ID: 902322681

View in Genome Browser
Species Human (GRCh38)
Location 1:15679656-15679678
Sequence TCCCCTTGGCTTCATTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902322677_902322681 27 Left 902322677 1:15679606-15679628 CCATGCAGTGATTCAGGGAACTA No data
Right 902322681 1:15679656-15679678 TCCCCTTGGCTTCATTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902322681 Original CRISPR TCCCCTTGGCTTCATTGCAC TGG Intergenic
No off target data available for this crispr