ID: 902332380

View in Genome Browser
Species Human (GRCh38)
Location 1:15736889-15736911
Sequence CTGGGTCATGGGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 605}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902332380_902332396 12 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332396 1:15736924-15736946 CCCTGCAGCCTCCAAAGGCAGGG 0: 1
1: 0
2: 2
3: 54
4: 594
902332380_902332399 20 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332399 1:15736932-15736954 CCTCCAAAGGCAGGGCTCAGTGG 0: 1
1: 0
2: 5
3: 44
4: 459
902332380_902332394 11 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332394 1:15736923-15736945 GCCCTGCAGCCTCCAAAGGCAGG 0: 1
1: 0
2: 4
3: 47
4: 470
902332380_902332393 7 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332393 1:15736919-15736941 AGGGGCCCTGCAGCCTCCAAAGG 0: 1
1: 0
2: 1
3: 36
4: 286
902332380_902332403 30 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332403 1:15736942-15736964 CAGGGCTCAGTGGACCTGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 378
902332380_902332402 27 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332402 1:15736939-15736961 AGGCAGGGCTCAGTGGACCTGGG 0: 1
1: 0
2: 1
3: 25
4: 352
902332380_902332401 26 Left 902332380 1:15736889-15736911 CCCTCCACCATCCCATGACCCAG 0: 1
1: 0
2: 2
3: 60
4: 605
Right 902332401 1:15736938-15736960 AAGGCAGGGCTCAGTGGACCTGG 0: 1
1: 0
2: 1
3: 33
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902332380 Original CRISPR CTGGGTCATGGGATGGTGGA GGG (reversed) Intronic
900594040 1:3472375-3472397 CTGGGTCATGGGGAGGTGAGGGG + Intronic
901233700 1:7656032-7656054 CTAGGTCATTGCATGGTGGAAGG - Intronic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
901876987 1:12172497-12172519 CTGGGCCATGGGGTGGTGCTCGG + Intronic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
903121994 1:21222225-21222247 TTGGGGCCTGGGATGATGGATGG - Intronic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904400204 1:30251696-30251718 CTGGTCCATGGGCTGGAGGAAGG + Intergenic
904729753 1:32580819-32580841 AAGGATCATCGGATGGTGGAAGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905294120 1:36943290-36943312 CAGGGACCTGGGATGGGGGAGGG - Intronic
905832322 1:41081624-41081646 CTGGGTCATGCTATGTTGCAAGG - Intronic
906067592 1:42993318-42993340 CTGGGGCATGGCATGGTGCGCGG - Intergenic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
906798825 1:48718694-48718716 TTGGGTCATGGGATGCTGTCAGG + Intronic
906807221 1:48790971-48790993 CTGTGTCATAGCATGGTAGAAGG - Intronic
907274618 1:53310300-53310322 CTGGAGCATGGGATTGTGGCAGG - Intronic
907298811 1:53472363-53472385 CTGTGTCATTGGATGCTTGAAGG + Intergenic
907654051 1:56324246-56324268 CTGGGTCAAGGAATGCTGGTGGG + Intergenic
907660920 1:56391743-56391765 CTGGCTCATAGGCTGGTGCACGG - Intergenic
908388904 1:63667921-63667943 CTGTGTCCTGACATGGTGGAAGG + Intergenic
909454469 1:75834778-75834800 TGGGGTCAGGGGATGGGGGAGGG + Intronic
910117564 1:83749180-83749202 CTGCTTCATCGTATGGTGGAAGG + Intergenic
910203491 1:84724259-84724281 CTGGGGTATGGGCTGGTAGATGG + Intergenic
910643483 1:89489388-89489410 CTGGGGCTTGGAATGGGGGAAGG - Intergenic
911281596 1:95936212-95936234 CTCGGCCATGAGATGGGGGAGGG - Intergenic
911447257 1:98012456-98012478 CTTGGTCATGTGATTTTGGATGG + Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
914679959 1:149932078-149932100 ATGGGTCATGGGATGGAATAAGG + Intronic
914919307 1:151837012-151837034 CCGGCTCCTGGGAAGGTGGAGGG + Intergenic
915015495 1:152729185-152729207 CTGGGTCATTGGGTGTTTGATGG + Intergenic
915226409 1:154414906-154414928 CTGGGTCATGTGGCGCTGGAAGG + Intronic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916606139 1:166343790-166343812 TTGGCTCATGTGATTGTGGAGGG + Intergenic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
916912253 1:169363618-169363640 CTGGGTGGTGGGATGGTGCAGGG - Intronic
918345476 1:183603880-183603902 CTGGGACGTAGAATGGTGGAAGG + Intergenic
919434386 1:197538920-197538942 CTGTGTCATCCCATGGTGGAAGG - Intronic
919543814 1:198886218-198886240 CTGAGTCATAGGTTTGTGGATGG - Intergenic
921734572 1:218612365-218612387 CTGGGACATGGGTGAGTGGATGG + Intergenic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
924367713 1:243313553-243313575 CTGGATCATGGAATGTTGCAGGG + Intronic
924485739 1:244481776-244481798 CTGGGTCCTCGCATGGCGGAAGG - Intronic
924572999 1:245255146-245255168 CTGGGTCATAACATGGTGGAGGG - Intronic
924948411 1:248861428-248861450 CTGGGTGGTGGGCTGGGGGATGG - Intergenic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062940189 10:1415058-1415080 GTGGATCATGGGTGGGTGGATGG + Intronic
1062997192 10:1877531-1877553 CTGGGCCATGGGAGGGGGGGTGG + Intergenic
1063159790 10:3410761-3410783 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1064541214 10:16406848-16406870 CTGGGTCTTTCTATGGTGGAAGG - Intergenic
1064697840 10:17986469-17986491 CTGGTTCATGGACTGGTGAAGGG + Intronic
1065881886 10:30044091-30044113 CTGTGTCATCTCATGGTGGAAGG - Intronic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1067158498 10:43802644-43802666 CTGTGTCATGGGCTGGGGGTTGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067229728 10:44397720-44397742 CTGGGGCAGGGAATGGGGGAGGG + Intergenic
1067815878 10:49476623-49476645 ATGGGTCATGGGAGGTGGGATGG - Intronic
1068484236 10:57636134-57636156 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1069777029 10:70933254-70933276 CTGGGCCCAGGTATGGTGGAAGG + Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071822702 10:89294411-89294433 CTGGGTCATCCCATGATGGAAGG + Intronic
1071839124 10:89450607-89450629 TGGGGTCAGGGGATGGGGGAGGG + Intronic
1072106785 10:92282117-92282139 CTGGGCCATGCAATGGTCGAGGG - Intronic
1072764757 10:98086387-98086409 CTAGCTCATGGGACTGTGGAAGG - Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073759482 10:106613978-106614000 AGGGTGCATGGGATGGTGGAAGG - Intronic
1073982351 10:109169030-109169052 TTGGCTCATGGAATGGTGAAGGG - Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1076288986 10:129329657-129329679 TTGCTTCATGAGATGGTGGAGGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1077014990 11:395478-395500 AGGGGTCATGGGGTGGAGGACGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077109608 11:856299-856321 CTGGGGCCTGGTATGCTGGACGG + Intronic
1077424652 11:2468944-2468966 CTGTGTCATGGGGTGGGTGAGGG + Intronic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079044728 11:17091118-17091140 TTGGGGGATGGGATGGTGGGAGG + Intronic
1079101059 11:17542720-17542742 CTGAGTCTTGGGTTGGGGGATGG + Intronic
1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG + Intergenic
1079592834 11:22201662-22201684 CTGTGTCATAACATGGTGGAAGG + Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080803415 11:35630330-35630352 CAGGATCATGGGATGGTAGTGGG - Intergenic
1081797881 11:45834283-45834305 TGGAGTCAAGGGATGGTGGAAGG - Intergenic
1081885503 11:46492423-46492445 CTGGGCCATGTGATGGTTAAAGG - Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083764622 11:64835982-64836004 CTAGGCCAGGGGATGGTGGCTGG - Intronic
1083765246 11:64838482-64838504 CTGGGCCAGCGGATGGTGGCTGG + Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084266208 11:68006642-68006664 CTGGCTCACAGGATGGTGGGAGG + Intergenic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085254441 11:75164483-75164505 CTGGGCCTTGGGATGGTCGCGGG + Intronic
1085333439 11:75671460-75671482 CAGGGTCATTGGATGGTCCAGGG - Intergenic
1085547276 11:77331635-77331657 TGGGGTCAGGGGAGGGTGGAGGG + Intronic
1085856697 11:80183270-80183292 CTGAGTCATTGCATGCTGGAAGG - Intergenic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087768172 11:102179042-102179064 CTGGGTCACGGGGTGGGGGGTGG - Intronic
1088247131 11:107829472-107829494 CTGTGTCATAGCATGGTGGAAGG - Intronic
1089307225 11:117534208-117534230 CTTGTGCTTGGGATGGTGGAGGG - Intronic
1089597906 11:119593499-119593521 CTGTGTCATAGCATGGTGGAGGG + Intergenic
1090381960 11:126333657-126333679 CTGGGGCTTGGGCTGCTGGAGGG + Intronic
1090410829 11:126508523-126508545 ATGAGCCCTGGGATGGTGGAAGG + Intronic
1090851924 11:130578462-130578484 ATGGGAACTGGGATGGTGGAAGG - Intergenic
1090915710 11:131160371-131160393 CTGGGTGCTGGGATGCTGGCTGG + Intergenic
1091294304 11:134462083-134462105 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092252447 12:6907454-6907476 CTGGGTCAGAGGGTGGTGCAGGG + Intronic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093038992 12:14358106-14358128 CTGCGTCATTCCATGGTGGAAGG + Intergenic
1095373489 12:41498464-41498486 CTGTGTCATAACATGGTGGAAGG + Intronic
1095690594 12:45084255-45084277 CTGGGGGGTGGGGTGGTGGAGGG - Intergenic
1096071249 12:48776627-48776649 CTGGGTTGTGGGCTGGGGGAGGG - Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096464059 12:51838507-51838529 CTGAGTCATGGGAGGGGGAAGGG - Intergenic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1097269812 12:57767033-57767055 CTGGGTCATGGTCTGGTTCAGGG + Exonic
1098177023 12:67803450-67803472 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1099360818 12:81698398-81698420 CTGTGTCATCTCATGGTGGAAGG - Intronic
1099438671 12:82673582-82673604 TTGGGTAATGGTATGGTGAAAGG + Intergenic
1100681782 12:96931863-96931885 CTGGGTAGTGGGATTATGGATGG + Intronic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1101451698 12:104785695-104785717 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1101890019 12:108704962-108704984 ATTGGTGATGGGATGGTGGCAGG + Intronic
1103234176 12:119358392-119358414 CTGTGTCATCCCATGGTGGAAGG - Intronic
1103951569 12:124554372-124554394 CTGGGTGGTGGGAGGCTGGAGGG - Intronic
1104078146 12:125408437-125408459 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1104207916 12:126657827-126657849 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104381779 12:128313657-128313679 CTAGCCCCTGGGATGGTGGACGG + Intronic
1104475272 12:129065967-129065989 CTGGATGGTTGGATGGTGGATGG - Intergenic
1104547728 12:129727298-129727320 CTGTGTCATAACATGGTGGAAGG + Intronic
1104714204 12:131005753-131005775 CTGGCTCAGGGGATGGAGCAGGG + Intronic
1104861715 12:131927597-131927619 CTGGAGCCTGGGCTGGTGGAGGG + Intergenic
1105807700 13:23966420-23966442 CTTGGTCATGGGGTGCGGGATGG - Intergenic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1105934143 13:25083172-25083194 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1106567086 13:30895558-30895580 CTGGGTGGTGGGATGATAGAGGG + Intergenic
1106873190 13:34043898-34043920 TTGGGGGATGGGGTGGTGGAGGG - Intergenic
1107822143 13:44295840-44295862 CTGGGGCTTGGGATGGAGAAGGG - Intergenic
1108161466 13:47644724-47644746 CTGGGTCCTCATATGGTGGAAGG - Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109383889 13:61602135-61602157 CTGGGTAATGGGATACTAGAAGG - Intergenic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1110487300 13:76061551-76061573 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1111044653 13:82798443-82798465 CTGTGTCATGTCCTGGTGGAAGG - Intergenic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112477045 13:99740913-99740935 CAGGGACAAGGGATGGTGCAGGG + Intronic
1113273507 13:108701468-108701490 CTGGGTCATCCAATGGTGTAAGG - Intronic
1113507372 13:110826500-110826522 CAGGGTCAATTGATGGTGGATGG + Intergenic
1113632965 13:111900369-111900391 ATGGGTCTTGTGAGGGTGGAGGG + Intergenic
1113813344 13:113155034-113155056 CTGCGTCATCCCATGGTGGAAGG - Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1114232132 14:20792705-20792727 CTGCATCATCGCATGGTGGAAGG - Intergenic
1115736698 14:36339316-36339338 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1117455052 14:55888627-55888649 ATGGTTCATGGGGTGTTGGAGGG - Intergenic
1117833306 14:59776407-59776429 CTGCATCATGGCATGGTGGAAGG - Intronic
1118700192 14:68425525-68425547 CTGCATCATTGCATGGTGGAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119508687 14:75194359-75194381 CTGCGTCATCTCATGGTGGAAGG - Intergenic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121210982 14:92207741-92207763 CTGGGGCATGGTATGGAGTATGG + Intergenic
1121534142 14:94679580-94679602 CTAGGTCATGGGAATGGGGAGGG + Intergenic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122678210 14:103435047-103435069 CTTGGTCATGGGATGTAGCAGGG + Intronic
1122781634 14:104146253-104146275 CTGGGTGTTGGGATGGTGCCAGG + Intronic
1122910307 14:104824601-104824623 CTGGATGATAGAATGGTGGATGG + Intergenic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123058527 14:105583924-105583946 CTGGCTCATGGGAGCCTGGACGG + Intergenic
1123082860 14:105704157-105704179 CTGGCTCATGGGAGCCTGGACGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123632077 15:22268458-22268480 CTGGGACATCCCATGGTGGAAGG - Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124719208 15:32097453-32097475 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1125764416 15:42123635-42123657 CTGGGTCCTGGGATGAGGGGTGG - Intergenic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128567731 15:68712152-68712174 CTGGGTCTTGGGTTTGAGGAAGG + Intronic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1130052182 15:80493081-80493103 CTGTGTCATCCCATGGTGGAAGG + Intronic
1130555486 15:84919566-84919588 CTGTGTCATAACATGGTGGAAGG + Intronic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1133110222 16:3543574-3543596 CTGAGTCAAGGGGTGGTGAAAGG - Intronic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1133256460 16:4519536-4519558 CTGTGTCATCCCATGGTGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133638936 16:7698264-7698286 GTGGGTCCTGGCATGGTGGAAGG - Intronic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1134070600 16:11257229-11257251 CCGGGGCTTGGGATGGTGGGCGG + Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134413135 16:14020136-14020158 CAAGGTCATGGGACAGTGGAGGG - Intergenic
1135154595 16:20041544-20041566 CTGGACCCTGGGATGGAGGAAGG + Intronic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137370929 16:47905060-47905082 CTGGGTCCTAGCATTGTGGAGGG + Intergenic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137614654 16:49839157-49839179 CTGGGTCCTGGGATGAGGGGAGG - Intronic
1137670658 16:50276329-50276351 CTGGCTCATGGCAGGGTTGAGGG + Intronic
1138509260 16:57498396-57498418 CTGGTTCATGGAATGGAGGGAGG + Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138549119 16:57737688-57737710 CTTGGGCCTGGGATGGGGGAAGG + Intronic
1138990957 16:62390657-62390679 TTGGGACATGTCATGGTGGATGG - Intergenic
1139331090 16:66190761-66190783 CTGGGTCCTAGGATGCTGGTGGG - Intergenic
1139368172 16:66446672-66446694 CTGAGTCTTGGGCTGGTGAAGGG + Intronic
1139532390 16:67548782-67548804 CAGGTTCCTGAGATGGTGGAGGG + Intergenic
1139696799 16:68680872-68680894 CTGGCTCATGGGTGTGTGGATGG - Intronic
1140114220 16:72027532-72027554 CTGGGACCAAGGATGGTGGAAGG + Intronic
1140510237 16:75502322-75502344 CTGGACCACGGGATGCTGGAGGG + Intergenic
1140516003 16:75542388-75542410 CTGGACCATGGGATGCTGGAGGG + Intronic
1140554656 16:75907997-75908019 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1140728521 16:77835431-77835453 CTGGACCATGGGATGATGGATGG - Intronic
1141633435 16:85301381-85301403 CGGGTTCCTGGGATGATGGAAGG + Intergenic
1142132035 16:88435562-88435584 CTGGGACCTGGGGTGATGGAGGG + Exonic
1142478640 17:204644-204666 ATGGGTCAGTGGGTGGTGGAGGG - Intergenic
1143052930 17:4141601-4141623 CTGGGTGATGGGATGCTGTGTGG + Intronic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1143476377 17:7205826-7205848 ATGGGCTATGGGATGGAGGACGG - Intronic
1143481004 17:7227375-7227397 CTGGGTCCTGGGCAGGTGGCTGG - Intronic
1143874602 17:9982077-9982099 TGTGGTCATGGGATGGTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144382944 17:14720782-14720804 CCTAGTAATGGGATGGTGGAAGG - Intergenic
1144538116 17:16111743-16111765 CTGGCTCCTGTGATTGTGGAGGG - Intronic
1144744774 17:17606760-17606782 CTGGGACCTAGGATGGGGGAGGG - Intergenic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145100577 17:20073232-20073254 CAGGGTCATGGCAAGGTGGTGGG + Intronic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145752850 17:27367626-27367648 CTGGGGCCTGGGCTGGTGAAAGG + Intergenic
1146076794 17:29738068-29738090 TGGGGTCACGGGAGGGTGGAGGG - Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146530249 17:33602449-33602471 CTGTGTCATAACATGGTGGAAGG - Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147426986 17:40350641-40350663 TTGGGGGATGGGATGGGGGAGGG + Intronic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147882884 17:43665339-43665361 CTGGGTCATGGTGGGGTGGGTGG + Intergenic
1148115590 17:45172847-45172869 CTGGGGCCTGGGGTGGGGGAAGG - Intergenic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148554525 17:48570363-48570385 CCGGGGCATGGGATGGGGGGTGG + Intronic
1148779025 17:50111421-50111443 CAGGGCCATGGGAGGTTGGAAGG - Exonic
1148862608 17:50612512-50612534 CTGGGTCCCGGCCTGGTGGAAGG - Intronic
1148869243 17:50646337-50646359 GAGGGTCATGGGTTGGGGGAAGG + Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1151190494 17:72394470-72394492 CAGGCTCATGGGAAGTTGGAAGG + Intergenic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1152126217 17:78448803-78448825 CTGTGTCATCCCATGGTGGAAGG - Intronic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152334000 17:79690095-79690117 CGGGGTCGTGGGAGGGAGGAAGG - Intergenic
1152546459 17:81002543-81002565 CTGCGTCATCACATGGTGGAAGG + Intronic
1203169415 17_GL000205v2_random:134550-134572 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1154016033 18:10618707-10618729 CTGGCTCATGGGAGGTGGGAAGG - Intergenic
1154025195 18:10700875-10700897 CTGGGTCATTGGGTTGTGGCAGG - Intronic
1154189480 18:12216937-12216959 CTGGCTCATGGGAGGTGGGAAGG + Intergenic
1154210963 18:12377743-12377765 CTGAGTCATGGGGTGGTGCTAGG + Intergenic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1156495397 18:37522372-37522394 CTGGGTCCTGGGCTGGGGGCCGG - Intronic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1157430096 18:47617515-47617537 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1159829395 18:73255871-73255893 CTGCGTCATCCCATGGTGGAAGG + Exonic
1160437227 18:78860927-78860949 CTGGGTCCCAGGATGATGGACGG + Intergenic
1160742204 19:691882-691904 GTGGGTCATGGGGTGGTAGTCGG + Exonic
1161069737 19:2254095-2254117 CTGGGTCCTTGGATCTTGGAGGG - Intronic
1161167176 19:2794569-2794591 CTGGGCCCTGGGATGGAGAAAGG - Intronic
1162043716 19:7985420-7985442 CTGGGTCCCGGGATGGGGTAGGG - Intronic
1163338242 19:16687649-16687671 CTGTGTCCTCGCATGGTGGAAGG + Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163764067 19:19152787-19152809 CTGGGCCCTGGGATAATGGAGGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164788836 19:30959124-30959146 CTGGGCCCTGGGATGGAGGTGGG + Intergenic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1165106499 19:33472872-33472894 CTGGGTCATGGAGTGTGGGAGGG - Intronic
1165309442 19:35021624-35021646 CTGGGGCGTGGGTTGGGGGATGG + Intronic
1165448424 19:35869157-35869179 CTGGGTCCTGGGAGGCTGCAAGG - Intronic
1166040994 19:40202832-40202854 CTGGTACATGGGATGTAGGAGGG - Intronic
1166348125 19:42179397-42179419 CAGGGTCTTGGGAGGGTGCATGG + Intronic
1166356211 19:42229082-42229104 AGGGGTCATGGGGTGGTAGAAGG + Intergenic
1166546415 19:43636772-43636794 CTGGCTCATGGGTGGGTGGGTGG + Intronic
1166871224 19:45872288-45872310 CCGGGTCCTGGGCTGGTGCACGG + Exonic
1167311591 19:48740434-48740456 CTGGGTCCTGGGATGGAAGATGG + Intronic
1167583510 19:50359976-50359998 CGGGGTAATGGGATGCAGGAAGG + Intronic
1168313594 19:55473831-55473853 CTGGGTCATAGCAATGTGGAGGG - Intergenic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
1168491032 19:56809035-56809057 CTGGGTTGTGGGGTGGAGGAAGG + Intronic
925226358 2:2186609-2186631 GCGGGACATGGGATGGTTGACGG - Intronic
925303156 2:2831123-2831145 CTGGGTCATCCCATGGTGGAAGG - Intergenic
925917231 2:8615410-8615432 CCGGGTCAGGGGATGGAGGGCGG + Intergenic
926624522 2:15080068-15080090 CTGGCTCATGGGATGAGGGTGGG - Intergenic
927072569 2:19546024-19546046 CTGTGTCATAACATGGTGGAGGG - Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927741551 2:25573912-25573934 CTGGGTCCTTGAATGATGGATGG - Intronic
928295590 2:30080239-30080261 CTGGGGCATGGGATTGGGGGTGG - Intergenic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929319566 2:40526351-40526373 CTGGGGCATGAGATGGTTGTAGG + Intronic
929576540 2:43056090-43056112 CTGCATCATGGGCTGGTGAAGGG + Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
930766201 2:55088159-55088181 CTAGGACATGGGCTGCTGGATGG + Intronic
930902141 2:56520700-56520722 CTTTGTCTTGGCATGGTGGAAGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931404621 2:61963959-61963981 GTTGGTGATGGGATGGTGGCTGG + Intronic
931872140 2:66472796-66472818 CTGGCTCATGGCAGTGTGGAAGG - Intronic
932001528 2:67889414-67889436 CTGGGTCCTGGGAATTTGGATGG - Intergenic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
932425530 2:71631973-71631995 TTGGGGCAGGGGGTGGTGGAGGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932855717 2:75232201-75232223 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
933174128 2:79157601-79157623 CCGGGGCTTGAGATGGTGGAGGG + Exonic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933238943 2:79897875-79897897 CTGGATCCTGGTATGGCGGAAGG + Intronic
933649002 2:84833947-84833969 CTGGGTTCTGGGCTGGTGGGAGG - Intronic
933920447 2:87040313-87040335 CTGGGACCTGGGCTGGTGCAGGG - Intergenic
933931177 2:87153473-87153495 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934002550 2:87729585-87729607 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934603168 2:95673933-95673955 CAGGGTCATGTAATGGGGGAGGG + Intergenic
935160365 2:100524472-100524494 ATGAGTCATGGTAGGGTGGAGGG - Intergenic
936361946 2:111811959-111811981 CTGGGACCTGGGCTGGTGCAGGG - Intronic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
937094832 2:119228621-119228643 CAGGGTGATGGGTGGGTGGAGGG + Intronic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937463444 2:122109390-122109412 CTGGATCCTGGGAAGGTGAAGGG + Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938748442 2:134304347-134304369 CTGGATACTGGGATGGTGAATGG + Intronic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
940036790 2:149320346-149320368 CGGGGGCATGGGATGGCGGCAGG - Intergenic
941711084 2:168714106-168714128 CTGTGTCTTCGTATGGTGGAAGG + Intronic
942198950 2:173551847-173551869 CTGTGTCATGATATGGAGGAAGG + Intergenic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943014444 2:182494418-182494440 CTGGGCTAAGGGATGGTGGTTGG - Intronic
943204804 2:184880758-184880780 CTGTGTCATCCCATGGTGGAAGG + Intronic
944200121 2:197097927-197097949 CTGGGTCATTGGATGTTTGGTGG - Intronic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
944636478 2:201680392-201680414 CTGGGTCCTCCCATGGTGGAAGG + Intronic
944868846 2:203889550-203889572 CTGTGTCCTGTCATGGTGGAAGG + Intergenic
945055896 2:205868782-205868804 GTGGATCCTGGGATGATGGAGGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
945554286 2:211260301-211260323 CTGGGTCATGGATTGCTAGAAGG + Intergenic
945663656 2:212716339-212716361 CTGGGTCATGCCATGGTGAAAGG + Intergenic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946397385 2:219449763-219449785 ATGGGTCAGGGGATGGTGCCCGG - Intronic
947028200 2:225762742-225762764 CTGGCTCGTGTGATGATGGAAGG - Intergenic
948444690 2:238023171-238023193 CTGGGTCACTGGATGGTGGCAGG - Intronic
948641037 2:239376102-239376124 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641045 2:239376146-239376168 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641060 2:239376231-239376253 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641068 2:239376275-239376297 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641076 2:239376319-239376341 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948745752 2:240092351-240092373 CTGGGTGGTGGGGTGGGGGAGGG - Intergenic
1169252458 20:4071100-4071122 ATGGATCATAGGATGGAGGACGG + Intronic
1169282804 20:4281283-4281305 TTGGATCATGGGAGAGTGGAAGG + Intergenic
1169286930 20:4316824-4316846 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169785503 20:9355435-9355457 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1170509772 20:17064748-17064770 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170547912 20:17450709-17450731 CTGGGTCTTCCCATGGTGGAAGG + Intronic
1170838751 20:19907052-19907074 CTGCGTCATTCCATGGTGGAAGG + Intronic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172287178 20:33749032-33749054 CTGGGGCATGGGCTGGTCCAGGG - Exonic
1172390107 20:34560100-34560122 CTGGCTGGTGGGATGGGGGAGGG + Exonic
1172450838 20:35021502-35021524 CTGGCTCCTGGGATTGTGGAGGG - Intronic
1173180571 20:40803617-40803639 CTGTGTCCTGACATGGTGGAAGG + Intergenic
1173187940 20:40855611-40855633 CTGGGTCTTGAGACTGTGGAGGG - Intergenic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174386211 20:50190037-50190059 CTGGGCCCTGGGATGGGGCAGGG - Intergenic
1174405150 20:50298065-50298087 GAAGGTCATGGGAGGGTGGATGG - Intergenic
1174681452 20:52412666-52412688 CTGTGTCATAACATGGTGGAGGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175740185 20:61414621-61414643 CCGTGTGATGGGGTGGTGGAGGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1176001798 20:62835312-62835334 CTGCGTCATTCCATGGTGGAAGG + Intronic
1176332519 21:5561162-5561184 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176395238 21:6259789-6259811 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176402343 21:6324599-6324621 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176434814 21:6664505-6664527 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176441919 21:6729315-6729337 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176459076 21:6991575-6991597 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176466181 21:7056384-7056406 CTGTTTCATGGCATGGGGGAGGG - Intronic
1176489742 21:7438162-7438184 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176889423 21:14296271-14296293 GTGGGTCATGGAATAATGGAAGG + Intergenic
1176991969 21:15507878-15507900 CTGCATCATAAGATGGTGGAAGG - Intergenic
1179129713 21:38624156-38624178 CTGGATCATGGGATGGGTGGTGG - Intronic
1179154876 21:38841003-38841025 CTGGCTCTCAGGATGGTGGAAGG - Intergenic
1179366108 21:40759732-40759754 CAGGCTCATGGGATGATGGCAGG - Intronic
1179994620 21:44968164-44968186 CTGGGTGATGGGGTTCTGGAGGG - Intronic
1180015509 21:45080209-45080231 AAGAGTCATGGGATGGTGGCTGG + Intronic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1181809452 22:25394586-25394608 CTGGGCCATGGGAGGTTGGTAGG + Intronic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1184112430 22:42403146-42403168 CTGTGTCATGGGGTTGTAGAAGG - Intronic
1184145036 22:42604989-42605011 CTGAGTCCTGACATGGTGGAAGG - Intronic
1184169989 22:42753008-42753030 CTGGGTCCTGGGAGGGTGACAGG - Intergenic
1184259695 22:43307553-43307575 CCAGGTCACGGGATGCTGGAAGG + Intronic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
950194824 3:11001595-11001617 CAGGGGCAGGGGATGGTTGATGG + Intronic
951195303 3:19816902-19816924 CTGGCTCACTGGATGGTGAAAGG + Intergenic
953076430 3:39574798-39574820 CTGGGTGATGGGATGAGGCATGG + Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955053508 3:55435364-55435386 CTTGGTCATGGGATCGTGAAGGG - Intergenic
955417372 3:58705175-58705197 CTGGGTCATGAGAGAGTGAATGG - Intergenic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956290069 3:67651856-67651878 CAGGGTCATGGGATGGAGAATGG - Intronic
956334801 3:68151549-68151571 CTGAGTCATACCATGGTGGAAGG + Intronic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
957827938 3:85474219-85474241 CTGGCTCATGGGATTGTGGATGG + Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959752475 3:109855005-109855027 CTGAATCATGACATGGTGGAAGG + Intergenic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
959991683 3:112638545-112638567 CTGGGTTCTGAGATGGTGGTGGG + Exonic
960360405 3:116704210-116704232 CTGGGTCATCCCATGATGGAAGG + Intronic
960541561 3:118867456-118867478 TTGGGAAATGGGGTGGTGGAGGG + Intergenic
960859391 3:122136061-122136083 CTGTGTCATCCCATGGTGGAAGG + Intergenic
960989468 3:123301339-123301361 CTGGGTGATTGGATTGTGGGGGG + Intronic
961026809 3:123565462-123565484 CTGTGTCCTTGTATGGTGGAAGG - Intronic
961121871 3:124379623-124379645 ATGGTTCATGGGATGTTGGATGG - Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961570620 3:127795858-127795880 CTGGGTGATAAGATTGTGGATGG - Intronic
962775304 3:138653541-138653563 CTGGTTCATGAAATGGTGGGTGG + Exonic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
963309591 3:143694786-143694808 CTAACTCATGGGATGGTTGAGGG - Intronic
964102248 3:153001307-153001329 CTGTGTCATCCCATGGTGGAAGG + Intergenic
964356202 3:155854099-155854121 GTGGTTCACGGGATGGTGGCAGG + Exonic
964807535 3:160627919-160627941 CTGTGTCCTGTCATGGTGGAGGG + Intergenic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
965159456 3:165113282-165113304 GTGGCTCATGTGATGATGGAAGG + Intergenic
965598696 3:170433547-170433569 TGGGGACATGGGATGGGGGAGGG + Exonic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966669707 3:182513361-182513383 TGGGATCATGGGGTGGTGGAAGG + Intergenic
966716075 3:183014002-183014024 CTGTGTCATAACATGGTGGAGGG + Intergenic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967138331 3:186531432-186531454 CTGGGTCCTGCCATAGTGGAAGG - Intergenic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
967852313 3:194091400-194091422 GTGACTCATGGGATGGTGGAAGG - Intergenic
968393029 4:208347-208369 ATGGGTGTTGGGCTGGTGGATGG + Intergenic
969104792 4:4797526-4797548 CTGGGTCATCCCATGGTGGATGG + Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969414722 4:7050852-7050874 CTGCATCGTGGGATGGTGGGGGG + Intronic
969550623 4:7864222-7864244 CTGGGTCATGGGATTTGGGCAGG - Intronic
969981404 4:11159838-11159860 CTTGGTGATTGGATTGTGGATGG + Intergenic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
975935362 4:79573105-79573127 CTGGGCCATAGAATGGAGGATGG - Intergenic
977263097 4:94822123-94822145 CTGTGTCATCTCATGGTGGAAGG + Intronic
979206485 4:118044771-118044793 CTGTGTCATCTCATGGTGGAAGG + Intronic
979860366 4:125686100-125686122 CTGTGTCATCCGATGGTGAAAGG + Intergenic
980343782 4:131584848-131584870 CTGAGTCATGCTGTGGTGGAAGG + Intergenic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982285697 4:153731801-153731823 GAGGGTGGTGGGATGGTGGAGGG + Intronic
983210590 4:164954029-164954051 CAGGGTCCTGGGTTGGTGAAGGG - Intergenic
984624188 4:181987254-181987276 CAGGGGCTTGGGATGATGGAAGG - Intergenic
984753258 4:183299132-183299154 CTGTGTCATCCCATGGTGGAGGG + Intronic
985555206 5:554915-554937 CTGGGTCATGGGATGAACGGGGG + Intergenic
985555254 5:555027-555049 CTGGGTCATGGGATGAACGGGGG + Intergenic
985848329 5:2370714-2370736 CTGGGTCCTGTCATGGAGGATGG + Intergenic
985865183 5:2508990-2509012 CTGATTCATGGGATGGAGGCTGG + Intergenic
985966750 5:3343611-3343633 GTGGGTGGTGGGATGGAGGAGGG - Intergenic
986205417 5:5620527-5620549 CTGTGTCTTGGGATGTAGGAGGG - Intergenic
987419152 5:17698005-17698027 CTGGATCATGGGAATGTGAAAGG - Intergenic
988044017 5:25925690-25925712 GTGGGTCATGCAATGTTGGAGGG - Intergenic
988864939 5:35324440-35324462 CTGGTGCATGGGTTGGTGCATGG - Intergenic
988879467 5:35485346-35485368 CTGGGTCATGGGAACCAGGAAGG - Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
990055517 5:51572344-51572366 CTGTGTCCTCCGATGGTGGAAGG + Intergenic
990703043 5:58496411-58496433 GAGGGACATGGGTTGGTGGAGGG + Exonic
991671552 5:69053418-69053440 CTAGGTCATGGGTATGTGGATGG - Intergenic
992772318 5:80060046-80060068 CTGAGACAAGGGATGGCGGAAGG + Intronic
993121400 5:83779190-83779212 CTGCGTCATCCCATGGTGGAAGG + Intergenic
993572279 5:89556241-89556263 AAAGGTGATGGGATGGTGGAGGG + Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
996364519 5:122686537-122686559 CGGGGTCAGGGGAGGGGGGAGGG + Intergenic
996581241 5:125034637-125034659 CTGGGTCATGGGAGGGGTGGGGG - Intergenic
996777323 5:127146647-127146669 GTGGGTCATGGGTGGGGGGAGGG + Intergenic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
998140774 5:139698156-139698178 ATGGGTCTTGGGATGGGGGTGGG + Intergenic
998203661 5:140144560-140144582 CCGGGTCATGGCAGGGTAGAGGG - Intergenic
998415085 5:141940442-141940464 CTCAGTCATGGGATTGTGGGGGG - Exonic
999231814 5:150066144-150066166 ATGCCTCTTGGGATGGTGGAAGG - Intronic
999677842 5:154023136-154023158 TGGGGTCAGGGGATGGGGGAGGG + Intronic
999713700 5:154341909-154341931 CTGGCTCATGGGATGGGGAAAGG - Intronic
1000062428 5:157669167-157669189 CTGGGTGCTGGGATTGGGGAGGG + Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001517056 5:172363288-172363310 ATGGGTGATGAGATGGTTGATGG - Intronic
1001630425 5:173170897-173170919 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001900388 5:175422191-175422213 GTGGGCCCTGGGATGGGGGAGGG - Intergenic
1001933392 5:175688392-175688414 CTGGGGCAGAGGATGGTGGCTGG - Intergenic
1002270449 5:178068416-178068438 CAGGGGCATGGGATGGGAGATGG - Intergenic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003263109 6:4541155-4541177 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1003971941 6:11308182-11308204 TTGGGTTATGGGATGGAGCAGGG + Intronic
1005968701 6:30744436-30744458 CGGGGTCCCGGGATGGTGGAGGG + Exonic
1006065362 6:31457566-31457588 CTGGGGCATGGAATGATGGATGG - Intergenic
1008973603 6:57399181-57399203 TGGGGTCAGGGGATGGAGGAGGG - Intronic
1009162499 6:60300733-60300755 TGGGGTCAGGGGATGGAGGAGGG - Intergenic
1009305962 6:62089438-62089460 CTGGATCATGCCATGGGGGATGG - Intronic
1010006974 6:71006257-71006279 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1010022540 6:71177497-71177519 ATGGGTCATGGGATGGGGAAAGG - Intergenic
1010171259 6:72978818-72978840 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1011216889 6:85014673-85014695 CTGGGTCACTGGGTGGGGGAGGG + Intergenic
1011567648 6:88694851-88694873 CTGGGCCATGCTGTGGTGGAAGG - Intronic
1012411381 6:98961898-98961920 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1015262980 6:131259881-131259903 CTGGGTGATGGGTTGATGGGTGG - Intronic
1016197721 6:141366442-141366464 CAGGGGGATGGGATGGGGGAGGG - Intergenic
1016512023 6:144853948-144853970 CTGCGTCATCCTATGGTGGAAGG - Intergenic
1016738558 6:147506858-147506880 CTGGGCGCTGGGATGCTGGAAGG - Intergenic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1018207115 6:161446095-161446117 CTGGAGCATGGGGTGGTGGTGGG + Intronic
1018644600 6:165935838-165935860 CTGTGTCATCCCATGGTGGAAGG - Intronic
1019327806 7:446746-446768 CTGGGTCCTCGGCTGGTGCAGGG - Intergenic
1019374678 7:683119-683141 CTGGGTCTTGGGATGTCAGAAGG - Intronic
1019704249 7:2490010-2490032 CAGGGTCCTGGGATGGTGGGTGG - Intergenic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1021925907 7:25533469-25533491 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1025941176 7:66076957-66076979 CTGGGTCATGGCAGGGGGGTAGG + Intronic
1025949255 7:66130622-66130644 CTGGGTGATGGGCGGGTGAAAGG + Intronic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1026481615 7:70784600-70784622 CTGGGTCATGGGAGGAGGGGAGG - Intronic
1027768753 7:82380022-82380044 GTGGGTTATGGGATGATGAAGGG - Intronic
1029572769 7:101381566-101381588 CTGTGTCATTTTATGGTGGAAGG + Intronic
1029882179 7:103826159-103826181 CTGTGTCATAACATGGTGGAAGG - Intronic
1031035920 7:116787490-116787512 CTGTGTCATAACATGGTGGAAGG + Intronic
1031164801 7:118214973-118214995 CTGGGACATGGGTTGCTGAATGG - Intronic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032697203 7:134347740-134347762 CTGGGACATGGATGGGTGGATGG + Intergenic
1032961803 7:137044077-137044099 CAGAGTCCTTGGATGGTGGAAGG + Intergenic
1033153547 7:138937133-138937155 CTGGGGCATGGGCTGGTTGTAGG - Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034422853 7:150998456-150998478 CTGGGGCCTGGCATGGTGGGGGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035108951 7:156464414-156464436 TTGTGTCCTGGGATGGTGGGAGG - Intergenic
1035307605 7:157943324-157943346 CTGGGGCATGGGAGGGGGCATGG - Intronic
1035579191 8:729309-729331 CAGGGTCATGGGGTGGTTGCAGG - Intronic
1035748565 8:1979124-1979146 CTGGCTCATCCGATGGTGGTGGG + Intronic
1036535194 8:9643337-9643359 CTGTGTCATCCCATGGTGGAAGG + Intronic
1038725296 8:30076781-30076803 CTGTGTCATCCCATGGTGGAAGG - Intronic
1039772568 8:40702089-40702111 CTGTGTCATAACATGGTGGAGGG - Intronic
1040792938 8:51254594-51254616 GTTGGTGATGGGATGGTGGGAGG + Intergenic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1041719039 8:60959899-60959921 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1041737731 8:61129656-61129678 CTGTGTCCTTGCATGGTGGAAGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044327148 8:90871708-90871730 CTGGTTCATGGGATGCTGTAGGG - Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046237532 8:111446406-111446428 CTGCATCATAGCATGGTGGAAGG + Intergenic
1046471726 8:114683647-114683669 CTGGGTCATAACATGGTGAAAGG + Intergenic
1046484064 8:114862083-114862105 CTGGTTCATGAGCTGGTGCATGG + Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1047927382 8:129694773-129694795 CTGGGTCAAGGGATTTTAGAGGG + Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049734870 8:144199574-144199596 GTGGGTCATGGGAGGCTGGCAGG - Intronic
1053446260 9:38155460-38155482 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
1053524388 9:38813819-38813841 CCGGGTCATGGGAATGAGGAAGG + Intergenic
1054196622 9:62038228-62038250 CCGGGTCATGGGAATGAGGAAGG + Intergenic
1054641783 9:67550457-67550479 CCGGGTCATGGGAATGAGGAAGG - Intergenic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056911452 9:90704641-90704663 CTTGGTCATGAGATGGAGCAGGG - Intergenic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1060130626 9:121094303-121094325 CTGCGTCATGACATGGTAGAAGG + Intronic
1061328519 9:129878485-129878507 CTGGGAGATGGGATGCTGGCAGG + Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062369213 9:136228561-136228583 CTGGGTCAAGGGATGGGTGCTGG + Intronic
1062589837 9:137268677-137268699 CTGTGTCATCCCATGGTGGAAGG + Intronic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1203429572 Un_GL000195v1:79170-79192 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1203436722 Un_GL000195v1:144141-144163 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185967933 X:4628629-4628651 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1186021684 X:5263705-5263727 TTGGGTGATGGGGTGGTGGTAGG + Intergenic
1186149649 X:6660788-6660810 CTGGGATATAAGATGGTGGAAGG - Intergenic
1186236828 X:7521102-7521124 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1186349796 X:8730583-8730605 CTGGGTCAAGGGGTGGGGGGGGG - Intronic
1186716588 X:12258422-12258444 CTGTGTCATAACATGGTGGAAGG - Intronic
1188520075 X:31029146-31029168 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1189252514 X:39612521-39612543 CTGGCTCCTGGGATGGGGGAAGG - Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1189721940 X:43928824-43928846 CTGCGTCATCCCATGGTGGAAGG + Intergenic
1190127732 X:47721715-47721737 ATGGGTGATCGAATGGTGGATGG - Intergenic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1190299804 X:49050485-49050507 GGGGGTCATTGGAGGGTGGATGG + Intergenic
1190383819 X:49865084-49865106 CTGCATCTTGGCATGGTGGAAGG - Intergenic
1191624968 X:63260944-63260966 CTGGGTCATGGTATATTTGATGG - Intergenic
1192317652 X:70065557-70065579 CTGGGGCATGGACTGGTGAAGGG + Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194633248 X:96312391-96312413 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196940018 X:120766341-120766363 CTGGGTCAGGGGTTGGGGCAGGG + Intergenic
1197863544 X:130995363-130995385 CACGGTCCTGGGATGGTGGCTGG + Intergenic
1198838064 X:140825641-140825663 CTGGGTCATTACATGGTGGAAGG + Intergenic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1201746053 Y:17375202-17375224 TGGGGTCAGGGGATGGGGGAGGG - Intergenic