ID: 902329309

View in Genome Browser
Species Human (GRCh38)
Location 1:15723345-15723367
Sequence GGGACTTTTTCCAGATTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902329309_902329315 -1 Left 902329309 1:15723345-15723367 CCCGGAAATCTGGAAAAAGTCCC 0: 1
1: 0
2: 3
3: 18
4: 212
Right 902329315 1:15723367-15723389 CCGATGTTGCTGGTCTTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902329309 Original CRISPR GGGACTTTTTCCAGATTTCC GGG (reversed) Intronic