ID: 902334402

View in Genome Browser
Species Human (GRCh38)
Location 1:15746806-15746828
Sequence GAGCAGGGAGGTCCAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902334396_902334402 -3 Left 902334396 1:15746786-15746808 CCTGTGGAGGGTGGGTCAGGGAG 0: 1
1: 1
2: 3
3: 52
4: 368
Right 902334402 1:15746806-15746828 GAGCAGGGAGGTCCAGTCCGGGG 0: 1
1: 0
2: 2
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902334402 Original CRISPR GAGCAGGGAGGTCCAGTCCG GGG Intronic
900365785 1:2311460-2311482 GAGCACAGAGGACCAGCCCGGGG + Intergenic
900537356 1:3185484-3185506 GTGCAGGGATGTCCAGGCTGCGG + Intronic
900537362 1:3185512-3185534 GTGCAGGGATGTCCAGCCTGCGG + Intronic
901880769 1:12192554-12192576 GAGCAGGGAGGGGCTGTCCCTGG + Intronic
902334402 1:15746806-15746828 GAGCAGGGAGGTCCAGTCCGGGG + Intronic
902572388 1:17355084-17355106 GACCAGGGAGGTCCTCTCTGGGG + Intronic
902896680 1:19484798-19484820 GGGCAGTGAGGTCCAGACGGGGG + Intronic
903548579 1:24142258-24142280 GAGCAAGGAGGGCCTGGCCGAGG + Intronic
903557117 1:24202214-24202236 GAGAAGAGAGGACCAGTCCCAGG - Intergenic
904883462 1:33717855-33717877 GAGGAGGGAGCTCCAGTAAGGGG + Intronic
905325094 1:37146182-37146204 GAGCAGGGAGGCCTTGTCAGGGG + Intergenic
906219316 1:44066239-44066261 GAGCTGGGAGGTCAAGGCTGCGG + Intergenic
906324331 1:44835146-44835168 GAGCCGGGAGGTCAAGGCTGCGG - Intronic
907460761 1:54604168-54604190 GAGAAGGGAGGTCCAGGCTTGGG - Intronic
915733785 1:158071986-158072008 GAGCAGTGAGGTGCAGGCCTCGG - Intronic
915733948 1:158072830-158072852 GAGCAGTGAGGTGCAGGCCTCGG + Intronic
916517357 1:165532193-165532215 GACCAGGGAGGGCCAGTCTGGGG + Intergenic
918057363 1:181033593-181033615 GAGCAGGGAGTTCCAAGCCGTGG + Intronic
919241382 1:194921103-194921125 GAGCAAGGAGAACCAGTCTGAGG - Intergenic
920218622 1:204378927-204378949 GAGCCGGGAGGTCGAGGCTGCGG + Intergenic
921706223 1:218324514-218324536 CAGCAGGGAGGTGCAGGCGGTGG - Intronic
922776988 1:228219358-228219380 GTGCAGGGAGGTGCAGGCTGAGG + Exonic
922782500 1:228264150-228264172 GAGCAGGGAGGTGCAGGCTGAGG + Exonic
922801619 1:228367212-228367234 GGGCAGGCAGGGCCAGGCCGGGG + Intronic
1065275973 10:24086012-24086034 GGGCAGGGAGGAGCAGTCAGGGG - Intronic
1068083521 10:52347430-52347452 GAGCAGGGAGAACCAGGCAGTGG - Intergenic
1069845557 10:71368503-71368525 GGGCAGGGAGATCCAGACAGGGG - Intergenic
1070794858 10:79210558-79210580 GAGCAGGGTGCTCCAGGCAGAGG + Intronic
1074243866 10:111668297-111668319 GAGCAAGGAGAGCCAGTCTGAGG + Intergenic
1075616057 10:123891645-123891667 GAGCAGGCATGTCCCGCCCGGGG - Exonic
1075709611 10:124523647-124523669 AAGCAGGGGGGTCCAGGCTGTGG + Intronic
1075728669 10:124623491-124623513 GAGCAGGGCGGTCCAGGCCCTGG + Exonic
1078208725 11:9252925-9252947 GTCCAGGGAGGTCCAGACTGTGG - Intronic
1079373640 11:19872839-19872861 GGGCAGGGAGGCCTAGTCCAGGG - Intronic
1081757627 11:45555939-45555961 AAGCAGGGAGGTCAAGTCCAAGG - Intergenic
1081867332 11:46366960-46366982 GAGCAGGGCGCTCCAGGCCTGGG - Exonic
1083400168 11:62418084-62418106 AGGCAGGGAGGTCGAGTCAGGGG + Intronic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084680510 11:70663707-70663729 GTGCAGGGAGGTCCACTCTGGGG + Intronic
1084709554 11:70835581-70835603 GAGAAGAGATGTCCAGTCCCTGG + Intronic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1088722953 11:112610743-112610765 GAGAATGAAGGTCCAGTCCCTGG - Intergenic
1088879556 11:113962862-113962884 GAGCGGGGAGCTCCAGGCAGAGG + Intergenic
1089862693 11:121604218-121604240 GAGCAGGGAGTTCCAGTGCGAGG + Exonic
1090091664 11:123703454-123703476 GAGCAGGGAGATCCATTAGGAGG + Intergenic
1090662556 11:128892087-128892109 GAGCAGGGAGGGCCAGGATGGGG + Intronic
1091666209 12:2420227-2420249 GAGGAGGGAGGTTCAGTTAGTGG - Intronic
1092022871 12:5216648-5216670 TAGCAGGGAGGTCCAGGCTTAGG + Intergenic
1095371343 12:41470828-41470850 GAGCCAGGAGGTACAGTCCCTGG + Intronic
1104965664 12:132507826-132507848 CAGCAGGGAGGGGCAGTCCTGGG + Intronic
1107467476 13:40664574-40664596 GAGCATGGAGGACCAGGCGGGGG - Intronic
1108904608 13:55452655-55452677 GAGCAAGGAGAGCCAGTCTGAGG - Intergenic
1111343079 13:86913825-86913847 GAGCAGGGAGGCCCTGTGCCTGG - Intergenic
1113616660 13:111685262-111685284 GCTCAGGGAGGGCCAGTGCGGGG - Intergenic
1113622190 13:111770533-111770555 GCTCAGGGAGGGCCAGTGCGGGG - Intergenic
1113626641 13:111852812-111852834 GAGCAGGGGTCTCCAGTCCCTGG + Intergenic
1113654087 13:112057343-112057365 GGGGAGGGAGGTCGAGTCTGTGG + Intergenic
1114252196 14:20971181-20971203 GAGCAGTGAGGGCAAGTCTGGGG + Intergenic
1116783585 14:49264247-49264269 GAGCAGGGAGGTGCAGGATGAGG + Intergenic
1119428870 14:74552799-74552821 GAGCAGCGGGCTCCAGTCCAAGG + Intronic
1121100111 14:91244696-91244718 GAGCTGGGAGGTTCAGGCTGCGG - Intronic
1122941998 14:104985666-104985688 GGGCAGGGAGGGCGGGTCCGGGG + Intergenic
1124121589 15:26893491-26893513 CAGGAGGGAGGTCCAGGCCCAGG - Intronic
1124997443 15:34737429-34737451 GAGCAGAGAGGACCAGAGCGAGG - Intergenic
1125501470 15:40242415-40242437 GAGCAGGAAGGCCCAGGCTGCGG + Intronic
1127773213 15:62246735-62246757 TAGCAGGGAGGCCAAGTCTGGGG - Intergenic
1127774513 15:62254649-62254671 TAGCAGGGAGGCCAAGTCTGGGG - Intergenic
1129174422 15:73829815-73829837 GTGCAGGGAGGCCCAGTCTCAGG + Intergenic
1132402826 15:101523873-101523895 GAGCAGGGAGGAGCAGTTTGAGG - Intronic
1132578636 16:675274-675296 AAGCAGGGAGCTCCAGCCGGTGG + Intronic
1132809154 16:1789455-1789477 GAGAAGGGAGCTCCAATCCCAGG + Intronic
1132940312 16:2503020-2503042 GAGCAGGGAAGTCATATCCGTGG + Exonic
1133314507 16:4874321-4874343 GAGCAGGGAGCTCCCATCCCAGG + Exonic
1133979347 16:10622063-10622085 GATCAGGGAGGACCAGGGCGAGG - Intergenic
1136247628 16:28984817-28984839 GAGCAGGGAGGCCCTGACAGTGG - Exonic
1136478219 16:30526301-30526323 GAGGAGGGAGCGCCCGTCCGAGG - Intronic
1136617082 16:31404751-31404773 CAGCAGGGAGGTCCAATCCTTGG - Intronic
1137454219 16:48605925-48605947 TAGCAGGGAGGTCCTGGCAGAGG - Intronic
1138143053 16:54585034-54585056 GAGCAGGGTGCTGCAGTCCCAGG + Intergenic
1140162995 16:72518251-72518273 GAGCATGGAGAGCCAGTCCAAGG - Intergenic
1141137285 16:81474575-81474597 GAGCAGGGAGCCCCAGCCCCTGG + Intronic
1141548457 16:84787993-84788015 GAGCAGGGAGGTGGAGGGCGTGG + Intergenic
1141715797 16:85726139-85726161 GAGCAAGGAGGTGCAGTCGAGGG - Intronic
1142113914 16:88346594-88346616 GAGCCTGGAGGTTCAGGCCGCGG - Intergenic
1144945853 17:18969170-18969192 CAGCAGGGAGGTCCACCCAGGGG + Exonic
1145217352 17:21061897-21061919 CAGCAGGGAGGTACAGGCAGTGG - Intergenic
1145997883 17:29115007-29115029 GAGCAGGGTGGGTCAGCCCGCGG - Exonic
1147338359 17:39739980-39740002 GATCAGAGAGGGCCAGTCCAAGG - Intronic
1148640110 17:49181085-49181107 GAGCAGGCTGGTCCAATCTGTGG - Intergenic
1148871908 17:50663342-50663364 GAGCAGGGAAGTCCAGTCAATGG + Intronic
1149524132 17:57340846-57340868 CAGCAGGGAAGCCCAGTCCCTGG + Intronic
1152780868 17:82226982-82227004 CAGCAGAGAGGTCAAGTCTGTGG - Intergenic
1152858458 17:82680097-82680119 GAGCAGGACGGGCCAGCCCGAGG - Intronic
1153695038 18:7631555-7631577 GAGCAAGGTTGTCCAGCCCGCGG + Intronic
1153739063 18:8103960-8103982 GAGTAGGGAGGCCCAGTGCCAGG + Intronic
1156506546 18:37599452-37599474 CAGCAGGGAGGTCTAGCACGTGG - Intergenic
1156519244 18:37707749-37707771 GAGGAGGAAGGAGCAGTCCGGGG - Intergenic
1157586364 18:48803931-48803953 GAGAAGGGAGGACCAGCCCTGGG + Intronic
1160492292 18:79348503-79348525 GAGCCGGGAGGGCCTGTCAGTGG - Intronic
1160927408 19:1553548-1553570 GAGGAGGGAGTTCCAGGCCAGGG + Intergenic
1162930062 19:13953100-13953122 GAGCTGGGAGTTCCAGTACCTGG + Intronic
1165169320 19:33880049-33880071 GAACAGGGAGGGACAGTGCGCGG - Intergenic
1165481507 19:36067218-36067240 GAGCAGGGAGTTCCAGCCTGAGG + Intronic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
1167505192 19:49867502-49867524 GACCAGGGAGGTCCTGCCCGAGG + Exonic
925609825 2:5693267-5693289 GGGCAAGGCGGCCCAGTCCGGGG + Exonic
926212767 2:10883402-10883424 GAGCAGCGGGTTCCAGTCGGCGG - Intergenic
928273066 2:29874508-29874530 GGGCCGGGAGGTCCTGTCCAAGG - Intronic
929754816 2:44755884-44755906 GAACAGGGAGGCCAAGTCAGAGG + Intronic
931212850 2:60214097-60214119 GAGCAGGCAGGTCCCGTCCTTGG + Intergenic
933349571 2:81136680-81136702 GATCAGGGAGGTCCACTCTCTGG - Intergenic
933707689 2:85304099-85304121 GGGCAGGGAGGCCTAGTCCTGGG - Intronic
933789291 2:85871113-85871135 GAGCCGGGAGGTCAAGGCTGCGG - Intronic
934735841 2:96689417-96689439 CACCTGGGAGGGCCAGTCCGCGG + Intergenic
936327982 2:111522089-111522111 GAGCAGGGAGGAGCAGGCTGGGG + Intergenic
938105403 2:128526591-128526613 GAGCAGTGAGGTCCTGCCCTTGG - Intergenic
942321675 2:174741683-174741705 GACCAGGAGGGTCCAGTCAGGGG - Intergenic
945256996 2:207811242-207811264 GGGCAGGTAGCTCCAGTCCTGGG - Intergenic
946201092 2:218071136-218071158 CAGCAGGAAGGGCCAGTCCTAGG - Intronic
946425522 2:219593530-219593552 GAACAGGGAGGTCTAGACCCAGG + Intergenic
948234909 2:236380158-236380180 GAGCAGTGAGGCCCAGTCTCAGG - Intronic
948494351 2:238337263-238337285 GAGCAGGGAGGGCCTCTCTGAGG + Intronic
948830496 2:240596245-240596267 CAGCAGGGAGGTCAAGGCCAGGG + Intronic
1169665722 20:8033441-8033463 GTGCAGGGAGGTAAAGTCCACGG - Intergenic
1171442478 20:25176459-25176481 GAGCAGGGGACTCCAGTCGGAGG + Intergenic
1171458763 20:25286779-25286801 GGGCAGAGAGCTCCAGTCCTGGG - Intronic
1171750497 20:29044361-29044383 CAGCAGGGAGATCCTGCCCGTGG + Intergenic
1172512093 20:35507884-35507906 CAGCAGGGAGCTCCTGTCCAGGG + Intronic
1172644892 20:36462828-36462850 GGGCAGGGATGCCCAGCCCGTGG - Intronic
1172648656 20:36487596-36487618 GAGCAGGGCGGGACAGTCCAAGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172900610 20:38331956-38331978 GATCAGGGAGGGCCTCTCCGAGG + Intronic
1174058888 20:47818611-47818633 GAGAAGGGAGTTCCAGGCAGCGG + Intergenic
1174064335 20:47853683-47853705 GAGTAGAGAGGACAAGTCCGGGG + Intergenic
1174558332 20:51412459-51412481 GAGCAGGGAGTTCCAGTTCCTGG + Intronic
1175872901 20:62216806-62216828 GAGCTGGGAGTACCTGTCCGGGG - Exonic
1176066521 20:63199694-63199716 CAGCAGCGAAGTCCAGTCTGGGG + Intronic
1180060792 21:45383882-45383904 GGGCAGGCAGGTCCAGACCTTGG - Intergenic
1180938532 22:19641801-19641823 GAGCAGGTACCTCCACTCCGAGG - Intergenic
1181047302 22:20221563-20221585 GAGCTGGGATGTCCACTCCCTGG + Intergenic
1181310864 22:21944018-21944040 GAGCAGGGGAGTCCAGACCAGGG - Intronic
1181328507 22:22070223-22070245 GAGCAGAGGGGTCCAGGCCATGG - Intergenic
1182765930 22:32758593-32758615 GAGCAAGGAGAGCCAGTCTGAGG - Intronic
1183437735 22:37805062-37805084 GAGCAGGAAGGCCCGGGCCGGGG + Intergenic
1184107013 22:42373631-42373653 GAGCATGGAGGTCATGACCGAGG + Intergenic
1184649371 22:45912627-45912649 CAGCAGGGAGGGGCAGTTCGGGG + Intergenic
1184682319 22:46078997-46079019 CAGCAGGGAGCTCCTGTCCACGG + Intronic
1184996170 22:48209247-48209269 AAGCCGGGAGGGCCAGGCCGGGG - Intergenic
1185344350 22:50304834-50304856 GAGAAGGGAGGTCAAGGCTGGGG + Intronic
951919889 3:27842714-27842736 GAGCAAGGTGGTCCAGTCTCAGG + Intergenic
953251269 3:41247350-41247372 GAGCAGGGAGGGTCAGTGTGTGG - Intronic
954265873 3:49470065-49470087 GAGCAGAGAGGTGCTGGCCGGGG + Intronic
954296262 3:49676029-49676051 GTGCAGGGAGGGCCAATCAGGGG - Intronic
956335854 3:68162527-68162549 GAGCAGAGTGGTCCAGACCAGGG - Intronic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
960955469 3:123027754-123027776 GAGCAGGGAGGAGGAGACCGCGG + Intronic
961530233 3:127536132-127536154 GGGCAAGGAGGCCCAGTGCGGGG - Intergenic
963764894 3:149324364-149324386 GAGCAGGAAAGTACAGTCTGAGG - Intronic
968972467 4:3803248-3803270 GACCAGGCATGTCCAGTCCCCGG - Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
972323809 4:37996158-37996180 GAGCAGGGAGGCCCACACCCAGG - Intronic
979667599 4:123329353-123329375 GAACAGGGAGGCCCAGTTAGAGG - Intergenic
985264303 4:188144005-188144027 GAGCAGAGAGGTTCACTCCTCGG - Intronic
986776434 5:11018282-11018304 GAGGAGGAAGGGCCAGTCTGTGG - Intronic
988142557 5:27262963-27262985 GAACAGTGAGGTCCAGGCTGTGG + Intergenic
989456183 5:41646971-41646993 GAGCAAGGATGTCCTGTCTGAGG - Intergenic
989802272 5:45557851-45557873 GAACGGGGAGGTCCAATCAGAGG - Intronic
992565312 5:77990298-77990320 GAGGAGGGAGATCCACTCCCTGG - Intergenic
996900459 5:128537722-128537744 GAGCAGGGAGCCCGAGCCCGAGG - Exonic
999130834 5:149282034-149282056 GAGCCGGGAGGGCCCGGCCGGGG + Intronic
999133035 5:149299244-149299266 GCCCAGGGAGGTCCAGTCCTTGG + Intronic
1001054960 5:168441777-168441799 GAGCAGGGAGCTCAAGCCAGTGG + Exonic
1002291858 5:178205408-178205430 GAGGAGGGAGGTCCGGGCCCCGG - Intronic
1002378753 5:178809186-178809208 GAGAAGAGAGTTCCAGTCTGAGG + Intergenic
1003652539 6:7974697-7974719 GAACAAGCAGGTCCAGTCCTAGG + Intronic
1005832039 6:29679169-29679191 GAGCAGGGAACTCCAGTGCTGGG - Intronic
1007464397 6:42041841-42041863 GAGGAGGGAGGACCAGCCCGGGG - Intronic
1009792288 6:68419401-68419423 GAACAGTGAGGTCCAGCCTGAGG + Intergenic
1013034031 6:106362519-106362541 GAGCAGCGAGTTCCAGGCAGGGG + Intergenic
1014288491 6:119530713-119530735 GAGCAAGGAGGTATAGTCAGAGG - Intergenic
1015715972 6:136192083-136192105 GAGCAGGGAGAGCCTGCCCGTGG - Exonic
1017064759 6:150518623-150518645 GAGCTGGCAGGTCCAATCCCAGG - Intergenic
1019476893 7:1248657-1248679 GAGCAGGGAGGTCCAGCACAAGG + Intergenic
1019558522 7:1644593-1644615 GGGAAGGGACGTCCAGTCAGAGG - Intergenic
1023529160 7:41135756-41135778 GAGCAGGCAGCTCCAGGCCCTGG + Intergenic
1025145176 7:56495654-56495676 GAAAAGGGAGGCCCAGTCCTAGG - Intergenic
1025260778 7:57416146-57416168 GGGAAGGGAGGCCCAGTCCTAGG - Intergenic
1026902956 7:74047115-74047137 GTGCAGGGAGGTGCAGTGAGTGG - Intronic
1029392980 7:100287848-100287870 GAACAGTGAGGGCCAGTCCAAGG + Intergenic
1030055597 7:105581430-105581452 CAGCAGGGAGCTCCAAGCCGCGG - Exonic
1032516298 7:132508658-132508680 GAGAAGGCAGGTCCAGTTCCAGG + Exonic
1033264986 7:139877169-139877191 GAGCAGGGAGGTGTACTCCTCGG + Intronic
1034091233 7:148365147-148365169 GAGCAGGGAAGGCCACTCTGAGG - Intronic
1034467647 7:151239255-151239277 GAGCAGGGAGGGCCATTGCATGG + Intronic
1035931571 8:3785780-3785802 GAGTAGGTAGGTCCAGGCTGCGG + Intronic
1038612009 8:29066828-29066850 GAGAGGGGAGGTCCAGTGTGGGG + Intergenic
1040070290 8:43181679-43181701 GGGCAGGGAGGGTCAGTCAGTGG + Intronic
1042367433 8:67952787-67952809 GAGAAGAGAGCTCCAGTCCAGGG + Intronic
1044326823 8:90868457-90868479 GGGCAGTGAAGTCCAGTCTGAGG + Intronic
1045009362 8:97944105-97944127 GGGCAGGGAGGTCCAGGCGGAGG + Intronic
1047381825 8:124371894-124371916 GAGCAGGCAGCTCCTCTCCGTGG + Exonic
1048203988 8:132401043-132401065 GAGCAGGAAGGTCCAGGCTAGGG + Intronic
1049223041 8:141436561-141436583 AAGCAGGGAGGCCCAGGCCCTGG - Intergenic
1049475535 8:142795452-142795474 GAGCAGGGAGCTCGGGTCAGCGG - Intergenic
1052865468 9:33462348-33462370 TCGCAGGGAGGTCCAGGCCCAGG + Exonic
1055985873 9:82056287-82056309 TAGCAGGGAGGCCCTGTCCTGGG + Intergenic
1057698910 9:97348900-97348922 GAGCAGGGAGCTCCTGTTTGTGG - Intronic
1061064602 9:128269548-128269570 AAGCAGGTAGGTCCAGTTGGGGG - Intronic
1061191430 9:129084927-129084949 GGGCTGGGAGGTTCAGTCAGAGG + Intronic
1061725948 9:132582166-132582188 GAGCAGGGAGGCGCTGTCCACGG + Exonic
1186851486 X:13584347-13584369 GAGCAGGAAGGTCCAGAAAGAGG - Intronic
1188757083 X:33975294-33975316 GAGCAGGGTGGTCATGTCCATGG - Intergenic
1189002918 X:36964069-36964091 GGGCCGGGCGGTCCAGGCCGCGG + Intergenic
1189375783 X:40465404-40465426 GACCTGGGAGGTCCAAACCGAGG + Intergenic
1189447613 X:41095321-41095343 GAGCAGGGACTTCCGGTCAGAGG + Intronic
1190776001 X:53552715-53552737 GAGCAGGCAGCTCCACTCCTGGG - Exonic
1192546558 X:72019021-72019043 GAGCAGGGATGTCCTGTCCGAGG + Intergenic
1192809555 X:74536662-74536684 GAGCAGGGAGGTAGAGGGCGGGG - Intergenic
1195390740 X:104359487-104359509 GAGCAGGGAGGTGCTGTGCCTGG + Intergenic
1197778121 X:130133704-130133726 GAGCCTGGAGGTCCAGGCTGTGG - Intronic
1200374944 X:155769833-155769855 TAGGAGGGAGGCCCAGTCAGTGG + Intronic