ID: 902329259

View in Genome Browser
Species Human (GRCh38)
Location 1:15723066-15723088
Sequence ACCTGGAGGAAGGCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 462}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902329251_902329259 4 Left 902329251 1:15723039-15723061 CCCGGGGAGGCTCTGTCTTCTCC 0: 1
1: 0
2: 8
3: 32
4: 380
Right 902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 49
4: 462
902329252_902329259 3 Left 902329252 1:15723040-15723062 CCGGGGAGGCTCTGTCTTCTCCT 0: 1
1: 1
2: 5
3: 44
4: 421
Right 902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 49
4: 462
902329246_902329259 27 Left 902329246 1:15723016-15723038 CCTGAGCTCACTCTGGCAGCTCA 0: 1
1: 0
2: 2
3: 34
4: 217
Right 902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 49
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902329259 Original CRISPR ACCTGGAGGAAGGCAGGACT TGG Intronic
900420888 1:2555503-2555525 ACCTGGCTGAAGTCAGGACCAGG + Intergenic
900484256 1:2914049-2914071 ACCTGAAGGCAGGGAGGACTTGG + Intergenic
900679237 1:3907227-3907249 ACGTGGACCCAGGCAGGACTGGG + Intergenic
901457553 1:9371896-9371918 AGCTGCTGGCAGGCAGGACTCGG + Intergenic
901654784 1:10763037-10763059 GCTTGGAGGATGGCAGGAATGGG - Intronic
901791031 1:11653876-11653898 CTCAGGAGGAAGGCAGGAATAGG + Intronic
902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG + Intronic
903177512 1:21589848-21589870 GTCTGAAGGAAGGCAGGGCTGGG + Intergenic
903263915 1:22145105-22145127 AGCTGGAGGAGGGCCAGACTGGG + Intergenic
903363866 1:22794105-22794127 ATCTGGAGGTAGGCAGGCCAGGG - Intronic
903670581 1:25033244-25033266 ACGTGGAGCCAGGCAGGCCTGGG - Intergenic
905275637 1:36816127-36816149 CCCTCGAGGAAGGTAGGCCTGGG + Intronic
905309339 1:37038429-37038451 AGCTGAAGGTAGGCAGGCCTCGG - Intergenic
905422201 1:37855282-37855304 ACCTGCAGAAAGGCAGGTTTTGG + Intronic
905879415 1:41453951-41453973 GCCTGGAGTCAGGCAGGCCTGGG + Intergenic
906658520 1:47565989-47566011 CCCAGGAGGAAAGCAGGATTGGG + Intergenic
906784788 1:48605445-48605467 TCCTGGAGGAAGGCTGGGCAGGG - Intronic
907119065 1:51992633-51992655 ACCAGGAGGATGGCAGGACAGGG - Intergenic
907400881 1:54224038-54224060 AGCTGGAGGAAGGCAGGTCACGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907766541 1:57417955-57417977 ACCTGGAGAAAGGAAAGGCTGGG - Intronic
907968328 1:59355760-59355782 AGCTGGAGGCAGACTGGACTAGG - Intronic
909391456 1:75125844-75125866 ACCTTGAGGATGGCGGGACTGGG - Intergenic
909602614 1:77476647-77476669 AGCCGGAGGAAGGCAGAACATGG + Intronic
913119409 1:115726106-115726128 TCCTTCAGGAAGGCAGTACTTGG - Intronic
913378745 1:118185409-118185431 AACTGGAGGAGGGCAGGACGAGG + Intergenic
915269646 1:154744647-154744669 ACCTGGACAAAGGCAGAGCTGGG - Intronic
915281619 1:154826522-154826544 ACCTGGAGGCAGACAGATCTGGG - Intronic
915461834 1:156075147-156075169 GCCTGGGGCAAAGCAGGACTGGG - Exonic
915473705 1:156140243-156140265 CCCTGGAGCAGGGCAGGGCTGGG - Intergenic
915732489 1:158063908-158063930 AGCTGGATGATGGCAGGACTAGG + Intronic
917651372 1:177081187-177081209 ACCTGGAGGAAGAAAGGTCAAGG + Intronic
918132933 1:181645078-181645100 GCAGGGAGGAAGGCAGGAGTAGG + Intronic
918476601 1:184931948-184931970 ATCTGGAGGAAGGGAGAACATGG - Intronic
919504596 1:198383505-198383527 ACCTGAAGGAAGCTAGGAGTTGG + Intergenic
920145964 1:203861420-203861442 ACCTGGAGGGAGGCGGGAGGAGG - Intergenic
920300028 1:204982911-204982933 AGATGGAGGAAGGGAGGGCTGGG + Intronic
920301989 1:204994579-204994601 ACCTGTAGGAAGGGAGGCCCAGG + Intronic
920832550 1:209478720-209478742 ACTTGGAGGTAGGTAGGACTGGG - Intergenic
921165976 1:212507406-212507428 AGCTGGAGGAAGGCAGCCCCGGG - Intergenic
921260669 1:213382909-213382931 TTTTGGTGGAAGGCAGGACTCGG + Intergenic
922165174 1:223109264-223109286 ACCTGGAGTTACGCTGGACTTGG + Intergenic
922247315 1:223813210-223813232 TCCAGAATGAAGGCAGGACTTGG - Intronic
1063105290 10:2987090-2987112 AGCAGGATGAAGGCAGGACCAGG + Intergenic
1063529791 10:6820010-6820032 ACCTGTAAGTAGGCAGGAGTAGG - Intergenic
1064872611 10:19955511-19955533 ACCTGAATGAAGGCAGCCCTTGG - Intronic
1066634662 10:37488871-37488893 AGATGGAGGAAGAGAGGACTTGG + Intergenic
1067047946 10:42996479-42996501 TCCTGGAGCTAGGCTGGACTGGG - Intergenic
1067568140 10:47352635-47352657 TGCTGGAGGGAGGCAGGTCTTGG - Intronic
1067584023 10:47464668-47464690 ACCTGGAGGGAGTCAGCACATGG + Intronic
1067691139 10:48503057-48503079 ACCTTGGAGAAGCCAGGACTTGG + Intronic
1068458456 10:57292645-57292667 ACCTGGTGGAAGACAGGAGCTGG - Intergenic
1069566391 10:69466101-69466123 AGCTGCAGGAAGGCAGAAGTGGG + Intronic
1069604895 10:69732803-69732825 ACCCACAGAAAGGCAGGACTAGG + Intergenic
1070816557 10:79328204-79328226 CCCTGGGGAAAGGCAGGAGTGGG + Intergenic
1071667959 10:87578566-87578588 ACATGGCTGAAGGCAGGCCTAGG - Intergenic
1072156090 10:92724989-92725011 TCCTTGAGGAAGGGAGGTCTTGG - Intergenic
1072425202 10:95324234-95324256 CCCTGGAGTCAGGCAGGACAGGG + Intronic
1073151718 10:101316168-101316190 ACTTGGAGGGAGGCAGGAGGCGG + Intergenic
1074898381 10:117796187-117796209 TCCTGGAGGAAGCCAGTGCTGGG + Intergenic
1075001910 10:118804944-118804966 ACCTGAAGGAAGACAGGAGCTGG + Intergenic
1075415099 10:122256871-122256893 ACCTACAAGAAGACAGGACTCGG + Intergenic
1075623886 10:123948058-123948080 ACCTGGAGGAAGAAGGGAGTGGG - Intergenic
1077073222 11:687323-687345 AGCAGGAGGGAGGCAGGGCTGGG - Intronic
1077209212 11:1360694-1360716 CCCTGTAGGGAGGCAGGACAGGG - Intergenic
1077340220 11:2023134-2023156 GCCTGCGGGAGGGCAGGACTCGG - Intergenic
1077343145 11:2034949-2034971 AGCTGGAGGGAGGCAGGAGCTGG - Intergenic
1077413285 11:2413342-2413364 ACCCGCAGGGAGGCTGGACTTGG + Intronic
1077478785 11:2803323-2803345 GCCTGGACGGTGGCAGGACTCGG + Intronic
1078270486 11:9789968-9789990 AGCTGGAGGAAGGCCAGACTAGG + Intronic
1078537904 11:12189796-12189818 ACCAAGAGGAAGGCATGCCTGGG - Intronic
1078888083 11:15525903-15525925 ACTTGGTGGTGGGCAGGACTAGG - Intergenic
1079592835 11:22201672-22201694 ACATGGTGGAAGGCATCACTTGG + Intronic
1081583438 11:44367874-44367896 ACCTGGCGAATGGCAGAACTGGG + Intergenic
1081669207 11:44933842-44933864 ACCGGGAAGCAGGCAGGAGTGGG + Exonic
1081850978 11:46274999-46275021 AAGAGGAGGAAGGCCGGACTGGG - Intergenic
1081855000 11:46297310-46297332 ACCTGGAGTGAGGCAGTACCAGG - Intronic
1081976523 11:47238821-47238843 GCCAGGAGGAAGCCAGGACACGG + Exonic
1082811354 11:57480950-57480972 CCCTGCAGGAGGGCAGGCCTGGG + Intergenic
1083722913 11:64612194-64612216 ACCTGGAGGAGGGGAGGACCGGG + Intronic
1083889067 11:65586886-65586908 AGCTGGGGGAAGGCCTGACTTGG - Intronic
1084875762 11:72131575-72131597 ACTTGGATGAAGGCTGGCCTTGG + Intronic
1086219972 11:84430635-84430657 AAGTGAAGGAAGGCAGGAGTAGG - Intronic
1086853539 11:91839471-91839493 ACCTGGAGGAGGGCCGGGCATGG - Intergenic
1086955781 11:92933450-92933472 AGCTGGAGGAGGGCAGGAGCAGG + Intergenic
1088243249 11:107792314-107792336 ACCAGTGGGAAAGCAGGACTGGG - Exonic
1088804847 11:113342875-113342897 AGGGCGAGGAAGGCAGGACTTGG + Intronic
1089030697 11:115325304-115325326 TCCTGGAGGCAGCCAGGGCTTGG + Intronic
1089849410 11:121483318-121483340 GCCTGGAAAAAGGCAGGACTGGG - Intronic
1090283856 11:125481683-125481705 GCCTGGAGGAAGGAAGAGCTGGG + Intronic
1090411528 11:126512964-126512986 AGCTGGATGGTGGCAGGACTGGG + Intronic
1090454205 11:126833672-126833694 ACCTGGAGACATGCAGCACTCGG - Intronic
1090457724 11:126864372-126864394 ACTTGGAGAAAGGCAGGTGTGGG + Intronic
1090723562 11:129499867-129499889 TCCTGAAGGAAGGAAGGAGTGGG + Intergenic
1202823205 11_KI270721v1_random:78323-78345 GCCTGCGGGAGGGCAGGACTCGG - Intergenic
1202826131 11_KI270721v1_random:90138-90160 AGCTGGAGGGAGGCAGGAGCTGG - Intergenic
1092441624 12:8509562-8509584 GCCTGGTGGAGGACAGGACTCGG + Intronic
1092778675 12:11965626-11965648 ACCTGGCATAAGGGAGGACTGGG - Intergenic
1093157621 12:15706345-15706367 GCCTCGAGGAAGGAAGAACTTGG - Intronic
1093497046 12:19770048-19770070 ACCTGGAGGGAGGCTTAACTTGG + Intergenic
1094490993 12:30960508-30960530 ACCTGGAGGAAAGCAGGCAGAGG - Intronic
1095357395 12:41291934-41291956 ACTGGGAGGAAGGCAGGACCAGG + Intronic
1096777252 12:53971894-53971916 ACTTGTAGGAGGGCAGGACAGGG + Intergenic
1096878419 12:54648108-54648130 ACCTAGTGGGAGGCAGGAGTGGG + Intronic
1096912179 12:54995580-54995602 ACCTGGAGCAGGTCAGAACTTGG - Intergenic
1096979527 12:55720279-55720301 GCCTGGCTGAAGCCAGGACTTGG - Intronic
1097039990 12:56150266-56150288 TCCTGGAGGACGGCATGCCTAGG + Intergenic
1097349497 12:58532960-58532982 ACAGGGAGGAAGGCAGGAGATGG - Intergenic
1100888182 12:99095523-99095545 ACCTGGAGGCAGGCAAGGATAGG + Intronic
1101916488 12:108900137-108900159 CACTGGTGGAAGGCAGGGCTGGG + Intronic
1102236848 12:111298978-111299000 AGCCGGAGGAAGGCAGGAGGCGG - Intronic
1102533527 12:113564436-113564458 AGCTGGAAGAATGCAGAACTGGG - Intergenic
1103490688 12:121317076-121317098 GGCTGGGGGAAGGGAGGACTGGG + Intronic
1103520940 12:121536888-121536910 AGCTGGAGGATGGCAGGATGGGG - Intronic
1104079081 12:125414708-125414730 ACCAGGATGAAGGCAGGCCGTGG - Intronic
1105294568 13:19076402-19076424 GCCTGCAGGAAGGCAGCTCTGGG - Intergenic
1105768770 13:23587475-23587497 GCCTGAAAGGAGGCAGGACTAGG - Intronic
1105840660 13:24251325-24251347 CTCTGGAGGAAGCCAGGACAAGG - Intronic
1106303685 13:28492626-28492648 ACCTGAAGGAAGGCAGACCCAGG + Intronic
1108582060 13:51836219-51836241 CCATGGAGGAAGGCAGCACGTGG - Intergenic
1110233327 13:73189941-73189963 AGCTTGAGGAAGGCAGGAGATGG - Intergenic
1111618402 13:90691474-90691496 AACTGGTGGAAGGAAGCACTGGG + Intergenic
1112718013 13:102209081-102209103 GACGCGAGGAAGGCAGGACTGGG + Intronic
1113286847 13:108858974-108858996 ACCTGAAGGGAGGGAGGAATGGG - Intronic
1114678521 14:24462163-24462185 ACCTGAAGGAAGTGAGGTCTGGG - Intergenic
1114957019 14:27835204-27835226 ACCAGGAGGAATGAAAGACTGGG - Intergenic
1117806499 14:59497389-59497411 TTCTGGTGGAAGGCAGGAGTGGG + Intronic
1118830483 14:69426682-69426704 ACCTGCCCCAAGGCAGGACTTGG - Intronic
1119025519 14:71149256-71149278 GCTTGGAGGGAGGCAGGAGTAGG + Intergenic
1119058538 14:71449113-71449135 AGCTGGTTGATGGCAGGACTGGG + Intronic
1119348473 14:73944956-73944978 ACCAGTGGGAAGGGAGGACTGGG - Intronic
1119524056 14:75308275-75308297 TCAGGGATGAAGGCAGGACTTGG + Intergenic
1119788447 14:77329316-77329338 GCATGGATGAGGGCAGGACTGGG + Intronic
1119892874 14:78196179-78196201 ACATGGACAAAGGCAGTACTCGG - Intergenic
1120973200 14:90226719-90226741 GCCTTGAGGAAGGCAGGACCAGG - Intergenic
1121021221 14:90581249-90581271 ACCAGGAGGCAGGCATGGCTGGG - Intronic
1121180078 14:91922376-91922398 CCAGGGAGGAAGGCAGGCCTAGG - Intronic
1122117921 14:99536887-99536909 GCCTGGGGGGAGGCAGGACCAGG - Intronic
1122424657 14:101598883-101598905 CCCTGGAGGAAGGCTGGGCAGGG - Intergenic
1122972662 14:105158729-105158751 ACCTGGAAGGAGCCAGGGCTGGG - Intronic
1124238865 15:28013688-28013710 GCCTGGAGGAACCCAGGAGTGGG - Intronic
1124654785 15:31499395-31499417 ACCTGGTGGGAGGCAGGAGATGG - Intronic
1125269395 15:37921578-37921600 ATCAGGTGGGAGGCAGGACTAGG + Intergenic
1126464649 15:48950837-48950859 TCCTGGAGGAGGGTAGGAGTAGG + Intronic
1127457952 15:59171804-59171826 GCCAGGAGGAAGGCCGGGCTGGG - Intronic
1128327088 15:66730867-66730889 CTCTGGAGGCAGGCAGGCCTGGG - Intronic
1128339227 15:66808772-66808794 AGCTGGAGGAAGGCAGCCCCGGG + Intergenic
1128625330 15:69196049-69196071 AGTTGGAGGAGGGCAGGCCTGGG + Intronic
1128789257 15:70420839-70420861 GCCTGGAGGAAGGCAGTCCAGGG - Intergenic
1129074166 15:72977253-72977275 ATCTGGAGGAAGCCAGGCCAGGG - Intergenic
1129108317 15:73323455-73323477 AGCTGGATGAGGGCAGGAGTGGG + Exonic
1129376650 15:75137983-75138005 GCCTGGAGGCAGCCAGGACCAGG - Intergenic
1129456879 15:75680845-75680867 TCTGGGAGGAGGGCAGGACTGGG - Intronic
1129685999 15:77686426-77686448 GCCTGGGGGAAGGCAAGACCCGG + Intronic
1129726920 15:77906108-77906130 TCAGGGAGGAGGGCAGGACTGGG + Intergenic
1129826134 15:78636283-78636305 ACCAGGAGGAGGGCAGGGGTGGG - Intronic
1129832349 15:78679213-78679235 GCCAGGAGGAAGCCAGGCCTGGG + Intronic
1129917650 15:79288513-79288535 ACCTGGAGAAAGTCAGGCCAGGG + Intergenic
1130274917 15:82471364-82471386 TCAGGGAGGAGGGCAGGACTGGG + Intergenic
1130467264 15:84198733-84198755 TCAGGGAGGAGGGCAGGACTGGG + Intergenic
1130496998 15:84474803-84474825 TCAGGGAGGAGGGCAGGACTGGG - Intergenic
1130589561 15:85203331-85203353 TCAGGGAGGAGGGCAGGACTGGG + Intergenic
1131334531 15:91535237-91535259 ACTTGGAGGAAAACAGAACTAGG - Intergenic
1131998550 15:98157073-98157095 ACCTGGGTGAAGGGAGGAGTAGG + Intergenic
1132710663 16:1265687-1265709 AGCTGGAGGATGGGAGGGCTGGG + Intergenic
1132760220 16:1505389-1505411 ACCTGGAGGGAGACAGGCCCAGG - Exonic
1132787692 16:1667071-1667093 ACCTTGTGGCAGGCAGGGCTGGG - Intronic
1133218076 16:4305525-4305547 ACCTGGAGTTCGGCAGGAGTGGG + Intergenic
1133734187 16:8601622-8601644 ACTGGGATGAAGGCAGGAGTGGG - Intergenic
1134038617 16:11050914-11050936 CCCTGGAGCAAGACAGGCCTGGG + Intronic
1134216165 16:12318457-12318479 GCATGGAGGGAGGCATGACTTGG + Intronic
1134312067 16:13083927-13083949 AGCGGGAGGGAGGCAGGATTTGG + Intronic
1136120099 16:28127322-28127344 CCAAGGAGGAAGGCAGGAGTGGG - Intronic
1136173508 16:28502503-28502525 ACATGGAGGAAGGATGGAGTTGG - Intronic
1136317306 16:29461792-29461814 AAGTGGAGGAAGACAGGGCTGGG + Intronic
1136400716 16:30016577-30016599 TTCTGGAGGCAGGCAGGGCTGGG - Intronic
1136431881 16:30201135-30201157 AAGTGGAGGAAGACAGGGCTGGG + Intronic
1137540184 16:49356516-49356538 ACCTTGAGGCAGGGAGGGCTGGG - Intergenic
1137815155 16:51391866-51391888 ACCTGCCGGATGGCAGGACTGGG - Intergenic
1139247072 16:65455492-65455514 AGCTCCACGAAGGCAGGACTGGG + Intergenic
1139355550 16:66365300-66365322 GCTTGGAGGGAGGGAGGACTTGG - Intergenic
1139960942 16:70716925-70716947 TCCTGCAGGAAGGAAGGAGTTGG + Intronic
1140464941 16:75173937-75173959 ACCAGGAGGAAGGCAGAGCGTGG + Intergenic
1141602550 16:85135281-85135303 ACCGGGGGGAAGGCAGGGCAAGG + Intergenic
1141824302 16:86468299-86468321 ACCTGGTGGACGGCAGAACAAGG - Intergenic
1142614515 17:1126698-1126720 ACCTGGAGGAAAGGATGTCTGGG - Intronic
1142697167 17:1640039-1640061 ACCTGGGGTGAGGCAAGACTCGG + Exonic
1142831474 17:2552354-2552376 ACCTTGAGAAGGGCAGGGCTCGG + Intergenic
1143181831 17:4988185-4988207 GCCTGGAGGAAAACAGGACTTGG + Intronic
1143711055 17:8735668-8735690 GGCTGGAGGTTGGCAGGACTGGG - Intronic
1146208854 17:30926356-30926378 ACCTGGAGGATGGAAGAAGTGGG - Intronic
1146266964 17:31459167-31459189 ACTTGGAGGTGGGTAGGACTGGG - Intronic
1147440055 17:40442712-40442734 TCGTGGAGGGAGGCAGGCCTGGG - Intergenic
1147727287 17:42574088-42574110 ACATGGAGGCTGGTAGGACTGGG - Exonic
1148188927 17:45665390-45665412 TCCTGGAGAAAGACAGAACTGGG + Intergenic
1148641283 17:49189664-49189686 ACCTGAAGGAAGGCTGGGCACGG - Intergenic
1148734210 17:49855649-49855671 ACCTGGAGGGAAGGAGGATTGGG + Intergenic
1148769911 17:50060680-50060702 TCCTGGAGTCAGGCTGGACTGGG - Intronic
1148797252 17:50203006-50203028 ACATGGAGGAAGAAAGGACGTGG - Intergenic
1148875621 17:50685145-50685167 AGCTGGGAGAAGGCAGGTCTGGG + Intronic
1149600546 17:57890564-57890586 ACCTGGAGGAGGACAGGTGTGGG - Intronic
1150834341 17:68551022-68551044 TTCTGGAGGAAAGCATGACTTGG + Intronic
1151482775 17:74380066-74380088 AGCTGGGGGATGGGAGGACTCGG - Intergenic
1151698754 17:75731458-75731480 CCCTGGAGTCAGGCAGGCCTGGG + Intronic
1152245979 17:79184767-79184789 AGCTGGAGGGAGGCAGGCCTGGG + Intronic
1152555725 17:81052291-81052313 TCCCGAGGGAAGGCAGGACTAGG - Intronic
1152868201 17:82736607-82736629 AGGTGGAGAAAGGCAGGCCTGGG + Intronic
1155001250 18:21689197-21689219 ACCTGAGGGAAGGCAGTAGTTGG + Intronic
1155158249 18:23176060-23176082 AGGTGGAGGAAGGTAGGATTTGG + Intronic
1155343426 18:24835812-24835834 CCTTGGAGGGAGGCAGGACTGGG + Intergenic
1155379277 18:25201252-25201274 ACCTGGAGGATTGAAGGAGTAGG - Intronic
1156472788 18:37388036-37388058 ACTCGGTGGAAGGCAGGAGTTGG + Intronic
1156769440 18:40701099-40701121 GCTTGGAGGAAGCAAGGACTTGG + Intergenic
1156882914 18:42102310-42102332 AGCTGAAGGAAGGGAGGTCTAGG - Intergenic
1157937959 18:51893983-51894005 TCCTGGAGGTAGGAAGGAGTAGG + Intergenic
1158052579 18:53241383-53241405 CCGTGGGGGAAAGCAGGACTGGG - Intronic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
1160358419 18:78248283-78248305 ACATGGAGGGGGGCAGCACTGGG + Intergenic
1160510426 18:79450601-79450623 CCCTGGAGGCAGCCAGGACTTGG + Intronic
1161042685 19:2118414-2118436 ACCTGGAGGTCAGCAGGACGGGG - Intronic
1161591961 19:5132995-5133017 ACCTAGAGGAGGGCAGGGCAGGG - Intronic
1161628711 19:5340662-5340684 ACCTGGAGGCTGGCTGGGCTGGG + Exonic
1161993993 19:7701372-7701394 TCCAGGAAGAAGCCAGGACTCGG - Intronic
1162476117 19:10900370-10900392 AGCTGGGAGAAGGCAGGAATGGG - Intronic
1162935093 19:13978229-13978251 CCCTGGAGGAGGCCAGGGCTGGG + Intronic
1163106711 19:15127429-15127451 ACCAGGAGGAAGTGAGGACATGG + Intergenic
1163533538 19:17864163-17864185 ACCAGGAGGAAGCCAGGACTAGG + Intergenic
1163551872 19:17969843-17969865 CCCTGGAGGAGGGCAGGATCTGG + Intronic
1164733693 19:30525170-30525192 ACCTGGATGGAGGGAGAACTGGG + Intronic
1164741493 19:30579410-30579432 AGCTGGAGGATGGCTGGTCTAGG + Intronic
1164816925 19:31211492-31211514 CCGGGGAAGAAGGCAGGACTGGG + Intergenic
1165374555 19:35432556-35432578 GCCTGGAAGAAGTTAGGACTTGG + Intergenic
1165929912 19:39350777-39350799 ACCTGGAGAAAGGCTGGGCACGG - Intronic
1166085626 19:40472793-40472815 ACCTGGAGGAGGGCTGGGGTGGG + Intronic
1166142662 19:40813375-40813397 ACTTGGAGGAAGGCTGGATTTGG - Intronic
1166184866 19:41133393-41133415 ACTTGGAGGAAGGCTGGATTTGG + Intergenic
1166268079 19:41697119-41697141 ACCTGAGGGCAGGCAGGACCTGG + Intronic
1166552740 19:43677235-43677257 CCCTGGAGGAAGGAGGGACAGGG + Intergenic
1166616211 19:44249645-44249667 TTCTGGATGAAAGCAGGACTAGG - Intronic
1166845830 19:45727874-45727896 ACCTGGAGTAAGGCCAGACTGGG + Intronic
1167093490 19:47360502-47360524 ACCTGGAGAAAGACAGCTCTCGG - Intronic
1167117397 19:47496253-47496275 AGCTGGTGGGTGGCAGGACTAGG - Intronic
1167190214 19:47982945-47982967 AGCTGGAGGGAGGGAGGAATGGG + Intronic
1167356969 19:49010321-49010343 CCCAGGAGGTAGTCAGGACTAGG - Intronic
1167590919 19:50403743-50403765 ACTTGGAGCAGGGCAGGACCAGG - Intronic
1168337800 19:55606031-55606053 ACCTGGAGGAAGCAATGACGGGG - Intronic
1168430149 19:56272551-56272573 AACAGGAGGAGGGCAGGATTTGG + Intronic
926048155 2:9725243-9725265 TCCTGCAGCAAGGCAGGGCTCGG + Intergenic
926218971 2:10922696-10922718 CCCAGGAGGAAGGCGGGACATGG - Intergenic
928078526 2:28287656-28287678 TCCTGGAAGAAGGCGGGGCTTGG + Intronic
928978359 2:37112913-37112935 ATCTGGAAGAAGGGAGGAATGGG - Intronic
930693788 2:54390856-54390878 GCCTGGAGGAATGCTGGCCTGGG + Intergenic
930912923 2:56651789-56651811 TCATGGAGGAAGGTAAGACTTGG + Intergenic
932366285 2:71155495-71155517 ACCAGAAGGACGGCAGGACTGGG - Intergenic
932449547 2:71800744-71800766 GCCTGGAGGGAGGCAGGAGTAGG - Intergenic
932487317 2:72092006-72092028 ACCTGGAGAGGGGAAGGACTAGG - Intergenic
932760376 2:74435850-74435872 ATCTGTAGGCAGGCAGGACAAGG - Intronic
933707730 2:85304266-85304288 ACCGGGAGGAAGGGAGTACATGG - Exonic
933797043 2:85927927-85927949 ACCTGCAGGAAGGCTGGGCTGGG - Intergenic
934480261 2:94632778-94632800 ACCAGGAGGAATGAAAGACTGGG + Intergenic
935068839 2:99676125-99676147 GCCTGGAGGAACCCAGGAGTAGG - Intronic
935223497 2:101034674-101034696 ACCTAGAGGAATGCAGACCTTGG + Intronic
935274802 2:101466899-101466921 ACCTGGAGGAGAGGAGGACAAGG + Exonic
936153280 2:110033103-110033125 ACCTGGAGGAGGGAAGCACCAGG + Intergenic
936191401 2:110338312-110338334 ACCTGGAGGAGGGAAGCACCAGG - Intergenic
936559175 2:113521682-113521704 ACCTCGAAGAAGGGAGGATTTGG + Intergenic
936786264 2:116097088-116097110 ACCTGGAGATAGACAAGACTTGG + Intergenic
937114097 2:119391896-119391918 GTCTGGAGGAAGGAAGGCCTTGG + Intergenic
937449857 2:121993053-121993075 AGCTGGAGGATGGGAGGGCTGGG - Intergenic
937648451 2:124293823-124293845 ACCTGCAGGAAAGTAGGACTGGG + Intronic
937869296 2:126776411-126776433 GCCAGGAGAAGGGCAGGACTGGG + Intergenic
938085281 2:128395878-128395900 GGCTGGAGAAAGGCAGGGCTGGG - Intergenic
939712253 2:145536800-145536822 TCCTGGAGGAATGAAGGACAAGG - Intergenic
939888722 2:147710050-147710072 AAATGGAAGAAGGCAGAACTGGG - Intergenic
939959021 2:148549925-148549947 CCCTGGAAGAAGGCAGGCCTGGG + Intergenic
940857037 2:158737341-158737363 AGCTGGAGGAAGCCAGGAAGAGG - Intergenic
941273823 2:163464716-163464738 AGTTGGAGGATGGCAGGATTTGG + Intergenic
941778525 2:169419083-169419105 AGCTGGAGGAAGGTAGGAGATGG - Intergenic
942152692 2:173092892-173092914 ACCTGCACGAAAGCAGGATTTGG - Intronic
942447273 2:176086236-176086258 CCCTGGAGCAAGCGAGGACTGGG - Intergenic
942606707 2:177699642-177699664 ATCTGGAGGAAGAAAGGTCTGGG + Intronic
945759188 2:213891807-213891829 ACCTGGAGGCAGGCAGAATGAGG - Intronic
945887775 2:215394802-215394824 ACAGGGCGGAATGCAGGACTTGG + Intronic
946449736 2:219769485-219769507 TCCCGGAGGCAGGCAGGCCTCGG + Intergenic
946453569 2:219801792-219801814 ACCTGGAGGAAGACATCACCTGG + Intergenic
946594223 2:221288401-221288423 ACCTGGAGGACTGAAGGCCTTGG + Intergenic
947271753 2:228343930-228343952 GGAAGGAGGAAGGCAGGACTGGG - Intergenic
947295325 2:228624425-228624447 TGCTGGACGAAGGAAGGACTGGG - Intergenic
948055530 2:235007189-235007211 CCCTGCAGGAAGGCAGGAGCAGG + Intronic
948236416 2:236394294-236394316 ACCTGCAGGAAGACAGGACATGG + Intronic
948315642 2:237026574-237026596 ACCGGGAGGAGGGGATGACTGGG + Intergenic
948458870 2:238119606-238119628 AGCTGGAGGAGGGGAGGCCTGGG + Intronic
948776582 2:240292257-240292279 ACAGGGAGGAAGGGAGGGCTGGG - Intergenic
948807541 2:240459503-240459525 ACCTGCAGGGAGACAGGCCTTGG + Intronic
948920335 2:241063353-241063375 GCCTGGAGGAAGGCATGGCCTGG + Intronic
948939051 2:241187230-241187252 CCCTGGACGAGGGCTGGACTGGG - Intergenic
949056892 2:241932651-241932673 ACATGGAGCTAGGCAGGACGGGG - Intergenic
1169344751 20:4821429-4821451 CCCTGGAGGAAGGCACGAAAAGG + Intronic
1169554599 20:6735992-6736014 AGCTGGAGGAAGGCAGCAATTGG - Intergenic
1170421565 20:16198594-16198616 ACCGGGAGGAGGGGAGGAGTAGG - Intergenic
1170596229 20:17807702-17807724 ACCTAGTGGTAGGCAGGATTTGG + Intergenic
1170604683 20:17866679-17866701 ACCTGGTGGAAGGAATGTCTTGG - Intergenic
1172871853 20:38141192-38141214 AGCTGGAGGGCGGCAGAACTAGG - Intronic
1173031300 20:39363329-39363351 ACCTGTAGAAAGACAGGAATTGG + Intergenic
1175143717 20:56880314-56880336 AGCAGGAGGAAGGCCGGATTGGG - Intergenic
1175782849 20:61694595-61694617 ACTTGGAGGAAGGCTGAACTGGG + Intronic
1176875607 21:14123988-14124010 ACCTGGACCAAGTCTGGACTGGG - Intronic
1178177353 21:30118371-30118393 ACCAGGAGGAAAGCAGGTTTGGG - Intergenic
1178301394 21:31456341-31456363 ACCTGGCGGAACCCAGGACCAGG + Intronic
1179043847 21:37828467-37828489 ACCAGGGAGAAGGCAGGCCTGGG + Intronic
1179375983 21:40850134-40850156 AGCTGCAGGAAGACAGAACTGGG - Intergenic
1179712671 21:43272366-43272388 GCCTGGAGGGAGGCAGGGCCAGG + Intergenic
1179878850 21:44285184-44285206 ACCTGGAGGAAGGAAGGAGGGGG + Intergenic
1179923501 21:44520329-44520351 ACCAGGAGGAAGTGAGGGCTGGG - Intronic
1180715953 22:17872435-17872457 ACATGGAAGAAGGCAGGAAGGGG + Intronic
1180728230 22:17961830-17961852 AACTGGAGGCAGGCAGGCCGTGG - Intronic
1181062757 22:20289854-20289876 GAATGGAGGAAGACAGGACTCGG - Intergenic
1181278556 22:21702711-21702733 GCCTGGGGGAGGGGAGGACTCGG + Intronic
1181306348 22:21919393-21919415 GTCAGGAAGAAGGCAGGACTCGG + Intergenic
1181307709 22:21926500-21926522 CCCTGGAGGAACCCAGGCCTGGG - Intronic
1181747830 22:24968120-24968142 ATCTGCATCAAGGCAGGACTTGG - Intronic
1182401849 22:30084268-30084290 ACATGGAGGAAGGCATCACCTGG + Intronic
1182431643 22:30302368-30302390 TCCTGCAGGGAGGCAGGGCTGGG - Intronic
1182444896 22:30384371-30384393 CTATGGAGGATGGCAGGACTTGG - Exonic
1183948674 22:41340670-41340692 TCCTGGAGGAAGTGATGACTAGG + Intronic
1184326244 22:43789111-43789133 AACTGGAAGAAGGGAGGAATGGG + Intronic
1184499156 22:44861536-44861558 AACTGGAGGGAGGCAGGGCCAGG - Intronic
1184681468 22:46074480-46074502 ACATGGACAAAGGCAGGACAGGG - Intronic
1184798065 22:46743208-46743230 GACTGGAGGCAGGCAGGTCTGGG + Intergenic
1184822096 22:46917219-46917241 CCATGGAAGAAGGCAGGTCTAGG + Intronic
1185037646 22:48488378-48488400 ACCTGCAGGAAGGCAGAGCTTGG + Intergenic
949772074 3:7589936-7589958 ACCTGTATGAAGGGAGGCCTTGG - Intronic
949881520 3:8664645-8664667 ACCTGGAGGACAGCAGAGCTGGG + Intronic
950156065 3:10722567-10722589 ACAAGCAGGAAGGCAAGACTTGG + Intergenic
950319196 3:12034596-12034618 ACATGGGGGAAGGCATGACATGG + Intronic
950767188 3:15281544-15281566 ACCTGTAGAGAGGCAGGACTGGG - Intronic
951251616 3:20400506-20400528 ACCGGGAGGAAGGCAGTAGGTGG + Intergenic
952197648 3:31092954-31092976 ATCTGGGGGAAGGTATGACTGGG - Intergenic
952317035 3:32239975-32239997 CCCTGCAGAAAGGCAGGCCTGGG - Intronic
952954327 3:38547779-38547801 GGCTGGGGGAAGGCAGGAGTGGG + Intergenic
952983078 3:38754206-38754228 TCCTGGAGGAAGGCATAATTGGG - Intronic
953477007 3:43213668-43213690 CCATTGAGCAAGGCAGGACTGGG + Intergenic
953870877 3:46626770-46626792 TCCCAGAGGAAAGCAGGACTGGG + Intergenic
954036948 3:47855983-47856005 ACATGGACCAAGGCAGGCCTGGG + Intronic
954376606 3:50197376-50197398 AGCCGGGGGAAGGCAGGAATGGG - Intergenic
954440446 3:50518911-50518933 CCCTGGTGGAAGTCAGGACCTGG + Intergenic
959350074 3:105250737-105250759 ATCTGGAGGTGGGCTGGACTGGG - Intergenic
960796618 3:121494657-121494679 ACCAAGGGGAAGGCAAGACTGGG + Intronic
961142582 3:124567578-124567600 GCCTGTGGAAAGGCAGGACTAGG - Intronic
961371251 3:126433330-126433352 TCCTGGAGGGAGGCAGGGCAAGG - Intronic
961394743 3:126578896-126578918 ACCTAGAGGAAGAGAGGCCTGGG + Intronic
961470713 3:127109738-127109760 ACCTGGATCAAGCCAGGCCTGGG + Intergenic
961530594 3:127537635-127537657 ACCTGGAGGAAGGGTGTGCTGGG - Intergenic
961793486 3:129393153-129393175 ACCAGGAGGTAGGCAGGGCCCGG - Intergenic
961807483 3:129499771-129499793 ACCAGGAGGTAGGCAGGGCCCGG - Intronic
961821942 3:129579602-129579624 ACCATGAGCAGGGCAGGACTGGG + Intronic
961838669 3:129687750-129687772 AGGTGGAGGAAGGCAGGATAAGG - Intronic
962241659 3:133755574-133755596 CCCTGTAGGCAGGCAGGGCTCGG - Intronic
962456001 3:135566337-135566359 AGATGGAGGAAGGCAGCAGTTGG + Intergenic
962886917 3:139636074-139636096 ACCTGGAGGTAGGCAGCCCGGGG - Intronic
963123180 3:141793483-141793505 GCCATGAGGAAGGCAGGACTGGG + Intronic
964673737 3:159254979-159255001 AGCTGGAGGAAGGCACTGCTTGG - Intronic
964741509 3:159971197-159971219 ACCAGTAGGAAGGAAGGTCTGGG + Intergenic
965622550 3:170655728-170655750 ACCTGGAGTCAGGCTGGCCTGGG - Intronic
968020806 3:195387085-195387107 TCCAGGAGGAAGGACGGACTTGG + Intronic
968718482 4:2179853-2179875 GGCTGGAGGAGGGCAGGACTTGG - Intronic
968856214 4:3125710-3125732 ACCTGGTGGACAGCACGACTGGG + Intronic
971325316 4:25638680-25638702 AGAGGGGGGAAGGCAGGACTGGG + Intergenic
972907922 4:43774025-43774047 GACTGGAGGAAGGTAGGAATGGG + Intergenic
972953953 4:44366309-44366331 ACCTGATGGGAGGTAGGACTTGG + Intronic
973671367 4:53221748-53221770 AACTGGAAGAAGGCAGAACAAGG + Intronic
975278222 4:72527798-72527820 ACCAAGAGGAAGGAAGGACAGGG + Intronic
975516466 4:75253815-75253837 ACTTGGAGGAAATCAGAACTGGG + Intergenic
976191458 4:82491052-82491074 ATCAAGAGGAAGGCAAGACTGGG - Intronic
978804737 4:112788312-112788334 ATCAAGAGGAAGGCAAGACTGGG - Intergenic
980874090 4:138643219-138643241 ACATGGAGTAAGGCAGGAGGAGG + Intergenic
982130896 4:152227807-152227829 GCCTGGAGGCAGGAAGGACAGGG - Intergenic
982183185 4:152767829-152767851 ACATAGAGGAATACAGGACTAGG + Intronic
984739438 4:183146152-183146174 ACCTGGAGGGAGAAAGGACTGGG - Intronic
986026913 5:3859531-3859553 CCCTGGGGCAAGGCATGACTTGG + Intergenic
986070789 5:4280438-4280460 ACCTGGAGGAAAGCATCCCTGGG - Intergenic
986704690 5:10445398-10445420 AACTTGAGTAAGGCGGGACTTGG + Intronic
988734720 5:34008389-34008411 CCCTAGAGCAAGGCAGGAGTAGG - Intronic
990298884 5:54431060-54431082 ACCAGGAGGTGGGCATGACTGGG + Intergenic
992262858 5:74988259-74988281 AGCTGGAGGAAGGGAGGAATAGG - Intergenic
993127025 5:83847806-83847828 ATCTGGAGGAAGGATGTACTGGG - Intergenic
993332432 5:86617364-86617386 ACCTGGAGCTAGCCTGGACTAGG - Intergenic
993416850 5:87644490-87644512 GCTTGGAGGAAGTCAGGAGTTGG + Intergenic
993416918 5:87645716-87645738 GCTTGGAGGAAGTCAGGAGTTGG - Intergenic
994812093 5:104532938-104532960 ACTTGGAGGAAGGCAGAGCGGGG + Intergenic
997024002 5:130036629-130036651 AGCTGGAGCCTGGCAGGACTAGG - Intronic
997293853 5:132757403-132757425 GGCAGGAGGAAGCCAGGACTTGG + Intronic
997581350 5:135019400-135019422 ACCCGGAGGTAGGCTGGGCTGGG + Intergenic
997657200 5:135564185-135564207 ACCTGGAGCCAGGCAGCTCTGGG - Intergenic
997897405 5:137731995-137732017 AGCTGGAGGGAGGGAGGAGTGGG - Intronic
998420984 5:141986504-141986526 ACATGGAATAAGGCAAGACTGGG - Intronic
998442731 5:142175718-142175740 ACCTGGAGGGAGTCAGGAACGGG + Intergenic
999264955 5:150260845-150260867 ACGTGGAGGAAGGCAGGGAGAGG - Intronic
999301530 5:150493740-150493762 AACATGAGGAAGGCAGGATTGGG + Intronic
999803177 5:155056769-155056791 CCCTGAAGGAGGGGAGGACTTGG + Intergenic
1000850676 5:166336327-166336349 GCCTGGTGGAAGGGAGGAATGGG + Intergenic
1001275160 5:170345298-170345320 ACATGGAAGAAGGCAGAACCAGG - Intergenic
1001426389 5:171625408-171625430 ACCTGGAGAAAGGGAGAGCTGGG + Intergenic
1001937194 5:175713926-175713948 CCAAGGAGGAAGGCAGGACTTGG - Intergenic
1002104942 5:176875378-176875400 AACTGGGGGAAGCCAGGAATGGG - Intronic
1002197046 5:177507094-177507116 AGCTGGAGGAAGGGAGAAGTGGG - Intronic
1002310172 5:178309345-178309367 GCCTGGAGCTGGGCAGGACTGGG + Intronic
1002880012 6:1242896-1242918 AACTGGAGGCAGGCTTGACTGGG - Intergenic
1003503896 6:6724641-6724663 CCCTCCAGGAAGGCAGGCCTGGG + Intergenic
1003570854 6:7255468-7255490 CCATGGAGGAAGGCAGGGCTGGG - Intergenic
1004237936 6:13891335-13891357 ACCTGGAGCAAAGCAGGAAAGGG - Intergenic
1004565932 6:16797835-16797857 GCCAGGAGGATGGCAAGACTTGG + Intergenic
1004702735 6:18094123-18094145 AGCTGGGGGAAGAGAGGACTGGG - Intergenic
1005493945 6:26372533-26372555 ACATGGAGGGAGGGAGGACAGGG + Intronic
1006330956 6:33390729-33390751 TCCTGGAGGTAGTCAGGACAGGG - Intergenic
1007169454 6:39852425-39852447 GCCTAGAGGAAGGCAGAGCTGGG + Intronic
1007519649 6:42441776-42441798 AGCTTGGGGAAGGCAGAACTGGG - Intronic
1009623045 6:66100370-66100392 TCCTGGAGGAAGGCATGCCTGGG - Intergenic
1010176155 6:73030598-73030620 AAGAGGAGGAAGGCAAGACTAGG + Intronic
1010473068 6:76252574-76252596 ACCTGGAGTAAGTGAGGAATGGG - Intergenic
1011997290 6:93608393-93608415 ACCTGGGGGAAGGCAGAACAGGG + Intergenic
1016237572 6:141887069-141887091 AGCAGGAGGAAGGCAGGGGTAGG + Intergenic
1016268119 6:142255997-142256019 ACCTAGAGGAAGGAGGCACTAGG - Intergenic
1016779866 6:147945257-147945279 ATCTTGAGCAAGGCAGCACTTGG - Intergenic
1017344807 6:153368559-153368581 GCCTGGAGCAAGGCAGGAGAGGG - Intergenic
1018743049 6:166744710-166744732 ACCTGGGGGCATGCAGGCCTGGG + Intronic
1019024600 6:168948589-168948611 ACCAGGAGGAAGTCAGGATGTGG + Intergenic
1019139783 6:169936057-169936079 GCCTGGGGGCAGGCAGGCCTGGG - Intergenic
1019160270 6:170064676-170064698 ACCAGGAGGGTGGTAGGACTTGG - Intergenic
1019707566 7:2503805-2503827 GGATGGAGGAAGGCAGGGCTGGG - Intergenic
1019710013 7:2513903-2513925 ACCAGGAGGACGGCAGGCCTGGG - Intronic
1019883741 7:3885571-3885593 AGAGGGAGGAAGGCAGGGCTGGG - Intronic
1022071739 7:26922661-26922683 ATCAAGAGGAAGGCAAGACTGGG + Intronic
1022648530 7:32254021-32254043 AAATGGAAGAAGGCAGGACAGGG + Intronic
1023017415 7:35981861-35981883 ACCAGCAGGAAGCCAGCACTGGG - Intergenic
1023104158 7:36747184-36747206 ACCAGGAGCAAGGGAGGACAAGG + Intergenic
1024136465 7:46413590-46413612 ATCTGGAGGAGGGCAGGACCTGG - Intergenic
1027499666 7:78933136-78933158 AAATGCAGGAAAGCAGGACTGGG + Intronic
1027622029 7:80500152-80500174 ACCAGGAGTGAGGCAGGTCTAGG - Intronic
1028168769 7:87570171-87570193 ATCTGGAGGAAGACATGACCAGG - Exonic
1031096786 7:117429559-117429581 ACCTTGAGGAAGCCTGGTCTTGG + Intergenic
1032110446 7:129071106-129071128 AAATGGAGGAAGGCTGGGCTGGG - Intergenic
1032458532 7:132092545-132092567 ACCTGGAGGAAGGCCATGCTAGG + Intergenic
1034534790 7:151719981-151720003 ACCTGGAGGAGCCCAGGACTGGG - Intronic
1037516317 8:19635383-19635405 ACCAGTAGGCAGGTAGGACTTGG - Intronic
1037990965 8:23320926-23320948 ACCAGGAGGAAGGGTGGGCTTGG + Intronic
1038086658 8:24205511-24205533 ACCTGTAGGAATGCAAGAGTGGG - Intergenic
1038415262 8:27390221-27390243 GCATGGAGGAAGGCAGGGCTGGG + Intronic
1039828677 8:41195531-41195553 GCGTGGAGGCAGGAAGGACTGGG + Intergenic
1042662157 8:71166502-71166524 ACTTGGAGGGAAGCCGGACTAGG - Intergenic
1044747983 8:95389592-95389614 TACTGGAGGAAGGCTGGATTTGG + Intergenic
1045912178 8:107423548-107423570 AGAGGGAGGAAAGCAGGACTAGG - Intronic
1046590597 8:116201275-116201297 ACCTGGAGGGAGGGGGGAATAGG + Intergenic
1047660522 8:127029541-127029563 ACCTGGAGAAAGGGATGACATGG + Intergenic
1048219919 8:132531716-132531738 ACCTGGGTGAGGGCAGAACTAGG - Intergenic
1048615619 8:136072207-136072229 TCCTGGAGGAATTCAGGCCTTGG + Intergenic
1048878025 8:138852031-138852053 AACTACAGGAAGGCAGGAATTGG + Intronic
1049071560 8:140359329-140359351 ACAAGGAGGAAGGCAGGTTTGGG + Intronic
1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG + Intergenic
1049280705 8:141742708-141742730 TTCTGCAGGATGGCAGGACTGGG + Intergenic
1049356770 8:142192956-142192978 AGCAGGAGGAAGGGAGGAGTAGG + Intergenic
1049709689 8:144057922-144057944 ACCTAGGGGAAGGAAGGGCTGGG + Exonic
1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG + Intronic
1051878529 9:21816197-21816219 ACCAGGATGACTGCAGGACTGGG - Intronic
1051964172 9:22805914-22805936 ACCTGGAGGAAAGAAGAACTTGG - Intergenic
1052325971 9:27217057-27217079 GCCTGGAGGCAGTCAGGACCAGG + Intronic
1053677586 9:40451144-40451166 ACCAGGAGGAATGAAAGACTGGG - Intergenic
1053927504 9:43078981-43079003 ACCAGGAGGAATGAAAGACTGGG - Intergenic
1054286135 9:63173767-63173789 ACCAGGAGGAATGAAAGACTGGG + Intergenic
1054290659 9:63286670-63286692 ACCAGGAGGAATGAAAGACTGGG - Intergenic
1054388680 9:64591217-64591239 ACCAGGAGGAATGAAAGACTGGG - Intergenic
1054507036 9:65925154-65925176 ACCAGGAGGAATGAAAGACTGGG + Intergenic
1056535264 9:87521570-87521592 TCCTAGCGGAAGGCAGGACATGG - Intronic
1056745348 9:89296627-89296649 ACCAGGAGGAAGCCAGGAGAAGG - Intergenic
1057003445 9:91534125-91534147 GCCTGCAGGAAGTCAGGACCTGG - Intergenic
1057265267 9:93613299-93613321 GCCTGCAGGAAGGCAGCTCTGGG + Intronic
1057317295 9:93977888-93977910 ACCTGGAGGAGGGCAGCCCCTGG + Intergenic
1057329552 9:94100528-94100550 CTCTGGAGTAAGGCAGAACTGGG + Intronic
1057330384 9:94108900-94108922 AGCTGGAGGAAGTCAAAACTGGG + Exonic
1058053116 9:100426352-100426374 GTCTGGAGGAAGGAGGGACTGGG + Intergenic
1058991136 9:110256188-110256210 CCCTGGAGGAAGGGAGGAGAAGG - Intronic
1059783256 9:117552218-117552240 AGCTGGGGGAAGTCAGGAATGGG + Intergenic
1059808838 9:117833731-117833753 GACTGGAGGTAGGCAGGGCTGGG + Intergenic
1060202007 9:121656857-121656879 ACCTGGAGGTGGGCAGAGCTGGG - Intronic
1060505665 9:124196843-124196865 AGCTTCAGGAAGGCAGGAGTAGG + Intergenic
1060666860 9:125436867-125436889 ACCTGGTGGAAAGCAGAAGTGGG + Intergenic
1060692500 9:125676604-125676626 AGCTGGAGGAAGGTAGTAATGGG + Intronic
1060748416 9:126153149-126153171 ACCTGGGCCAAGCCAGGACTAGG - Intergenic
1060859802 9:126945075-126945097 ACCTGGAGGAGGGCAGCAGTGGG - Intronic
1061664804 9:132154289-132154311 ACCAAGAGGGAGGCAGGACGAGG + Intergenic
1061805518 9:133135535-133135557 ACCTGGGGGCAGGCAGGGTTGGG - Intronic
1061848981 9:133403608-133403630 AGCTGGAGGAAGGCAGCAGATGG + Intronic
1061894982 9:133642495-133642517 CCCGGGAGGAAGGCAGGGCTGGG - Intronic
1062168819 9:135122789-135122811 GCCTGGAGGAACGCAGGCCAAGG - Intergenic
1062177213 9:135170392-135170414 CCCTGGAGGAAGGCTGGGGTGGG + Intergenic
1062614018 9:137387932-137387954 ACCTGCAGACAGGCAGGTCTAGG + Intronic
1186500506 X:10046926-10046948 CCCTTCAAGAAGGCAGGACTGGG - Intronic
1186714297 X:12233812-12233834 AGCTTGGTGAAGGCAGGACTTGG + Intronic
1187970062 X:24649956-24649978 AGCAGGAAGAAGCCAGGACTAGG - Intronic
1188193233 X:27197361-27197383 ACCCGGAGGCAGTTAGGACTGGG + Intergenic
1189335949 X:40171127-40171149 ACCTGGAGGAAGGAGGGTGTAGG - Intronic
1189742247 X:44131706-44131728 AGCTGGAGGAAGGAAGGAATGGG - Intergenic
1190370862 X:49739493-49739515 CCCAGGAGGAAGGCTGGCCTTGG + Intergenic
1190969243 X:55332926-55332948 ATGAGGAGGAAGGCAGCACTTGG - Intergenic
1192450989 X:71244779-71244801 ACCATGAGGAAGGTAGGGCTGGG - Exonic
1195353736 X:104018751-104018773 GTCTGGAGGCAGGCAGGAGTGGG + Intergenic
1195764877 X:108285533-108285555 ATCTGCAGGAAGTCAGGCCTGGG - Intronic
1197249850 X:124204205-124204227 GGCTGGGGGAAGGCAGAACTAGG - Intronic
1198215208 X:134549355-134549377 ACAGGGAGGAAGGAAGGGCTGGG + Intergenic
1198378352 X:136061382-136061404 CTCTGGAGGAAGGCTTGACTTGG - Intergenic
1199766935 X:150948167-150948189 ATCTGGAGGCAGGCAGGGCAGGG - Intergenic
1200126501 X:153817530-153817552 ACCTGGAGGAAGGGGGGCCTGGG + Intronic
1201468260 Y:14309144-14309166 ACCTGGAGCAAGTGAGGGCTGGG - Intergenic