ID: 902325840

View in Genome Browser
Species Human (GRCh38)
Location 1:15700161-15700183
Sequence GAGCCCCATCGCTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902325835_902325840 3 Left 902325835 1:15700135-15700157 CCTGATGTGGTCCCCTAAATCCT 0: 1
1: 0
2: 1
3: 15
4: 125
Right 902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 156
902325838_902325840 -10 Left 902325838 1:15700148-15700170 CCTAAATCCTGCAGAGCCCCATC 0: 1
1: 0
2: 2
3: 17
4: 169
Right 902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 156
902325837_902325840 -9 Left 902325837 1:15700147-15700169 CCCTAAATCCTGCAGAGCCCCAT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 156
902325836_902325840 -8 Left 902325836 1:15700146-15700168 CCCCTAAATCCTGCAGAGCCCCA 0: 1
1: 0
2: 2
3: 14
4: 210
Right 902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902325840 Original CRISPR GAGCCCCATCGCTGAAGCCC TGG Intronic
901021349 1:6257546-6257568 GAGCCACATCTCTATAGCCCTGG + Intronic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
902414456 1:16230707-16230729 GGGCCCCATAGATGAACCCCTGG - Intergenic
903071110 1:20727346-20727368 GGGCCCCATCCCTTATGCCCTGG - Intronic
903560561 1:24224164-24224186 GAGCACAAGCTCTGAAGCCCTGG + Intergenic
903666723 1:25012451-25012473 GAGCGCCAGCCCTGGAGCCCAGG - Intergenic
906071601 1:43020908-43020930 TATCCCCATCCCTGAAGCCATGG + Intergenic
912798491 1:112706865-112706887 GGGCCCCCTCGCTGCAGCCCGGG + Intronic
913294405 1:117304620-117304642 GAGCCCCTGCGCTGCAGCTCGGG + Intergenic
916128565 1:161592132-161592154 GATCCCCATCGGTGAAGAGCTGG - Intronic
916138482 1:161673963-161673985 GATCCCCATCGGTGAAGAGCTGG - Exonic
916799525 1:168203469-168203491 AAGCCACATCCCTGAAGGCCAGG + Intergenic
919787664 1:201270114-201270136 CTGCCCCATCACTGAATCCCTGG - Intergenic
1062993116 10:1838523-1838545 GAGCCAGATGGCTGCAGCCCAGG + Intergenic
1064354490 10:14604579-14604601 GAGGCCGAGCGCTGCAGCCCCGG - Intronic
1067293672 10:44962077-44962099 GAGCCCCATAGCTGCAGTGCTGG + Intronic
1067449174 10:46370928-46370950 GAGCCCCATCTAGGATGCCCAGG + Intronic
1067588196 10:47489837-47489859 GAGCCCCATCTAGGATGCCCAGG - Intronic
1067635320 10:47997928-47997950 GAGCCCCATCTAGGATGCCCAGG - Intergenic
1067705391 10:48603256-48603278 AAGCCCCTTTGCTGAAGCACTGG + Intronic
1071394836 10:85213059-85213081 GAGACGCAAAGCTGAAGCCCAGG + Intergenic
1073851962 10:107632004-107632026 CAGGCAGATCGCTGAAGCCCAGG + Intergenic
1075785622 10:125048219-125048241 GGGCCCCATCGCTGGACACCAGG - Intronic
1075791398 10:125086857-125086879 GAGCCCCCTCCCTGAGGGCCTGG - Intronic
1076507513 10:130987678-130987700 GAGTCCCAGCTCTGAGGCCCAGG + Intergenic
1076687498 10:132204653-132204675 GACTCCCATCCCTGAGGCCCGGG - Intronic
1077445725 11:2589767-2589789 GAGGCCAAGCGCTGATGCCCTGG - Intronic
1077445950 11:2590910-2590932 GAGGCCAAGCGCTGATGCCCTGG + Intronic
1079481839 11:20889779-20889801 GAGCCCCCTCCCTGCAGCCAAGG + Intronic
1083678467 11:64340705-64340727 GGGCCCCATCGCTGAGGCGCAGG - Exonic
1083711823 11:64554415-64554437 GAGCCCCAGCTTTGAAGCCCAGG + Intergenic
1084659094 11:70536612-70536634 GAGCCACAAGCCTGAAGCCCAGG - Intronic
1085509725 11:77082199-77082221 GAGCCCCAGAGCTTCAGCCCAGG + Intronic
1089146194 11:116331123-116331145 GAGCCCCATCTCCGGAGACCTGG - Intergenic
1089806981 11:121099121-121099143 CAGCCCCAGTGCTGAAACCCAGG - Intergenic
1092253464 12:6914301-6914323 GAGCCGCACCCCTGTAGCCCGGG - Intronic
1092791327 12:12073100-12073122 GAGCAGGATCGCTTAAGCCCAGG - Intronic
1095667555 12:44820013-44820035 GTGCCCCAGCCCAGAAGCCCAGG + Intronic
1101884850 12:108653753-108653775 GAGCCCTAGCACTGAACCCCAGG + Intronic
1102495594 12:113316841-113316863 GAGCCTCATTCCTGGAGCCCAGG + Intronic
1102878626 12:116467081-116467103 GAGCTCCATCACAGCAGCCCTGG - Intergenic
1105864055 13:24443213-24443235 GAGCCCCTCTGCTGAGGCCCTGG + Intronic
1108151889 13:47544762-47544784 GAGCCCCATGGCTGCTCCCCAGG + Intergenic
1113909071 13:113833383-113833405 GAGCCCCACGGCTGCATCCCAGG + Intronic
1114617848 14:24077664-24077686 GAGCCCCAGGGCTGATGCCCTGG - Exonic
1117059947 14:51951901-51951923 GAGAACCATCGCTGTAGACCAGG - Intronic
1119743678 14:77029291-77029313 TAGCTCTATCGTTGAAGCCCGGG - Intergenic
1122877177 14:104673625-104673647 GAGCCCGACGGCTGAAGCCTTGG + Intergenic
1123135779 14:106026474-106026496 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1123161019 14:106277940-106277962 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1123583413 15:21736861-21736883 GAGCCCCTTCTCTGGAGCTCCGG + Intergenic
1123620063 15:22179458-22179480 GAGCCCCTTCTCTGGAGCTCCGG + Intergenic
1127636164 15:60872143-60872165 GAGCTCCATGTCTGAGGCCCAGG + Intronic
1129165570 15:73775347-73775369 GAGAGCCATCACTGAGGCCCTGG + Intergenic
1129393722 15:75233326-75233348 GATCCCCACCGCGGATGCCCTGG - Intergenic
1129848193 15:78777629-78777651 GAGACCCATCGGAGAAGCCTTGG + Intronic
1129884178 15:79027024-79027046 GAGTCCCTTCTCTGTAGCCCTGG - Intronic
1130032564 15:80328902-80328924 CATCCCCATCCCTGAACCCCAGG - Intergenic
1130253731 15:82316307-82316329 GAGACCCATCGGAGAAGCCTCGG - Intergenic
1132512816 16:352669-352691 GAGCCAGAGCGCCGAAGCCCAGG + Intronic
1132715262 16:1286900-1286922 GAGCCCCAAGGCTGCAGTCCTGG + Intergenic
1132901134 16:2255119-2255141 GAGACCCAAGGCAGAAGCCCAGG + Intronic
1135479990 16:22814359-22814381 GAGCCCCATCGCCTAGGACCGGG + Exonic
1136315035 16:29449435-29449457 GAGCCCCATCCCTAGAGCCCTGG - Intronic
1136429612 16:30188774-30188796 GAGCCCCATCCCTAGAGCCCTGG - Intronic
1139795930 16:69482767-69482789 AAGGCCCATCCCTTAAGCCCAGG - Intergenic
1141255776 16:82401114-82401136 CAGCCTCATCACTTAAGCCCAGG - Intergenic
1142220200 16:88850510-88850532 GAGCCCCCTCCCTCAAGCCCTGG - Intronic
1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG + Intergenic
1143573641 17:7776954-7776976 GAGCCCACTCGCTTGAGCCCAGG + Intronic
1147966103 17:44195003-44195025 GAGCCCCATTGCTCAAGTCCAGG + Intronic
1153697134 18:7655282-7655304 GAGGACCATCACTTAAGCCCAGG - Intronic
1155302548 18:24444014-24444036 GAGCTGTATCCCTGAAGCCCAGG - Intronic
1156697560 18:39785161-39785183 GAGCCACATCTCTGATGTCCAGG + Intergenic
1157288479 18:46393455-46393477 CAGCCCCATTTCTAAAGCCCTGG - Intronic
1157328542 18:46686491-46686513 CACTCCCATCCCTGAAGCCCAGG + Intronic
1157465266 18:47938613-47938635 GAGCCCTGTCTTTGAAGCCCGGG + Intergenic
1157579574 18:48765515-48765537 GGCTCCCATCACTGAAGCCCTGG - Intronic
1159931290 18:74315527-74315549 GAGCTCCGGCGCTGAAGCCCCGG - Intergenic
1160823984 19:1071056-1071078 GAGGCCCAGACCTGAAGCCCGGG - Intronic
1161835857 19:6645771-6645793 GAGCCCCAGGGATGGAGCCCAGG + Intergenic
1163854784 19:19692814-19692836 GAGGCCAATCGCTTGAGCCCAGG + Intergenic
1165115998 19:33529069-33529091 GAGCCCTGTGGCTGAAGCCCCGG - Intergenic
1165352174 19:35281692-35281714 GAGGCAGATCGCTTAAGCCCAGG - Intronic
1167043099 19:47034353-47034375 AAGCCCCATCCTTGGAGCCCTGG + Intronic
1168355295 19:55696393-55696415 GATCCCCATCCCTGAGGCCCTGG - Intronic
1168543270 19:57230579-57230601 GAGCCCCATCGCGGTGACCCTGG + Intergenic
1168724194 19:58571772-58571794 GAGGCCGATCTCTGGAGCCCGGG - Intronic
926350999 2:11994266-11994288 CAGCCCTGTCCCTGAAGCCCTGG - Intergenic
926511624 2:13787869-13787891 GAACCCCAGCGCTGTAGTCCAGG + Intergenic
926738762 2:16094023-16094045 GAGCCCCAAAGCTGCTGCCCTGG - Intergenic
927111060 2:19863978-19864000 GATTCCCATCCCTGAAGCCAGGG + Intergenic
929332845 2:40704810-40704832 GAGCCACATCTCTGAGGCCTTGG + Intergenic
930156435 2:48111778-48111800 CAGCCCCACCCCTGGAGCCCTGG + Intergenic
932515944 2:72349446-72349468 GAGCCCCATCCCTGACCTCCAGG + Intronic
932571252 2:72939625-72939647 GAGCCCCACCTCTGAGGCCTGGG - Intergenic
934516936 2:94994102-94994124 GACCCTCAGCCCTGAAGCCCAGG - Intergenic
935222064 2:101023679-101023701 CGGCCCCATCGCTGAGGACCAGG + Intronic
935672231 2:105565663-105565685 GATGCCCTTCACTGAAGCCCGGG - Intergenic
946145283 2:217725918-217725940 GAGCTCCCTCCCTGAAGGCCTGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948402622 2:237694590-237694612 GAGACCCATCCCTGAACCCACGG - Intronic
1169141366 20:3229038-3229060 GAGCCCCACAGCAGAGGCCCGGG + Intronic
1169226266 20:3859025-3859047 GAGGCCGATCGCTTCAGCCCAGG - Intronic
1172794452 20:37527451-37527473 GACCACCATCTCTGCAGCCCCGG - Intronic
1172939386 20:38644218-38644240 AAGCCCCATCCCTGAGGCCCAGG + Intronic
1175995695 20:62811413-62811435 AGGCACCATCCCTGAAGCCCCGG - Intronic
1177178876 21:17723892-17723914 GAGCCCATTCACTTAAGCCCAGG + Intergenic
1178588397 21:33888606-33888628 CAGACCCATCCCTCAAGCCCGGG - Exonic
1180071176 21:45436613-45436635 GTGCCCCACCCCTGCAGCCCTGG + Intronic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1181313264 22:21956837-21956859 ATGCCCCAACCCTGAAGCCCTGG - Intergenic
1181346369 22:22222909-22222931 ATGCCCCAACCCTGAAGCCCTGG - Intergenic
1183372495 22:37441817-37441839 GAGGCGGATCGCTTAAGCCCAGG - Intergenic
949890541 3:8730620-8730642 GAGCCCCCTCTCTGAGGCCTGGG - Intronic
951330098 3:21356519-21356541 GAGCTTCACAGCTGAAGCCCTGG + Intergenic
952923529 3:38305560-38305582 GTGCCCCATCTCTGTGGCCCAGG + Intronic
954136970 3:48586338-48586360 CAGCCCCATCCGTGAGGCCCAGG - Exonic
960573207 3:119205617-119205639 GAGCCCGATCCCTGATTCCCAGG + Intergenic
962975116 3:140439319-140439341 GCAGCCCCTCGCTGAAGCCCAGG - Intronic
966262955 3:178001909-178001931 AAGCCCCACCCCTGAGGCCCAGG - Intergenic
968074231 3:195807684-195807706 GAGCCACTTCTCTGAAGGCCAGG - Intronic
969015118 4:4098793-4098815 GAGCCCCAGGGCAGAAGCCAGGG - Intergenic
979349484 4:119628135-119628157 GAGCCCCTTCCCTGCAGCTCCGG - Intronic
979610000 4:122679909-122679931 GAGCCCAATTGCTTGAGCCCAGG + Intergenic
985719195 5:1480446-1480468 GAGCCCCAGAGGAGAAGCCCGGG - Intronic
988414672 5:30931100-30931122 GAGCAGGATCCCTGAAGCCCAGG + Intergenic
988855309 5:35222536-35222558 GAGCCCCGTCCCTGATGCCTGGG - Intronic
989007710 5:36833687-36833709 GAGCCTCATCGCTTGAGCTCAGG + Intergenic
994434120 5:99706518-99706540 CAGCCCCTTCGCTGAACCCGTGG - Intergenic
995831265 5:116358555-116358577 GAGCCACATGGCTGAAACCTGGG - Intronic
997722212 5:136088448-136088470 CAGCCCCATCCCTACAGCCCTGG + Intergenic
1001124585 5:169007986-169008008 GAGCCCCATCCCTGGAGAACCGG + Intronic
1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG + Intergenic
1004714506 6:18204379-18204401 GAGGCCGATTGCTGGAGCCCCGG + Intronic
1005282213 6:24286363-24286385 CAGGCCGATCGCTGGAGCCCAGG + Intronic
1005477777 6:26225266-26225288 AAGCCCCATCGCTACCGCCCTGG + Exonic
1009650914 6:66477110-66477132 GGGCCTCATCTCTGAAGCCTAGG + Intergenic
1012777518 6:103516535-103516557 CAGCCCCATGCCTGCAGCCCAGG - Intergenic
1015729806 6:136335851-136335873 CAGCTGCATCTCTGAAGCCCAGG - Intergenic
1018830921 6:167442858-167442880 GATCCCCATCCTTGAAGGCCTGG - Intergenic
1019726513 7:2605899-2605921 GAGCCCCATCGCCCAGGCCACGG + Exonic
1020792245 7:12641376-12641398 CAGCCCCATCCCTGAGGCCATGG - Intronic
1020959811 7:14788238-14788260 GAGCCCCATCCCTGAAGCTCAGG + Intronic
1022529739 7:31059550-31059572 AAGCCCCACCACTGCAGCCCAGG - Intronic
1023822794 7:43989234-43989256 CAGTCCTATCTCTGAAGCCCAGG + Intergenic
1029751058 7:102542649-102542671 CAGTCCTATCTCTGAAGCCCAGG + Intronic
1029769011 7:102641760-102641782 CAGTCCTATCTCTGAAGCCCAGG + Intronic
1034400190 7:150857013-150857035 GGGCCACATCGGTGAAGGCCAGG - Exonic
1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG + Intergenic
1036998982 8:13695235-13695257 GAGCCCCATCACTGAAGGGTCGG + Intergenic
1044019393 8:87085832-87085854 AAGTACCATCTCTGAAGCCCAGG - Intronic
1050764272 9:9113005-9113027 GAGCCCCTGCACTGAAGCCTAGG - Intronic
1052348110 9:27430254-27430276 GAGCACCATCCCTGCAGCACAGG - Intronic
1055452990 9:76447470-76447492 CAGCCCGATCGCTTAAGCCCAGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056532501 9:87498871-87498893 GACCCCGCTCGCTGAAGACCGGG - Intronic
1057742222 9:97721795-97721817 GAGCCCCGTGTCTGCAGCCCAGG - Intergenic
1059202328 9:112429862-112429884 CAGGCCGATCGCTGGAGCCCAGG + Intronic
1060212079 9:121716716-121716738 GAGCCACATGCCTGAGGCCCAGG + Intronic
1061666809 9:132164825-132164847 GAGTCCCATGCCTGGAGCCCTGG + Intronic
1062455531 9:136635691-136635713 CAAACCCATCGCTGAAGCCATGG + Intergenic
1187068657 X:15866123-15866145 CAGGCAGATCGCTGAAGCCCAGG - Intergenic
1188443043 X:30231567-30231589 CAGCCTCATCGCTTAAGCACAGG + Exonic
1188443273 X:30232877-30232899 CAGCCTCATCGCTTAAGCACAGG + Exonic
1188443345 X:30233312-30233334 CAGCCTCATCGCTTAAGCACAGG + Exonic
1196007705 X:110853502-110853524 GAACCCCATCTGTGAAGGCCAGG + Intergenic
1196420479 X:115515742-115515764 TAGGCCCATCGCTTGAGCCCAGG + Intergenic
1196814147 X:119651738-119651760 GAGCCACATGGCTGCAGGCCTGG - Intronic
1198068054 X:133119495-133119517 GAGTCTCAAGGCTGAAGCCCTGG - Intergenic
1200075088 X:153546853-153546875 CAGCCCGATGGCTGCAGCCCTGG + Intronic
1200891386 Y:8328017-8328039 GAGCCACATCACTGAAATCCTGG - Intergenic