATTGCAATAGGG + Intronic
1181335118 22:22123431-22123453 CAGGAGAAGGCATTGCAAAAAGG - Intergenic
951752241 3:26049787-26049809 GTGGCGAACTCATTGCAAAATGG + Intergenic
955036243 3:55270655-55270677 CAGGAGAGGTGAGTGCAAAAAGG + Intergenic
958204575 3:90373211-90373233 GAGGCAAGGCCATTACATAATGG + Intergenic
961976394 3:131029216-131029238 GAGAAGAGGGCATTACAAAAAGG + Intronic
962766006 3:138563099-138563121 GAGACAAGGGCATTGCATAATGG + Intronic
971076546 4:23155768-23155790 GAGGGGAGGTTATAGGAAAAAGG - Intergenic
971318159 4:25584429-25584451 GAGAAGAGGTCATGGCAGAAGGG + Intergenic
971540848 4:27814348-27814370 CAGGCTAGGTCATTGAAAGAGGG - Intergenic
974024442 4:56720846-56720868 GAGGTGAGGTCAGTCCAAACAGG + Intergenic
974873079 4:67667819-67667841 AATGCGAAGTCATTGCCAAAAGG - Intronic
984701318 4:182820417-182820439 GAGGAGAGGGCAGAGCAAAATGG - Intergenic
985259518 4:188102208-188102230 GAGACCAGGACATTGGAAAAGGG + Intronic
987213640 5:15710192-15710214 GAGGCAATGTCCTTGCAATACGG + Intronic
988187616 5:27887617-27887639 GAGACAAGGTCATTACATAATGG - Intergenic
992231855 5:74671547-74671569 GAAGCGGGGAGATTGCAAAAGGG + Intronic
997373834 5:133383055-133383077 ATGGAGAGGTCATTTCAAAATGG - Intronic
1005415426 6:25594984-25595006 GGGGCTAAGTCATTGCTAAATGG + Intronic
1006374389 6:33663804-33663826 GAGGCGATGTCATTGCCATGAGG - Exonic
1006801385 6:36761938-36761960 GTGGGGAGGGAATTGCAAAAGGG + Intronic
1013383568 6:109601823-109601845 GAGACAAGGTCATTGCATAATGG - Intronic
1014600853 6:123410348-123410370 GATGCTAGGTGCTTGCAAAAGGG - Intronic
1015509478 6:134023691-134023713 GAGGTGAGGTCATTTCATTAAGG - Intronic
1016062259 6:139643136-139643158 GAGGAAAGGTCATTGAAAACAGG - Intergenic
1017730489 6:157311445-157311467 GAGGCCAGGTGATTGCACACTGG - Intronic
1017730557 6:157311955-157311977 GAGGCCAGGTGATTGCACACTGG - Intronic
1017730609 6:157312329-157312351 GAGGCTAGGTGATTGCACACTGG - Intronic
1024998267 7:55292662-55292684 GAGGGGAGGGCATTACATAATGG - Intergenic
1027860921 7:83579612-83579634 AATGCTAGGTCAATGCAAAATGG + Intronic
1027894389 7:84022849-84022871 GTGCTGAGGACATTGCAAAATGG - Intronic
1028793931 7:94883225-94883247 AAGGTCAGGACATTGCAAAAGGG - Intergenic
1035124888 7:156601376-156601398 TAGGTGAGGACAGTGCAAAATGG + Intergenic
1036614447 8:10377851-10377873 GAGGCGAGATCTGTGCAAAGTGG - Intronic
1039424162 8:37471868-37471890 GAGAGGATGACATTGCAAAATGG - Intergenic
1040525937 8:48225386-48225408 GAGGGCAGCTCCTTGCAAAAGGG - Intergenic
1042369384 8:67973552-67973574 GAAGAGATGTCATTACAAAAAGG - Intronic
1045358550 8:101411345-101411367 GAGGCCAGGTCATGGCAGGAAGG + Intergenic
1050232371 9:3540492-3540514 GAGACAAGGCCATTACAAAATGG - Intergenic
1051619000 9:19033052-19033074 GACGACAGGACATTGCAAAAGGG - Exonic
1060666348 9:125434236-125434258 GAGGCCAGGCCATTGGAAAGTGG - Intergenic
1203517957 Un_GL000213v1:21311-21333 GAGACAAGGTCATTACATAATGG - Intergenic
1188517475 X:31003206-31003228 TAGGCAATGTCATTCCAAAAAGG + Intergenic
1190476727 X:50835503-50835525 GAGGCAAGGTCATTGGAGCAAGG + Intergenic
1193037719 X:76971659-76971681 GATGGGAGGTCATTGCAAAGAGG - Intergenic
1195548755 X:106142439-106142461 GATGCAAGGTCGTTGCAACATGG + Intergenic
1200879334 Y:8195847-8195869 GAGACAAGGTCATTACATAATGG + Intergenic