ID: 902332992

View in Genome Browser
Species Human (GRCh38)
Location 1:15739655-15739677
Sequence CTGAGCAAGGCTCTGGGATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 399}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902332992_902332996 -5 Left 902332992 1:15739655-15739677 CCACATCCCAGAGCCTTGCTCAG 0: 1
1: 0
2: 4
3: 47
4: 399
Right 902332996 1:15739673-15739695 CTCAGTTATAGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 120
902332992_902332998 7 Left 902332992 1:15739655-15739677 CCACATCCCAGAGCCTTGCTCAG 0: 1
1: 0
2: 4
3: 47
4: 399
Right 902332998 1:15739685-15739707 AACTGCTGCGGGCGTGCACATGG 0: 1
1: 0
2: 0
3: 1
4: 49
902332992_902332997 -4 Left 902332992 1:15739655-15739677 CCACATCCCAGAGCCTTGCTCAG 0: 1
1: 0
2: 4
3: 47
4: 399
Right 902332997 1:15739674-15739696 TCAGTTATAGCAACTGCTGCGGG 0: 1
1: 0
2: 0
3: 9
4: 143
902332992_902332999 13 Left 902332992 1:15739655-15739677 CCACATCCCAGAGCCTTGCTCAG 0: 1
1: 0
2: 4
3: 47
4: 399
Right 902332999 1:15739691-15739713 TGCGGGCGTGCACATGGCATAGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902332992 Original CRISPR CTGAGCAAGGCTCTGGGATG TGG (reversed) Exonic
900300199 1:1973300-1973322 CTGGGCAGGGGTCTGGGAAGAGG + Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900778301 1:4600746-4600768 CTGTGCAGGGCTCCGGGCTGAGG - Intergenic
901829962 1:11886351-11886373 CTGCTCATGGCCCTGGGATGGGG - Intergenic
901938777 1:12645978-12646000 CTGAGCAGGGCTTGGGGATTGGG + Intronic
902332992 1:15739655-15739677 CTGAGCAAGGCTCTGGGATGTGG - Exonic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
902988573 1:20170754-20170776 CTGAGCAAGGCTCTGGACTCAGG + Intronic
904012850 1:27399588-27399610 CTGGGGTAGGCCCTGGGATGGGG + Intergenic
905261141 1:36719999-36720021 CAGATCAAGGGTCGGGGATGGGG - Intergenic
905314340 1:37071971-37071993 CTGAGCTGGGCTCTGGGATGGGG + Intergenic
905945906 1:41901232-41901254 CTGAGGAAGGGGCTGGGGTGTGG + Intronic
906143086 1:43545220-43545242 CCCAGCAGGACTCTGGGATGGGG + Intronic
906870308 1:49472068-49472090 CTGGGCAGGGTTCTGGGCTGTGG - Intronic
907315870 1:53572209-53572231 CAGGGCAATGCTCTGGGAAGTGG - Intronic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
909270020 1:73611580-73611602 CTGAGCCAGGCTCTGCAATTTGG - Intergenic
909467403 1:75988322-75988344 CTGTGCACAGCTTTGGGATGTGG - Intergenic
910267384 1:85352201-85352223 CTGTGCACAGCTCTGGGATGTGG - Intronic
911076334 1:93879025-93879047 CTGAGCGCGGCTCTGCGAAGCGG + Intronic
912487975 1:110043964-110043986 CTGACCGTGGCTCTGGGATGAGG + Intronic
912724353 1:112045466-112045488 CTGGGCAAGGGTTGGGGATGCGG - Intergenic
915009842 1:152675359-152675381 ATGAGCAAGGCAGAGGGATGGGG + Intronic
915010999 1:152686187-152686209 ATGAGCAAGGCAGAGGGATGGGG + Intronic
915141340 1:153770495-153770517 ATGAGCCAGGCTCTGGGCTGGGG + Intronic
915291607 1:154887982-154888004 CTGTGCAAGGTTCAGGGTTGGGG - Intergenic
915886043 1:159722501-159722523 CTGAGCATGGCCCTAGAATGTGG - Intergenic
916086357 1:161272861-161272883 CTGACAAATGCTCTGGGAGGAGG + Intronic
916416589 1:164598009-164598031 CAGAGCATGGCTCTGGCATTTGG + Intronic
916500795 1:165384996-165385018 CTGAGCAGGGCTCTAAGAAGGGG + Intergenic
916812036 1:168314144-168314166 TTCAGCCAGGCTCTGGGAGGTGG - Exonic
917440403 1:175063945-175063967 CTGAGCAGATCTCTTGGATGTGG + Intergenic
917611852 1:176696460-176696482 CTGAGCTAGGCTCCAGGAAGGGG + Intronic
920111869 1:203592586-203592608 CTAAGTAAGGCTGGGGGATGGGG + Intergenic
921384026 1:214551718-214551740 CGGAGCCCGGCTCTGGGGTGGGG - Intronic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
922056629 1:222048356-222048378 CTGAGGAAGGCTCTTGTTTGGGG + Intergenic
922235802 1:223721667-223721689 CTGAGCTAGGCTGTGGGGTGGGG - Intronic
922414580 1:225409201-225409223 CTGAGCCAGGGTCTGTGAAGTGG + Intronic
923022857 1:230178366-230178388 CTGAGCATGGCTCTTGGAGCAGG + Intronic
924215538 1:241817727-241817749 CTGAGCAAGGCAATGGGAAGGGG + Intergenic
1062789538 10:293088-293110 CTGACCAATGCCCTGGGGTGGGG + Intronic
1062947899 10:1474824-1474846 CTGAGCAGGACTCCGGGAGGAGG + Intronic
1062964702 10:1598468-1598490 CTGAGCAAGGCTGGGTGGTGGGG - Intronic
1063668572 10:8081475-8081497 CTCAGAAAAGCTCTGGAATGTGG + Intergenic
1064317151 10:14269109-14269131 ATTGGCAAGGCTGTGGGATGGGG + Intronic
1069570933 10:69493944-69493966 CAGAGCGAGGCTCGGGGAGGAGG + Intronic
1070959588 10:80489402-80489424 CTATGTAAGGCTCTGGGATAAGG + Intronic
1071069070 10:81670218-81670240 CTGAGCAAGGCCCTGGGGAGGGG + Intergenic
1071118587 10:82251921-82251943 CTGAGCAATGGTGTGGGGTGAGG + Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1073549772 10:104387277-104387299 CTGGACTTGGCTCTGGGATGTGG + Intronic
1073694369 10:105848766-105848788 CTGAAAAAGGCTGTGGGGTGTGG - Intergenic
1074110568 10:110419850-110419872 CTGGGCAAGGGGCAGGGATGGGG + Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1075436437 10:122447167-122447189 CTGAGCAAGGCAGTAGGAAGTGG - Intergenic
1075559350 10:123457135-123457157 ATGAGCAGGGCTCTGGGGTCTGG - Intergenic
1075688450 10:124379743-124379765 CCGTGCAAGGCTCTGGGAAGTGG - Intergenic
1075797874 10:125134334-125134356 CTGAGCAAGGCACGGGGCGGGGG - Intronic
1076131646 10:128017845-128017867 CTGAGCCAGGCTGGGGGAGGAGG - Intronic
1076246020 10:128948584-128948606 CACAGCAAGGCCCTGGGATGAGG + Intergenic
1076810623 10:132884685-132884707 CTCTGCAGGGCCCTGGGATGTGG - Intronic
1077039340 11:511807-511829 CTGAGCTAGCCTCTGGGAACCGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077218650 11:1405572-1405594 CTGCCCAGGGGTCTGGGATGGGG + Intronic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077481205 11:2815529-2815551 CTCTCAAAGGCTCTGGGATGGGG - Intronic
1077551600 11:3202970-3202992 GGGAGCAAGGCACCGGGATGTGG + Intergenic
1077707709 11:4503890-4503912 CAGAGCCAGGATCTGGAATGTGG + Intergenic
1077906566 11:6539135-6539157 CTGGGCTGGGCTCTGGGATATGG + Intronic
1078569883 11:12448489-12448511 CTTGGCAATTCTCTGGGATGAGG + Intronic
1078974482 11:16456546-16456568 CTTGGCAAGGATCTGGCATGAGG - Intronic
1079002926 11:16772930-16772952 CTGAGCTTGGCACTGGGTTGGGG - Intergenic
1080669478 11:34362986-34363008 CTGTTCAAGGCTCAGGGAAGAGG + Intergenic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082946883 11:58770741-58770763 CAGGGGAAGGCTCTGGAATGCGG - Intergenic
1083071417 11:59987166-59987188 CTGAATTAGGCTCTGGCATGAGG + Intergenic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083898957 11:65634500-65634522 CTGAGCTGGGCTCTGGGATGGGG + Intronic
1084478165 11:69400683-69400705 CTAGGCAGGGCTCTGGGGTGGGG - Intergenic
1084504724 11:69558217-69558239 CTCAGCAGCCCTCTGGGATGGGG - Intergenic
1084686710 11:70700410-70700432 CTGAGCAAGGCTTTGAGGAGTGG - Intronic
1085386774 11:76162179-76162201 CACAGCAAGGCCCTGGGAGGTGG + Intergenic
1085391134 11:76182899-76182921 CTGAGCAAGCCACTGGTCTGTGG - Intergenic
1088278020 11:108109526-108109548 TTGTACAAGGCTCTGGGAGGGGG + Intergenic
1088813328 11:113406012-113406034 CTGACCCAGGCTCTGGGTAGAGG - Intergenic
1088901575 11:114121727-114121749 CTGGGCAAGGATTTGGGATCTGG - Intronic
1089103082 11:115980554-115980576 CCAAGCAGGGCTCTGGGAGGAGG + Intergenic
1089843088 11:121435700-121435722 CTGAGCAAGGCACTGCAGTGGGG - Intergenic
1090126695 11:124093733-124093755 CCAAGCAAGGCACTGGGATTGGG + Intergenic
1090149989 11:124374100-124374122 CTGAGCAAGGCCCTGGCAGGGGG - Intergenic
1090183175 11:124718495-124718517 CGGGGCGAGGCTCTGGGACGCGG - Intergenic
1090183927 11:124723899-124723921 GTGAGGAAGGCTCTGGGGTGTGG - Intergenic
1091851022 12:3696949-3696971 CTGACCAAGTCTCTGGGGTCTGG + Exonic
1092237407 12:6818911-6818933 CTCAGTAAGGATCTGGGAGGAGG + Exonic
1095227111 12:39690231-39690253 CAGAACAAGCCTCTTGGATGGGG + Intronic
1096332126 12:50722716-50722738 CTGAGGAAGACTCTGGGCAGAGG - Intronic
1097390849 12:59011102-59011124 ATGCGCATGCCTCTGGGATGTGG - Intergenic
1098988235 12:77035610-77035632 TTGAGCTTTGCTCTGGGATGTGG - Intronic
1101275719 12:103198718-103198740 CTGAGCAAATCTCAGGGAAGGGG - Intergenic
1101772842 12:107767418-107767440 CAGAGCATGGCACAGGGATGGGG + Intergenic
1101815554 12:108143523-108143545 CACAGCAAGGCTCTGAGATGGGG - Intronic
1101898124 12:108770668-108770690 CTGAGCAAGGTTCTGGGGTGGGG + Intergenic
1103913063 12:124362673-124362695 CTGGGCCAGGTTCTGGGAGGTGG - Intronic
1103913107 12:124362820-124362842 CTGGGCCAGGTTCTGGGAGGTGG - Intronic
1103981116 12:124737627-124737649 TTGAGCAAAGCTTTGGGAGGTGG - Intergenic
1104421513 12:128639729-128639751 CTGAGGAGGTTTCTGGGATGTGG + Intronic
1104933325 12:132351843-132351865 CTGAGCAAGTCCCTGGGCTCTGG + Intergenic
1104990863 12:132623157-132623179 CTGAACACAGCGCTGGGATGAGG - Intergenic
1108587419 13:51882873-51882895 CTGAGCAAGGCCCTGGGCGGAGG - Intergenic
1109393850 13:61727970-61727992 CTGAGAAAAGCTCTGAGACGTGG - Intergenic
1110380805 13:74848392-74848414 CTGAGCCAGCCTCTGGGTTGGGG - Intergenic
1114562474 14:23603246-23603268 TTGAGCCAGGCTCTGGAAAGCGG + Intergenic
1116053270 14:39831472-39831494 ATGAGCACGGTTTTGGGATGTGG + Intergenic
1116765906 14:49070431-49070453 GTGAGCTAGGGTCTGGAATGGGG - Intergenic
1117330254 14:54705301-54705323 CTGCGCATGGCTCTGGGCTCAGG - Intronic
1117546376 14:56797679-56797701 CAGAGGCAGGCTCTGGAATGGGG - Intergenic
1117998509 14:61500803-61500825 CTGAGCACGGGGGTGGGATGGGG + Intronic
1118412055 14:65490695-65490717 CAGATCAAAGCTCTGGGAGGAGG - Intronic
1118763982 14:68897965-68897987 CTTAGCAAGGCCTTGGGAAGGGG - Intronic
1120028077 14:79608412-79608434 CTTGGCAAGGCTCTTGGAGGTGG + Intronic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121554413 14:94825399-94825421 ATGAGCAAGGTTGAGGGATGAGG + Intergenic
1122054040 14:99080333-99080355 CATGGTAAGGCTCTGGGATGGGG - Intergenic
1122322126 14:100861504-100861526 CTGAGCAAGGCTCTGTGTGTAGG + Intergenic
1122519655 14:102334309-102334331 CTGGGCAAGGCCCTGGAATAAGG - Intronic
1122769357 14:104091153-104091175 CTGCGCCCGGCCCTGGGATGCGG + Intronic
1122954725 14:105065318-105065340 GGGGGCCAGGCTCTGGGATGGGG - Intronic
1123106473 14:105844127-105844149 CTCAGCCACCCTCTGGGATGTGG - Intergenic
1124610233 15:31203082-31203104 CTGGGCAAGGCTCTGTCACGAGG + Intergenic
1125477283 15:40055683-40055705 CAGAGCCAGGGTCTGGGAAGAGG + Intergenic
1125603722 15:40928710-40928732 CTGAGCAAGGCTAGGGGCTAAGG - Intergenic
1126664663 15:51065630-51065652 CTGAGCATCACTCTAGGATGTGG + Intronic
1127370205 15:58332059-58332081 GTGAGGAGGGCTCTGGGAAGAGG - Intronic
1127386071 15:58468240-58468262 GAGAGCAAGGGTCTGGGAGGTGG - Intronic
1127791906 15:62405666-62405688 CTGAGACTGGCTCTGGGGTGGGG + Intronic
1128608906 15:69058407-69058429 CTGAGGCAGGCCCTGGGAAGGGG + Intronic
1129028825 15:72604341-72604363 CGGAGGGAGGCTCGGGGATGGGG + Intergenic
1129229467 15:74188807-74188829 ATGAGGAAGGCCATGGGATGGGG - Intronic
1130212943 15:81942949-81942971 CTGAGCAAGGCACAGTGAGGAGG + Intergenic
1133473366 16:6096873-6096895 CTGAGGAAGGGTCTGGGACTTGG - Intronic
1133701140 16:8310323-8310345 CTGGGGAAGTCTCTGGGCTGGGG - Intergenic
1133829724 16:9310406-9310428 AAGACCAAGGCTCTTGGATGAGG - Intergenic
1134225653 16:12387840-12387862 CTGAAGCAGCCTCTGGGATGTGG + Intronic
1134228189 16:12408376-12408398 CTCAGCCTGGCTCTTGGATGTGG - Intronic
1134647701 16:15883468-15883490 CTGAGCAGGGGTCGGGGAGGGGG - Intronic
1134892547 16:17853864-17853886 CTGTGCAAGGAGCTGGGAAGTGG - Intergenic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1135624788 16:23984832-23984854 CTGGGGAAAGCTCAGGGATGGGG + Intronic
1136087965 16:27899064-27899086 ATGGGCAAGGCTCGGGGAGGAGG + Intronic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1137251103 16:46741563-46741585 CCCAGCAAGGCTCTGGGCTGTGG - Intronic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137788469 16:51155125-51155147 CTGACCTCGGGTCTGGGATGGGG + Intergenic
1138218880 16:55232931-55232953 ATGGGCACAGCTCTGGGATGTGG - Intergenic
1138458004 16:57132365-57132387 CTGTGCAAAGGTCTGGGAGGAGG + Intronic
1138537130 16:57666173-57666195 CTGGGCTAGGTCCTGGGATGGGG + Intergenic
1139357296 16:66374254-66374276 GTGCTCAAGGCTCTGGCATGGGG + Intronic
1139478927 16:67217614-67217636 CTGAGGAAGGCACAGGGCTGGGG - Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141988424 16:87594858-87594880 CTGGGCAAGGCTTTGGGAAGGGG - Intergenic
1142036723 16:87867016-87867038 CTGAGGCATGCTCCGGGATGTGG - Intronic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1143100110 17:4499972-4499994 CTGACAAAGGCTCCGGGCTGCGG + Intronic
1143116892 17:4586019-4586041 CTCAGCAAGGCTTTGTGCTGGGG + Intronic
1143587943 17:7860634-7860656 CTCAGCAAGTATTTGGGATGTGG + Exonic
1145302194 17:21648518-21648540 CTGTGCAAGGTTCGGGGTTGAGG - Intergenic
1145348121 17:22054798-22054820 CTGTGCAAGGTTCGGGGTTGAGG + Intergenic
1145829802 17:27906808-27906830 CTGCGCTGGGCTTTGGGATGGGG + Intergenic
1146517226 17:33498648-33498670 CTGCGCTGGGCTCTGGGATGTGG + Intronic
1147304875 17:39556340-39556362 CTGAGAATGCCACTGGGATGGGG + Intronic
1147892814 17:43729219-43729241 CTGAGTGAGGCAGTGGGATGGGG + Intergenic
1148911719 17:50946576-50946598 CTGAGCCAGGCTCTGGTGGGAGG - Intergenic
1149453702 17:56770311-56770333 CTGAGGAAGGCAGCGGGATGAGG + Intergenic
1150803710 17:68302273-68302295 GGGAGCAGGTCTCTGGGATGTGG - Intronic
1151348052 17:73515416-73515438 CAGAGCCAGATTCTGGGATGAGG + Intronic
1151999599 17:77637187-77637209 CTGAGCCAGGTTCTGGAATCTGG + Intergenic
1152333360 17:79686132-79686154 CTGGGTAAGGCTGTGGCATGAGG + Intergenic
1153807653 18:8723339-8723361 CTGAGCTTTGCTCTGGGGTGAGG + Intronic
1154380926 18:13849155-13849177 CTGAGAAAGTCTGTGAGATGGGG - Intergenic
1155238334 18:23843451-23843473 CAGAGAAAGACTCTGGGGTGTGG - Intronic
1157280285 18:46342443-46342465 ATGTGCAAGGCTCAGGGTTGGGG - Intronic
1157303104 18:46494602-46494624 CAGAGCAACACTCTGGGATCTGG + Intronic
1160460664 18:79036072-79036094 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160460832 18:79037034-79037056 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160984038 19:1829183-1829205 CTGAGCAGGGCCGGGGGATGGGG + Intronic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1161746235 19:6061806-6061828 CTGAGAAAGGGGCTGGGAGGGGG + Intronic
1162018142 19:7856666-7856688 CAGAACAAGGCTTTGGGGTGAGG - Intronic
1162753334 19:12841903-12841925 CAGGACAAGGCTCTGGGATAGGG + Intronic
1162777329 19:12987792-12987814 CTGAGCAGGGCTCTTGGGTGAGG - Intergenic
1163634070 19:18430371-18430393 CTGAGAGAGGCTGGGGGATGGGG + Intronic
1163676113 19:18656117-18656139 TTGAGCAAGGCTCAGGAAAGGGG + Intronic
1163678119 19:18665689-18665711 CAGAGCAGGGCTGTGGGGTGGGG + Intronic
1165167139 19:33864560-33864582 AGGAGCAGGGCTCTGAGATGGGG + Intergenic
1165718653 19:38063364-38063386 CTGAGGATGGCTCTAGGCTGAGG - Intronic
1165886910 19:39084832-39084854 AGGAGCAAGGCTCTGGAATCAGG + Intronic
1166299579 19:41906392-41906414 CTGGGCTGGGATCTGGGATGGGG - Intronic
1166320556 19:42015947-42015969 CTATGCTAGGCACTGGGATGGGG + Intronic
1168403709 19:56100116-56100138 CTGAGGAAGGGTCCGGGGTGAGG + Intronic
1168465427 19:56597464-56597486 CTGGGGAAGGCTGTGGAATGAGG - Intronic
925026749 2:614517-614539 ATGCGCAATGCTCAGGGATGTGG + Intergenic
925039620 2:721245-721267 CTGTGCAAGGCTCTGATGTGTGG - Intergenic
925100830 2:1244007-1244029 CAGAGCAAGACTCTGGCCTGGGG + Intronic
925201422 2:1970163-1970185 CTGAGTCCGGCTCTGGGAAGTGG - Intronic
925633996 2:5924806-5924828 CTGAGCAGGGACCTGGGCTGGGG + Intergenic
926060475 2:9801701-9801723 GGGAGCAAGGCTCCGGGAGGTGG - Intergenic
926410391 2:12596531-12596553 CTGAACAAGGCTGAGGGAAGAGG - Intergenic
926761720 2:16284138-16284160 ATGAGGCAGGTTCTGGGATGTGG - Intergenic
927277187 2:21272147-21272169 ATGAGCAAGGCTCTGGGTGTGGG + Intergenic
927561431 2:24076766-24076788 CTGAGCAAGGCGGTGAGCTGGGG + Intronic
928180211 2:29063287-29063309 CTGAGCACTTCTCTGAGATGAGG + Exonic
928391180 2:30912193-30912215 CTCAGCAGGTCCCTGGGATGTGG - Intronic
929534406 2:42771617-42771639 CTGAGCCAGGCTGGGGGCTGGGG - Intronic
929564235 2:42974925-42974947 CTGAGCATTCCTCTGGGATGAGG - Intergenic
930089774 2:47523312-47523334 CTGAGCATGGCTCTGCCATTGGG + Intronic
930154762 2:48094670-48094692 CAGTGCAAGGCTCTTGGTTGGGG - Intergenic
930180250 2:48348921-48348943 TGGAGCAAGGCTTTTGGATGGGG + Intronic
931103705 2:59031275-59031297 CTGAGCCAGACACTGGGATGAGG - Intergenic
932306212 2:70705707-70705729 CTCAGCCGGGCTGTGGGATGGGG - Intronic
932892670 2:75610321-75610343 CTGACCACAGCTCTGTGATGTGG - Intergenic
933748161 2:85585516-85585538 CTGAGGAAGGCTCTGAGAATAGG + Intronic
933987515 2:87604218-87604240 CTGAGCAAGTCCCTGGGAGAGGG + Intergenic
934477706 2:94604147-94604169 CTGACCAGGGCCCTGGGTTGGGG + Intronic
934856370 2:97732770-97732792 CTCTGCAAGGCTCTGAGGTGTGG + Intronic
936013187 2:108938798-108938820 CAGAGCAAGACTCTGGGGGGTGG - Intronic
936306324 2:111346590-111346612 CTGAGCAAGTCCCTGGGAGAGGG - Intergenic
938145663 2:128833153-128833175 CTGAGCCATGCTCTAGCATGAGG + Intergenic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
939219076 2:139279397-139279419 CTGAGCAAGGCGCCTGGATCTGG - Intergenic
939991183 2:148877189-148877211 CTGGGCAAGGCTCTGGCCTCAGG + Intronic
941352142 2:164450025-164450047 CTGAGCAGGGCTTGGGGAAGGGG - Intergenic
941754740 2:169173088-169173110 ATGAGCAAGGCTGTGGTAGGAGG - Exonic
942227729 2:173831732-173831754 CTGAGCAAGGGTCAGGGGTCGGG + Intergenic
943483643 2:188454038-188454060 CTGAGCAAGGCTCAGGCAGCAGG - Intronic
944209346 2:197190286-197190308 TATAGCAAGGCTTTGGGATGTGG - Intronic
944401767 2:199335038-199335060 CTAAGCAATGCTCTGGGGTGTGG - Intronic
944661224 2:201923542-201923564 CTGGGGAAGGCAGTGGGATGAGG + Intergenic
945221965 2:207492750-207492772 CTTGGCAAGGCTCTTGGATGAGG - Intergenic
945526600 2:210895409-210895431 CAGACCAAGGCTCAGGGATTGGG + Intergenic
945978091 2:216286107-216286129 CTTAGCCAGGCACTGGGATTAGG - Intronic
946241269 2:218357407-218357429 GTGAGGAAGGCTGTGGGATGAGG + Intronic
946477581 2:220023435-220023457 CTGGGCCAGGCTCTAGGATGTGG + Intergenic
947916799 2:233837887-233837909 CTGGGCCAGGGTGTGGGATGTGG - Intronic
948298158 2:236879821-236879843 CTAAGCAGGGGTCTGAGATGAGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1170474772 20:16703954-16703976 CAGAGAAAGGCTCTCGGAGGTGG + Intergenic
1170592921 20:17784770-17784792 ATGAACAGGGCTCTGTGATGGGG + Intergenic
1171558078 20:26096265-26096287 CTGTGCAAGGTTCGGGGTTGAGG + Intergenic
1172005786 20:31818551-31818573 CTGAGAAAGGCTCTGGGTGATGG + Intergenic
1172266831 20:33623173-33623195 CTGAGCCAGGTACTGGGATGGGG - Exonic
1172648093 20:36483975-36483997 CTCAGCCAGGCTCTGGCAGGTGG + Intronic
1172807849 20:37625659-37625681 GTGAGCAAGGCTCTGTGTTCTGG - Intergenic
1173330740 20:42074368-42074390 GTGAGCAGGACTCTTGGATGTGG - Exonic
1173494482 20:43508639-43508661 ATGTGCACGGCTCTGGGCTGGGG + Intronic
1174419046 20:50387540-50387562 CTGGGCAAGGCTCTGGGGACGGG - Intergenic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1175277089 20:57779596-57779618 CTGAGGAATGCAGTGGGATGTGG - Intergenic
1175360048 20:58402600-58402622 CTGTGCTAGGCACTGGGATGTGG - Intronic
1176905636 21:14497240-14497262 CTGAGCAAGACTCTGGGCCAGGG - Intronic
1178894322 21:36546259-36546281 CTGAATCAGGCTCTGGGATGAGG - Intronic
1179354755 21:40648990-40649012 CTGAGCAAGGCCCAGGCAGGGGG + Intronic
1179485843 21:41710350-41710372 CTGAAGGAGGCTCTGGGAAGTGG + Intergenic
1179919981 21:44502810-44502832 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179919997 21:44502856-44502878 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920076 21:44503129-44503151 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920130 21:44503296-44503318 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920159 21:44503388-44503410 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920264 21:44503722-44503744 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920331 21:44503935-44503957 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920488 21:44504501-44504523 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1179920550 21:44504736-44504758 GGAAGCAAGGCTCTGGGAGGAGG + Intronic
1180868665 22:19133992-19134014 CTTGGCAAGGCCCTGGGGTGTGG + Exonic
1182026717 22:27124832-27124854 CTGAGCAATGCTCTCAGCTGGGG - Intergenic
1182049729 22:27303501-27303523 CTAAGCAAGGCACTGGGAGGTGG - Intergenic
1182623960 22:31632565-31632587 ATGTGCATGGCTTTGGGATGTGG - Intronic
1183248943 22:36714653-36714675 CTCAGCAAGGAGCTGGGAAGAGG - Intergenic
1183530034 22:38348387-38348409 CTGAGCATAGCTCTGAGAGGCGG + Intronic
1184119673 22:42441569-42441591 CTGAGCAAGGTCCTGGAATGAGG - Intergenic
1184253333 22:43273296-43273318 CTGGTCAAGGCCCTGGGGTGGGG - Intronic
1184645459 22:45892470-45892492 CTGGGCAGGGCCCTGGGCTGCGG + Intergenic
1185255971 22:49831739-49831761 TTGATCCAGGCTCTGGGCTGAGG + Intergenic
950092947 3:10310012-10310034 CAGAGCAAGCCTCTGGGACAGGG - Intronic
950454359 3:13083957-13083979 CTGGGGAAGGCTAGGGGATGGGG - Intergenic
950480076 3:13238589-13238611 CTGCTCTAGGCTCTGGAATGTGG - Intergenic
950609947 3:14120099-14120121 CTGACCAAGGTTCTGGGGTGGGG - Intronic
950810041 3:15642357-15642379 CTAAGCAAGGGCATGGGATGAGG - Intronic
950888048 3:16377868-16377890 CTGAGCTGGGCTCTGGGCTTTGG + Exonic
952311513 3:32194745-32194767 CTGAGCCAGGCTGTGTCATGGGG - Intergenic
953864850 3:46575413-46575435 CTGGGCCAGGTTTTGGGATGGGG - Intronic
953920073 3:46945438-46945460 CTGCTGAAGGCTCTGGGAGGAGG - Intronic
954325595 3:49861667-49861689 CTGAGCAAGGCACAGGGACCTGG + Intronic
955801637 3:62693051-62693073 GTAAGCAGGGCTCTGGGATGGGG - Intronic
956406718 3:68935404-68935426 GTGAGCCAGGCTCTAGGATATGG + Intergenic
957790389 3:84933069-84933091 ATGAGCTAAGCTCTGGGTTGAGG - Intergenic
957821501 3:85381750-85381772 CTGAGCAGGGCTGCAGGATGTGG + Intronic
959728105 3:109568692-109568714 CTGGGCAAGGGTAGGGGATGAGG + Intergenic
960792884 3:121452537-121452559 CTCAGCAAGGCTCAGGGATTAGG + Intronic
961318178 3:126054852-126054874 CTCAGCACAGCTCTAGGATGAGG + Intronic
961511599 3:127407069-127407091 CTAAGGAAGCCTCTGGGGTGTGG - Intergenic
961658928 3:128458120-128458142 CAGAGCAGGGCTCTGGGTGGAGG + Intergenic
961692039 3:128676863-128676885 TTGGGCCAGGCTCTGAGATGTGG - Intronic
961751909 3:129101551-129101573 CTGAGCAAGTGTCTGAGCTGAGG + Intronic
963741256 3:149084405-149084427 ATGAACAAGGCGCTGGGGTGTGG + Intronic
965960326 3:174421949-174421971 TTGAGCAAAGCTTTGTGATGTGG - Intergenic
966064382 3:175800259-175800281 GTGAGCAATGCTCTGGTATAAGG - Intronic
966284087 3:178272692-178272714 CTGAGCAAGGCTTTGGAATGAGG + Intergenic
966319098 3:178680717-178680739 CTGAGCAAGGTTGTTGAATGAGG - Intronic
966938069 3:184727065-184727087 CTGGTCAAGGCACTGGGGTGAGG - Intergenic
967771946 3:193343836-193343858 CTTAGCAAGGGTCTGGTATAAGG + Intronic
967857509 3:194129573-194129595 CTCAGGAAGCCTCTGGAATGTGG - Intergenic
968334336 3:197900554-197900576 CAGAACAAGGCTCTGGGCAGAGG + Intronic
968334355 3:197900677-197900699 CAGAACAAGGCTCTGGGCAGAGG + Intronic
968450086 4:671556-671578 CAGAGCCTGGGTCTGGGATGAGG + Intergenic
968614919 4:1573447-1573469 CTGAGGGAGGAGCTGGGATGAGG - Intergenic
968632329 4:1658516-1658538 CTAAGCCAGGCTCTGGAGTGTGG + Intronic
968799792 4:2734412-2734434 CTGAGCAGGGCTCAGAGCTGAGG - Intergenic
968855403 4:3116581-3116603 GTGTGCTAGGCTCTGGGATAGGG + Intronic
969263665 4:6050133-6050155 CTGAGCAGGGCTCTAGGACACGG + Intronic
969416349 4:7062279-7062301 GAGAGCAAGGCTGTGGGGTGGGG - Intronic
969870303 4:10100526-10100548 CTGAGCCATCCTCTGAGATGAGG + Intronic
972285027 4:37639943-37639965 TTGAACAAGGCTCTTGGGTGGGG - Intronic
974566228 4:63580787-63580809 CTGAGCAAGGTCCTGGGTAGAGG - Intergenic
976766435 4:88602907-88602929 CTGAGCAAGAGTTTTGGATGAGG - Intronic
978541709 4:109823144-109823166 ATGAGCAGGGCTCTGGGGAGTGG + Intronic
979282881 4:118887104-118887126 ATGAGCACAGCTTTGGGATGTGG - Intronic
982925442 4:161331578-161331600 CTGACCATGGCTCTGGCATGAGG + Intergenic
985589387 5:756827-756849 CTGAGCAAGTCTCGGGGAGAGGG - Intronic
985755042 5:1708805-1708827 CTGAGCAGGGCACTGGGCAGTGG + Intergenic
986334670 5:6745031-6745053 CTGGACAAGGCACAGGGATGTGG - Intronic
986447278 5:7832345-7832367 CTGAGCCAGGATCTGGGTGGTGG - Intronic
987063036 5:14260956-14260978 GTGAGCAAGGCCCCTGGATGAGG + Intronic
990273195 5:54167925-54167947 CTGAGAAAGGCCATTGGATGTGG - Intronic
996625319 5:125563648-125563670 CTGAACAAGGCTCTAAGGTGGGG - Intergenic
997311830 5:132892302-132892324 CAGAGCATGGCTCTCGGAAGAGG - Exonic
997726683 5:136126748-136126770 TTGAGCTAGGCTCTGGACTGTGG + Intergenic
998370378 5:141656772-141656794 CTGAGCAGGGCTCTGGGAGCTGG + Exonic
998812129 5:145976938-145976960 ATGAGCCAGACTCTGGGAAGGGG - Intronic
999141336 5:149364345-149364367 CAGAGCAAGCCCCTGGCATGAGG + Intronic
999715429 5:154356383-154356405 ATGAGAAAGGCTCTGGGAGAGGG + Intronic
1000362150 5:160457634-160457656 GGGAGCATGGCTCTGGGATTAGG + Intergenic
1000369226 5:160519089-160519111 CTAGGCATGGCTCAGGGATGAGG + Intergenic
1000561614 5:162796337-162796359 CTGAGTGAGGCCCTGGGATCAGG - Intergenic
1000749398 5:165075065-165075087 CTGTGCAGTGCTCTGGGAAGGGG - Intergenic
1005086298 6:22010306-22010328 CTGTGCACAGCTCTGGGATGTGG + Intergenic
1005137733 6:22590258-22590280 CTGTGCAAGGCTCTCAGTTGGGG - Intergenic
1005231146 6:23703212-23703234 CTGGGCATGTCTTTGGGATGTGG - Intergenic
1006031401 6:31179253-31179275 CTCAGGAAGGCACTGGGAGGTGG - Intronic
1006514441 6:34538194-34538216 CTCAGCCAGGCCCTGAGATGGGG - Exonic
1006807403 6:36797629-36797651 CTGAAGCGGGCTCTGGGATGAGG - Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1007724549 6:43907175-43907197 CTGAGGGAGGCTGTGGGAGGAGG - Intergenic
1009893751 6:69721432-69721454 GTGAGCTAGGCCCTGGAATGGGG - Intronic
1009994074 6:70879884-70879906 TTGAGCGAGGCTCGGGGGTGGGG + Intronic
1010596483 6:77769697-77769719 AGGAGCTAGGGTCTGGGATGGGG - Intronic
1010801433 6:80180039-80180061 CTGTGCAAACCTCTGGGCTGTGG + Intronic
1013670684 6:112399416-112399438 CTGAGCAAGGCCCTGGCAGAGGG - Intergenic
1013822063 6:114166304-114166326 CTGAGCACTGTGCTGGGATGTGG - Intronic
1016091506 6:139984869-139984891 CTGAGCACTGCTCTGGGAGTCGG + Intergenic
1017730074 6:157307530-157307552 CTGAGCAAGTCCCTGTGATTCGG + Intronic
1017945672 6:159094607-159094629 CTGAGCCAGGCTCTGGGCCGCGG - Intergenic
1018021083 6:159762516-159762538 CTGAGCCCGGCTTTGGGCTGGGG + Intronic
1018088945 6:160329223-160329245 CTGTGCAAGACTCTGAGACGTGG + Intergenic
1018478452 6:164166789-164166811 CTGAGCAGGGCTCTGGGGCCAGG - Intergenic
1019065028 6:169289137-169289159 CTGAGCTTGGCTCTGGCTTGTGG - Intergenic
1019485799 7:1288723-1288745 CTGAGAAAGGGCCTGGGCTGGGG - Intergenic
1020380288 7:7537300-7537322 ATGGGCAAAGCTTTGGGATGTGG + Intergenic
1022104040 7:27185749-27185771 CAGAGCAAGTCTATGGGAGGGGG - Intergenic
1022112535 7:27240267-27240289 CTGGGGAAGGCTTTGGGCTGAGG + Intergenic
1022955729 7:35378347-35378369 CTGAGCAAAAGTCTGTGATGAGG + Intergenic
1022973405 7:35536956-35536978 CTGAACTAGGCACTGGGAAGGGG + Intergenic
1023083449 7:36546874-36546896 CTGTGCCAGGCTCTAGGATATGG - Intronic
1023204000 7:37728656-37728678 GTGGGCAAGGCTTTGGGAAGGGG + Intronic
1024035475 7:45504460-45504482 CTGAGCCTGCCTCTGGGTTGGGG - Intergenic
1024233440 7:47380094-47380116 CTGGGTGAGGCTCTGGAATGTGG + Intronic
1024983965 7:55180108-55180130 CTGAGCCAGGCTCTGAGATAGGG - Intronic
1025251970 7:57357461-57357483 CTGGGCAAGGCTCTGGGGACGGG + Intergenic
1026110239 7:67453665-67453687 CTGAAAAAAGCTCTGGGTTGGGG + Intergenic
1026959138 7:74397546-74397568 CTGAGCAAGGAACTGGCTTGTGG - Intronic
1029436737 7:100568002-100568024 CTGGGCAAGCCTCAGGGGTGGGG - Exonic
1030966262 7:115996284-115996306 ATGAGCTAGGCTCTGCAATGAGG - Intronic
1032336458 7:131029369-131029391 TTGAGCCAGGCTCTGTGATAGGG - Intergenic
1032473162 7:132192911-132192933 CTCAGAAAGGCCATGGGATGGGG + Intronic
1033346070 7:140526503-140526525 CTGGGCAGGTCTCTGGGATATGG - Intronic
1033469558 7:141632589-141632611 CTGGGCTAGGCTCTTAGATGGGG + Intronic
1033622033 7:143070205-143070227 CTGAGGATGGTCCTGGGATGTGG - Intergenic
1034432593 7:151048628-151048650 CTGGGCTAGGCACTGGGCTGGGG - Intronic
1034529620 7:151687734-151687756 TGGAGCAAGGCCCTGGGCTGCGG - Intronic
1035185915 7:157125727-157125749 CTGAGCAAGGGTGTGGGCCGTGG + Intergenic
1036632499 8:10525374-10525396 ATAAGAAAGGCTCTGAGATGAGG + Intergenic
1036813272 8:11882339-11882361 CAGAGCCAGGCTCTGCAATGAGG - Intergenic
1037102318 8:15061723-15061745 TTGAGCAAGGCACTGGCATTTGG - Intronic
1037476672 8:19264563-19264585 CTGAGCAAAGCTCTGGCTTTGGG + Intergenic
1040417461 8:47207782-47207804 CTGAGCCAGGCTCAGGGAGAAGG - Intergenic
1040509460 8:48081238-48081260 CTGAGCAAGGTCCGGGGTTGGGG + Intergenic
1045393496 8:101737809-101737831 CTGAGAAAGGCGCTGGCATGTGG + Intronic
1045556862 8:103222977-103222999 CTGAGTAGGTTTCTGGGATGTGG + Intronic
1045912932 8:107431511-107431533 CTGTGCAAGGCTCCGGGACCTGG - Intronic
1047287222 8:123497551-123497573 CTGTGCAAGGCACTGGGAATAGG - Intergenic
1048311146 8:133323336-133323358 CTGAACAAGGCCCTTGGATAGGG - Intergenic
1048802958 8:138211018-138211040 AGGAGCATGGCTCTGGGATCAGG - Intronic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049242784 8:141546902-141546924 CTGGGCTGGGATCTGGGATGTGG + Intergenic
1049306328 8:141906230-141906252 CAGAGAGAGGCTGTGGGATGGGG + Intergenic
1049434969 8:142582272-142582294 CTGACCAGGGCTCTGGGGAGGGG + Intergenic
1052503498 9:29323255-29323277 CTGAGCATAACTCTGGGATGTGG + Intergenic
1052852254 9:33385409-33385431 CTGACCAGGGCCCTGGGTTGGGG - Intronic
1055964203 9:81849650-81849672 CTGTGCTGGGCTCTGGGATGCGG + Intergenic
1057294997 9:93829729-93829751 CTTAGCCTGGCTCTGGGATTTGG - Intergenic
1058142311 9:101370127-101370149 CTGTACAAGGATCTGGGATATGG + Intronic
1058811569 9:108644582-108644604 AAGAGCCAGGCTCTGTGATGTGG + Intergenic
1059405225 9:114095089-114095111 CTCAGGAAGGCACTGGGCTGAGG + Exonic
1060528822 9:124335682-124335704 CTGCGCAGGGTACTGGGATGCGG + Intronic
1060785464 9:126448901-126448923 ATGATCAAAGTTCTGGGATGAGG - Intronic
1060795069 9:126507709-126507731 CAGAGCAGGGGTCTGGGATGTGG - Intergenic
1061400586 9:130366071-130366093 CTCAGCTAGGCTCTGGGGTGGGG - Intronic
1061465176 9:130772710-130772732 CTGAGCAAGGGCATGGGAAGAGG + Intronic
1061645327 9:131996301-131996323 CTGAGAAAGGCACAGTGATGAGG + Intronic
1061707849 9:132466732-132466754 CTGGGCAAGTCCTTGGGATGTGG - Intronic
1061899218 9:133664455-133664477 CCGAGCCAGGGTGTGGGATGGGG - Intronic
1061976345 9:134069783-134069805 CAGGGCAAGGCTCTAGGACGAGG + Intergenic
1062282739 9:135759253-135759275 AGGGGCAAGGCTCTGAGATGGGG + Intronic
1062685248 9:137809384-137809406 CAGAGCCAGTCCCTGGGATGTGG + Intronic
1186565962 X:10662868-10662890 CTGAGCAAGGATGTGGAATCTGG - Intronic
1186566024 X:10663593-10663615 CTGAGCAAGGATGTGGAATCTGG + Intronic
1187090979 X:16096189-16096211 ATGAGCTAGGACCTGGGATGGGG + Intergenic
1187186028 X:16986792-16986814 CTGAGTAAGTTCCTGGGATGTGG - Intronic
1188302098 X:28517099-28517121 TTGAGCAAGTCTATGGGATGGGG - Intergenic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1190047616 X:47125312-47125334 CCGAGCAACCCTGTGGGATGAGG - Intergenic
1192055017 X:67765185-67765207 CTGTGCAAGGCCCTGGCAGGCGG + Intergenic
1192533320 X:71908320-71908342 GGGAGCCAGGCTCTGGTATGTGG - Intergenic
1193082934 X:77423402-77423424 GTCAGCAAGGCTGTGGGGTGGGG + Intergenic
1195905013 X:109835990-109836012 CTGATGAAGGCTCTGGGTAGAGG - Intergenic
1196874696 X:120147032-120147054 CTGGGCAGGCCACTGGGATGCGG - Intergenic
1197375953 X:125682250-125682272 CTGAGCTAGGGCCTGGAATGTGG - Intergenic
1197652577 X:129081937-129081959 CTGAGTCAGCCTCTGGGTTGAGG + Intergenic
1199976395 X:152897349-152897371 GTGTGCAAGGCCCTGGGCTGGGG - Intergenic
1200017747 X:153179339-153179361 CTGACCCAGGCTCTGTGAGGAGG + Exonic
1200117835 X:153776939-153776961 CTGGGCCAGGCTCTGGGAGATGG - Exonic
1200218145 X:154377941-154377963 CTGATCAAGGCCCTGGGAATGGG + Intergenic
1202263813 Y:22997275-22997297 CTGAGCAAGGCTCAGGCAGGAGG - Intronic
1202380918 Y:24276214-24276236 CTGTTCAAGCCTCTGGGAGGTGG + Intergenic
1202416804 Y:24631017-24631039 CTGAGCAAGGCTCAGGCAGGAGG - Intronic
1202453983 Y:25039069-25039091 CTGAGCAAGGCTCAGGCAGGAGG + Intronic
1202489866 Y:25393911-25393933 CTGTTCAAGCCTCTGGGAGGTGG - Intergenic