ID: 902329674

View in Genome Browser
Species Human (GRCh38)
Location 1:15725190-15725212
Sequence CACCCCTGTCAGGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902329665_902329674 18 Left 902329665 1:15725149-15725171 CCCATGTCCTGTTAGGTTGTGGC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 164
902329667_902329674 11 Left 902329667 1:15725156-15725178 CCTGTTAGGTTGTGGCTTCTACT 0: 1
1: 0
2: 1
3: 11
4: 80
Right 902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 164
902329666_902329674 17 Left 902329666 1:15725150-15725172 CCATGTCCTGTTAGGTTGTGGCT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 164
902329663_902329674 19 Left 902329663 1:15725148-15725170 CCCCATGTCCTGTTAGGTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902329674 Original CRISPR CACCCCTGTCAGGTTTCCCT GGG Intronic
901151244 1:7103185-7103207 CACCCTTGCCTGGTTGCCCTAGG + Intronic
901631652 1:10651038-10651060 CACCCCAGCCAGGTTCCCCCCGG - Exonic
901805970 1:11738794-11738816 CAGCCCTGACTGGTGTCCCTGGG + Intronic
902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG + Intronic
902597980 1:17522080-17522102 TACCACTGTCAGGGTTTCCTTGG + Intergenic
906124410 1:43418608-43418630 CACAACTGTCAGTTTTCTCTGGG + Intronic
907907205 1:58793757-58793779 GACCCTTGTCAGATTTCCCCAGG - Intergenic
913958805 1:143323925-143323947 CACCCCTCACATCTTTCCCTAGG - Intergenic
914053122 1:144149305-144149327 CACCCCTCACATCTTTCCCTAGG - Intergenic
914126075 1:144817236-144817258 CACCCCTCACATCTTTCCCTAGG + Intergenic
915311108 1:155006203-155006225 CAGCCCTCTCTGGTCTCCCTGGG - Intronic
918887533 1:190214569-190214591 CACACCTGCCAGGATTCCATTGG - Intronic
920060698 1:203225147-203225169 CATCCCTGCCAGGGTGCCCTGGG - Intronic
920684228 1:208096809-208096831 CACCTCTGTCAGGTTCCCAAAGG + Exonic
922181767 1:223241427-223241449 AACCCCTGTCTTGTTTCCCTTGG + Intronic
1063956304 10:11270775-11270797 CAGCCCTGTCAGGTTCCCCCAGG - Exonic
1065976212 10:30845169-30845191 GGGCCCTGGCAGGTTTCCCTTGG + Exonic
1066366534 10:34782349-34782371 GTCCCCTGTCAAGATTCCCTGGG - Intronic
1067769350 10:49112140-49112162 TACCCCAGTCAGGTTCCCCAAGG + Intronic
1070285996 10:75084130-75084152 CACACCAGGCAGGCTTCCCTGGG + Intergenic
1073972641 10:109061649-109061671 CACCCCTGTCATGAGTCCATTGG + Intergenic
1073977531 10:109117988-109118010 CACCCCAGCCAAATTTCCCTTGG - Intergenic
1074704813 10:116121264-116121286 CTCCCCTGCCAGGTTTCCTCTGG - Intronic
1075900387 10:126038293-126038315 CAACCCTGTCAGGCTCACCTCGG - Exonic
1077545767 11:3169089-3169111 GACACCTGCCCGGTTTCCCTGGG + Intergenic
1077595188 11:3525944-3525966 CTCCCAGGACAGGTTTCCCTGGG - Intergenic
1078258734 11:9683967-9683989 CACAAATGTGAGGTTTCCCTCGG - Intronic
1084004232 11:66314778-66314800 CACCCCTGTGAGGCTGCCCCTGG + Exonic
1089165988 11:116477032-116477054 CACCCCTGCCAGATTTCCAAGGG - Intergenic
1089361184 11:117887723-117887745 CACCCCTGGCTGATGTCCCTGGG - Intergenic
1089640666 11:119845364-119845386 CACCCCTGCCTTGATTCCCTGGG + Intergenic
1090068050 11:123519941-123519963 CACAGCTTCCAGGTTTCCCTTGG + Intergenic
1090381378 11:126329882-126329904 CAGCTCTCTCGGGTTTCCCTGGG + Intronic
1093977195 12:25436352-25436374 CTCCCGAGCCAGGTTTCCCTTGG - Intronic
1094396809 12:30015755-30015777 CACTCCTGTCAGGGTTTCCTAGG + Intergenic
1096453463 12:51765747-51765769 CACCAGTGTCAGGTTGCCCAGGG - Exonic
1096656734 12:53097046-53097068 TACCCCAGTCTGGTTCCCCTCGG + Intergenic
1103113230 12:118301177-118301199 CACACCTGCCAGGGTTTCCTTGG + Intronic
1106292662 13:28379541-28379563 CACCGCTGTCAGGCTTCTCAGGG - Intronic
1111864632 13:93753285-93753307 CAACACTGTCAGCTTTTCCTCGG + Intronic
1112980356 13:105376965-105376987 CACCCCCATCAGGTATTCCTTGG - Intergenic
1113764086 13:112870021-112870043 CACCACGGCCAGGTGTCCCTGGG + Intronic
1114306851 14:21431232-21431254 CACCCATGAAAGGATTCCCTTGG + Exonic
1114686198 14:24534085-24534107 CACCCCTCTCAGTTTTTCATTGG - Intergenic
1117189750 14:53278285-53278307 CACCACTGTGAGGGGTCCCTGGG + Intergenic
1120275650 14:82369914-82369936 CTGCCCTGTCAGGTGTCCCCTGG - Intergenic
1120320497 14:82954291-82954313 CACTCCTGTCTGCTTTCCCATGG - Intergenic
1121324667 14:93012964-93012986 CACACCTGTCAGGTGGCTCTGGG + Intronic
1121405560 14:93717394-93717416 CACCCCTGCCTGGCTTCCCTGGG - Intergenic
1122028446 14:98894970-98894992 CACCCCTGCCAGCCCTCCCTGGG - Intergenic
1122874650 14:104658378-104658400 CACCTCTGTCATGGTTCACTCGG - Intergenic
1124621125 15:31274719-31274741 CACCCCTGCTGGGTGTCCCTTGG + Intergenic
1125605356 15:40937114-40937136 CACACATGTCAAGTGTCCCTAGG + Intronic
1128072482 15:64806517-64806539 CACCCCTGTCAGGCTGGACTGGG - Intergenic
1128153393 15:65377362-65377384 CTCCCCTGGCTCGTTTCCCTCGG + Intronic
1132626411 16:893737-893759 CACACCCGTCTGCTTTCCCTGGG + Intronic
1133644792 16:7754168-7754190 CACCTGTGGCAGGTTTGCCTGGG + Intergenic
1134204353 16:12224824-12224846 GAACCCTGTCACGTTTGCCTGGG - Intronic
1136616830 16:31403624-31403646 CACCACTGTCAGGATGCCCGTGG - Exonic
1137396133 16:48117258-48117280 CACCTCAGTCAGGTCTCCATAGG + Exonic
1137669776 16:50272279-50272301 CACCCCGATCAGGGTGCCCTGGG - Intronic
1141027681 16:80563460-80563482 CTCCTCTGCCAGTTTTCCCTGGG + Intergenic
1142810022 17:2391491-2391513 GACCCCTGCAAGGTTTCCCCAGG + Intronic
1143449376 17:7026862-7026884 CACCTCTTGCAGGTTTGCCTTGG - Intronic
1143619676 17:8073747-8073769 CCCGCCGGTCAGGCTTCCCTAGG - Exonic
1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG + Intergenic
1148227762 17:45910838-45910860 CAGCCCTGCCAGGTTCTCCTAGG + Intronic
1151712501 17:75814790-75814812 GAACCCTGTCAGGATACCCTGGG - Intronic
1153622096 18:6989141-6989163 CATCTCTGACAGGCTTCCCTGGG + Intronic
1153811174 18:8753153-8753175 CACCCATGTTGGGCTTCCCTGGG - Intronic
1157374944 18:47153808-47153830 CACTCTTGTCAGGCTTCCCAAGG - Intronic
1162039500 19:7961465-7961487 GAAGCCTTTCAGGTTTCCCTGGG - Exonic
1162057900 19:8075863-8075885 CACTATTGTCAGGTTTCCATGGG - Intronic
1163791113 19:19306571-19306593 GACCTCTGTCAGGTTTCCCAGGG - Intronic
1164788556 19:30957110-30957132 CACACCTGGCAGGTTTCACATGG + Intergenic
1165943319 19:39426231-39426253 CACATCTGTCTGATTTCCCTTGG + Exonic
1168559539 19:57371451-57371473 CAGCCCTGCCTTGTTTCCCTTGG - Intronic
1202692517 1_KI270712v1_random:101728-101750 CACCCCTCACATCTTTCCCTAGG - Intergenic
925003702 2:426177-426199 CATCCCTGTCTTGTTTCCCCTGG - Intergenic
925994786 2:9283421-9283443 GACCCATGTCGGGTTTCCCATGG - Intronic
927513168 2:23657146-23657168 CACCCCTGCCAGCTCTTCCTGGG + Intronic
927970718 2:27304879-27304901 CACCCCAGCCAGGGTTGCCTAGG - Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
931151871 2:59583536-59583558 CATCCCTGACAAGTTTCCTTGGG + Intergenic
932394973 2:71437699-71437721 CACTGCTGACAGGTTTCCCCAGG + Intergenic
933239782 2:79907506-79907528 CTCCCCTCTCAGCTTTCCTTTGG + Intronic
933588042 2:84201060-84201082 CAACCCTGTCAGATTACCCAAGG - Intergenic
933709529 2:85315347-85315369 CACCCCTGTGGGGAGTCCCTAGG + Intergenic
933713536 2:85344427-85344449 CACCCCTGTGGGGAGTCCCTAGG - Intronic
941978999 2:171434440-171434462 TCCCCGTGTCAGCTTTCCCTGGG + Exonic
948879858 2:240851134-240851156 CACACCCGTCAGGATTCCCAAGG + Intergenic
1171726391 20:28625233-28625255 CTCCCCTGTTAGGTTTCCCAGGG + Intergenic
1171790581 20:29519729-29519751 CTGCCCTGTTAGGTTTCCCAGGG + Intergenic
1171857127 20:30357109-30357131 CTCCCCTGTTAGGGTTCCCAGGG - Intergenic
1175546514 20:59781487-59781509 CCCCCTTGTCAGGTTGTCCTGGG + Intronic
1175664087 20:60843607-60843629 GTCCCCTGCCAGTTTTCCCTTGG - Intergenic
1175776105 20:61654741-61654763 CACCACTGTCAGCTTTGCCCAGG + Intronic
1175838994 20:62014776-62014798 CACAGCTGTCAGCTTCCCCTGGG - Intronic
1179271322 21:39853314-39853336 CATCCCTGGCAGGTGTCCCCGGG + Intergenic
1179888734 21:44325512-44325534 CACCCCTGCCAGGCCTCCCGCGG + Intronic
1180391279 22:12284842-12284864 CTCCCCTGTTAGGGTTCCCAGGG + Intergenic
1180408461 22:12579911-12579933 CTCCCCTGTTAGGGTTCCCAGGG - Intergenic
1180559799 22:16606836-16606858 GACCACAGTCAGGTTTCTCTGGG + Intergenic
1180968538 22:19802972-19802994 CAGCCATGCCAGGTTTCTCTGGG - Intronic
1182004540 22:26948940-26948962 CAGCTCTGTCAGTTTTCCCATGG - Intergenic
1182303040 22:29349435-29349457 GGCCCCTGTCTGGCTTCCCTGGG - Intronic
1183740514 22:39666277-39666299 AACTCCTGTCAGGGGTCCCTGGG - Intronic
949720800 3:6987829-6987851 GACCACTGTCAGATTTCCCCTGG - Intronic
950888894 3:16385753-16385775 CACCTCTGGCAGATTTTCCTTGG + Intronic
952070389 3:29627478-29627500 CACCCCAGTCAGGATGTCCTAGG + Intronic
953011221 3:39027190-39027212 CATCCCTGTCTTGTTTACCTTGG + Intergenic
954111286 3:48434814-48434836 CACCTCTGTCACCTTTCCCTGGG + Exonic
954701437 3:52452881-52452903 CACCCTGGTCAGGTTACCGTGGG - Intronic
954927831 3:54252799-54252821 CACCCCTCTCATGGTGCCCTTGG - Intronic
955127263 3:56125617-56125639 CTTCCCTATCAGATTTCCCTGGG + Intronic
955326729 3:58014403-58014425 CACCCCTTTCAGGAATCTCTGGG + Intronic
960416718 3:117393888-117393910 CACCATTTTCAGGCTTCCCTAGG - Intergenic
960996990 3:123346770-123346792 CTCCCCAGGCAAGTTTCCCTAGG - Intronic
970880361 4:20921184-20921206 CAATCCTGTCAGTTTTGCCTCGG - Intronic
972334980 4:38099722-38099744 CTCCACTGCCAGGTTTCTCTTGG + Intronic
975763015 4:77636249-77636271 CACCACTGTGAGGGGTCCCTGGG + Intergenic
987972750 5:24970383-24970405 CTCCTCTGTCAGCTTTCCTTTGG - Intergenic
988438608 5:31206518-31206540 CACCCTTGCGAGGTTTCCCTTGG - Intronic
992761245 5:79952515-79952537 CAACCCCCTCAGGATTCCCTGGG + Intergenic
998390222 5:141782739-141782761 CAGCCCTGTCATGTTTCTCTTGG - Intergenic
1000183436 5:158835557-158835579 GACCCCTCTCAGGCTTTCCTGGG + Intronic
1002632177 5:180589567-180589589 CACCGATGTCTGGGTTCCCTGGG + Intergenic
1003169912 6:3712982-3713004 CAGCCCTGCCAGGCTCCCCTGGG - Intergenic
1004947080 6:20627443-20627465 GATCCCTGGGAGGTTTCCCTTGG + Intronic
1006428691 6:33982224-33982246 CTCCCCAGGCAGGCTTCCCTTGG - Intergenic
1007515781 6:42410391-42410413 CTCCCCTGTCAGGTTCCCAAAGG + Intronic
1013296557 6:108762789-108762811 CACACCTGCCATGGTTCCCTTGG - Intergenic
1015202205 6:130595653-130595675 ACCCCCTGTCTGGTTTGCCTGGG + Intergenic
1018104154 6:160467101-160467123 CAGTCATGTCAGGTTTCTCTAGG + Intergenic
1018118524 6:160612486-160612508 CAGCCCTGTTAGGTTTCTCGAGG + Intronic
1018120926 6:160634677-160634699 CAGCCCTGTTAGGTTTCTCGAGG + Intronic
1018130875 6:160731657-160731679 CAGTCATGTCAGGTTTCTCTAGG - Intronic
1021744770 7:23728199-23728221 CACCTCTGTAAGATTTCCTTTGG + Intronic
1021895508 7:25231405-25231427 CACCCCCATCAGGTTTCAGTGGG - Intergenic
1022036041 7:26535670-26535692 AAGCCCTGTGAGGTTTTCCTAGG - Exonic
1024876385 7:54028830-54028852 CACCCCTGGCTGGTTTGCTTTGG - Intergenic
1025853846 7:65262168-65262190 CACCCCTCTCAGGTCACCATTGG - Intergenic
1028465676 7:91148703-91148725 CACCCCTCTCAGGATTTCCCAGG - Intronic
1030432620 7:109469966-109469988 CTCCCCTACCAGGTTTTCCTGGG + Intergenic
1032316314 7:130842052-130842074 CACCCCTGCCAAATTCCCCTGGG + Intergenic
1034617443 7:152430958-152430980 GACCACAGTCAGGTTTCTCTGGG - Intronic
1034883440 7:154779359-154779381 CACCACTGTCAGCTCTCACTTGG + Intronic
1035714284 8:1741998-1742020 CACCCAGGGGAGGTTTCCCTGGG - Intergenic
1039845541 8:41323172-41323194 CATCACAGTCAGCTTTCCCTGGG + Intergenic
1039906114 8:41787454-41787476 TACCCCTGTCAGGTTGGGCTGGG - Intronic
1042035328 8:64526738-64526760 CTCCCCTATTAGTTTTCCCTAGG - Intergenic
1044837081 8:96306227-96306249 CACCCCTGCCACCTCTCCCTGGG + Intronic
1047381167 8:124364937-124364959 CACTCTTGTCTGGTTTCCTTTGG - Intronic
1048204473 8:132404279-132404301 CACCCCTCTCTCTTTTCCCTGGG + Intronic
1048737193 8:137514849-137514871 CACCCCTTTCTGTTTTCCCTTGG + Intergenic
1049743780 8:144254427-144254449 CAGCACTGCCAGGTCTCCCTGGG + Intronic
1049860290 8:144893672-144893694 CACCTCTGCCAGGTTTCCAGGGG - Intronic
1051034950 9:12733356-12733378 CACACCTCACAGGTTTCCCAAGG + Intergenic
1052950093 9:34201854-34201876 CACTCATGTCAGGGTTCCCTCGG + Intronic
1053000985 9:34577328-34577350 TACCCCTGCCTGGTTTCCTTAGG - Intronic
1053723222 9:40970630-40970652 CTCCCCTGTTAGGGTTCCCAGGG - Intergenic
1054342742 9:63881363-63881385 CTCCCCTGTTAGGGTTCCCAGGG + Intergenic
1055439808 9:76326674-76326696 CCCCCCTGTAAGCATTCCCTGGG - Intronic
1057815709 9:98292530-98292552 CACACCTGTGAGGTGTCTCTTGG - Intronic
1061578769 9:131524026-131524048 CACCCGTGTCTGGGTTGCCTGGG - Exonic
1203761494 EBV:14689-14711 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203762423 EBV:17761-17783 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203763352 EBV:20833-20855 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203764281 EBV:23905-23927 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203765210 EBV:26977-26999 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203766139 EBV:30049-30071 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1203767068 EBV:33121-33143 CACCCGTCTCAGGGTCCCCTCGG + Intergenic
1185777148 X:2812504-2812526 CACCCCTTTCTGGTTTCCTTCGG - Intronic
1188569184 X:31561413-31561435 CACTCCAGCCAGGTTTCCTTAGG - Intronic
1189294340 X:39908289-39908311 GAGCCCTGTCAGGTCTCCCCGGG + Intergenic
1189699841 X:43707128-43707150 CACCCCTTTCCCATTTCCCTGGG - Intronic
1190737262 X:53263856-53263878 CACCCCCGTCCTGTTTCCCAAGG + Intronic
1196967742 X:121076883-121076905 CAGCATTCTCAGGTTTCCCTAGG - Intergenic
1201292864 Y:12438947-12438969 CACCCCTTTCTGGTTTCCTTCGG + Intergenic