ID: 902334543

View in Genome Browser
Species Human (GRCh38)
Location 1:15747471-15747493
Sequence CCTTGGGCCTCCAGTGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902334543_902334555 0 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334555 1:15747494-15747516 CCCGCAGGGGGATGGGTGAATGG 0: 1
1: 0
2: 5
3: 35
4: 211
902334543_902334559 30 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334559 1:15747524-15747546 CATTCTCAACGCTTTTCCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 108
902334543_902334552 -7 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334552 1:15747487-15747509 CCCAAGGCCCGCAGGGGGATGGG 0: 1
1: 0
2: 0
3: 22
4: 181
902334543_902334558 4 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334558 1:15747498-15747520 CAGGGGGATGGGTGAATGGGTGG 0: 1
1: 1
2: 10
3: 169
4: 1475
902334543_902334550 -8 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334550 1:15747486-15747508 GCCCAAGGCCCGCAGGGGGATGG 0: 1
1: 0
2: 1
3: 36
4: 290
902334543_902334557 1 Left 902334543 1:15747471-15747493 CCCGGGTCACTGGAGGCCCAAGG 0: 1
1: 0
2: 5
3: 24
4: 274
Right 902334557 1:15747495-15747517 CCGCAGGGGGATGGGTGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902334543 Original CRISPR CCTTGGGCCTCCAGTGACCC GGG (reversed) Intronic
900367936 1:2318880-2318902 TCTTGGGCCCTCAGTGGCCCTGG + Intergenic
900558273 1:3290853-3290875 CCTCGGGCCCCCAGTGCTCCGGG - Intronic
900566697 1:3335828-3335850 CCCCGGGCCTCCTGTGAACCTGG - Intronic
900626507 1:3611070-3611092 CCACGGGCCTCCAGAGGCCCCGG + Intronic
900992051 1:6102588-6102610 CCTTGGGCCTCAAGTGTCCTGGG + Exonic
901220000 1:7578337-7578359 CCTGGGTCCTCCAGGGAGCCGGG + Intronic
901329380 1:8393345-8393367 CTTTGGGCCCCCAGTCACACAGG - Intronic
902334543 1:15747471-15747493 CCTTGGGCCTCCAGTGACCCGGG - Intronic
902336487 1:15757795-15757817 CCTGAGGCCTCCAGGGACCCAGG + Intronic
902368827 1:15993203-15993225 CCTGAGGACTCCAGAGACCCAGG + Intergenic
902557713 1:17256686-17256708 CCTTGGGCCTCCAGTGTCCATGG - Intronic
903293453 1:22329108-22329130 CCTGGGGCTTCCAGGGGCCCTGG + Intergenic
903542017 1:24101892-24101914 CCTTAGGCCTCCAGGACCCCAGG - Intronic
903739780 1:25552111-25552133 CCCTGGGCCTCCAGGGGCTCTGG - Intronic
904289072 1:29471948-29471970 ACCTGGGCCCCCAGGGACCCTGG - Intergenic
904670224 1:32159136-32159158 CATTGGGCTTCCAGGGTCCCAGG - Intronic
904684229 1:32248927-32248949 CCATGGGCCTGCAGTGAACTAGG - Intergenic
904788351 1:32999104-32999126 CCTGGGGTCTCCAGACACCCTGG - Intergenic
905739992 1:40361707-40361729 CCTGTGGCCACCAGTGCCCCAGG - Intronic
907593734 1:55700654-55700676 CCTTAGGCATCCAGTGCCCAGGG + Intergenic
908824196 1:68117566-68117588 CCTGGGAGCTCCAGGGACCCTGG + Intronic
909612981 1:77572703-77572725 AATTGGGCCTGCAGTGAACCTGG - Intronic
912454863 1:109790672-109790694 CCTTGGGCCTCCAGATCCCATGG - Intergenic
915279091 1:154810222-154810244 CCTTGGGCTGCCAGTGGCCTGGG - Intronic
917300538 1:173569982-173570004 CCTTGGGCCTTAAGTGAACATGG - Intronic
918038578 1:180898315-180898337 CATTAGGCATCCAGGGACCCTGG + Intergenic
918203893 1:182292025-182292047 CCTTGGGAATCAAGTGACCAAGG - Intergenic
920166895 1:204042389-204042411 ACTTGGTCCTCCAGGAACCCTGG + Intergenic
920607949 1:207408557-207408579 ACTTGTCCCTCCAGTGATCCTGG + Intergenic
1062902378 10:1156147-1156169 GCTTGGGTCTCCAGCTACCCTGG + Intergenic
1064959514 10:20948056-20948078 CCTTGGGCCACATGCGACCCAGG - Intronic
1069572849 10:69504813-69504835 CCTGGGGCCACCTGGGACCCAGG + Intronic
1069712934 10:70501312-70501334 CCCTGGGCCTCCATGGAACCTGG + Intronic
1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG + Intergenic
1070604677 10:77890409-77890431 CCTTGGGTCTCTAGGGTCCCAGG + Intronic
1070831298 10:79419589-79419611 CCAAGGGCCTCCAGTGTGCCAGG - Intronic
1071502173 10:86211911-86211933 CCTGGGGCCTGCACTGAGCCGGG - Intronic
1071546980 10:86536562-86536584 GCTGGGGCCTCCCGGGACCCGGG + Intergenic
1072151674 10:92689678-92689700 CCTGGGGACTCCAGGCACCCCGG - Intergenic
1072262917 10:93698830-93698852 CCATGGGCCTCATGTGGCCCAGG + Intronic
1072624983 10:97105492-97105514 GCAGGGGCCTCCAGTGACCGTGG + Intronic
1075639540 10:124055021-124055043 ACTTGGGGCTGCAATGACCCAGG + Intronic
1077140248 11:1021045-1021067 CCTTGGGTCTCCAGAGACTCAGG - Intronic
1077295195 11:1823295-1823317 CAGTGGGCCTTCAGTGACCTGGG - Intergenic
1080838082 11:35958987-35959009 CATTGGGCCTCCAGGCTCCCAGG + Intronic
1081632482 11:44699350-44699372 CATTGGGCCTGCAGTGGCACTGG + Intergenic
1083615473 11:64023963-64023985 GCTTGGGTCTCCAGGGGCCCAGG - Intronic
1084154625 11:67306796-67306818 CCTTGGGGCCACTGTGACCCTGG + Intronic
1084394241 11:68898406-68898428 CCCTTGGCATCCAGTGGCCCTGG + Intronic
1084458877 11:69285278-69285300 CCTAGTGCCTCCAATGACTCAGG + Intergenic
1084791566 11:71478260-71478282 CCCTGGGCCTCCAGGAATCCAGG + Intronic
1084967429 11:72751932-72751954 GCCTGGGGCTCCAGTGACCTTGG - Intronic
1085460461 11:76690114-76690136 CCTTGGGACCCCAGGGAGCCTGG - Intergenic
1085519839 11:77131329-77131351 CCATTGGCCTCTGGTGACCCTGG - Intronic
1085534320 11:77208933-77208955 CCTTGGGGCTCCAGTGGTCTTGG - Intronic
1087873560 11:103327886-103327908 CCTTGGGACTCCACTTAGCCTGG - Intronic
1088753861 11:112868865-112868887 ACTTGGGGTTCCAGTGACCGTGG - Intergenic
1088942345 11:114472468-114472490 CCGTGGGCCACATGTGACCCAGG - Intergenic
1089041988 11:115460729-115460751 ACTTTTACCTCCAGTGACCCAGG - Intronic
1089541712 11:119193256-119193278 CAGTGGGCCACCAGGGACCCAGG + Intronic
1091283359 11:134394672-134394694 GCGTGAGCCTGCAGTGACCCAGG - Intronic
1092172860 12:6384368-6384390 CCTTGGGCCACCTCTGCCCCCGG + Exonic
1092634759 12:10431699-10431721 CCATGGGCCGCACGTGACCCAGG + Intronic
1095293778 12:40505830-40505852 ACTTGGGTCTCTAGTGATCCAGG - Intronic
1096186819 12:49586987-49587009 CCATCTGCCTCCTGTGACCCTGG - Intronic
1096812889 12:54182964-54182986 CCTTGTGCCTCCTTTAACCCTGG - Intronic
1097798826 12:63890736-63890758 CCTGGGGCCTGCAGAAACCCAGG - Intronic
1098308367 12:69123690-69123712 ACTTGGGACTCCAGTTCCCCTGG - Intergenic
1104000460 12:124856816-124856838 CCCAGGGCTCCCAGTGACCCCGG - Intronic
1105979237 13:25501584-25501606 CCCTGGGGCTTCACTGACCCTGG - Intronic
1110540350 13:76700557-76700579 GCTTGTGTCGCCAGTGACCCGGG - Intergenic
1112499966 13:99935205-99935227 CCCAGGGACTCCAGTGTCCCAGG - Intergenic
1113643312 13:111973730-111973752 CCTGGGTTCTCCAGGGACCCCGG - Intergenic
1118441546 14:65816482-65816504 CATTTGGCCCCCAGAGACCCTGG - Intergenic
1118762796 14:68890761-68890783 CCTGGAGCCTACAGAGACCCCGG + Intronic
1119195478 14:72714232-72714254 CCTTGGGCCTCTGCTGCCCCAGG - Intronic
1120699234 14:87680046-87680068 CCTTGTGCCAGCAGTCACCCTGG + Intergenic
1121718106 14:96090518-96090540 ACTTGTGCTTCCAGGGACCCAGG + Exonic
1122143878 14:99677441-99677463 TCTCGGGCCTCCAGTGGCCCAGG + Exonic
1122285329 14:100648493-100648515 CCATGGGCCTCATGTGGCCCAGG - Intergenic
1122693180 14:103541109-103541131 CCCTGGGCCTGCAGAGACACGGG + Intergenic
1122786027 14:104163666-104163688 ACCTGGGACCCCAGTGACCCCGG + Intronic
1123107025 14:105846429-105846451 CCTGGGGCCTCCAGGGACCCAGG - Intergenic
1124460237 15:29883244-29883266 CCTTGGGACTTAAGTGACGCTGG + Intronic
1125276960 15:38003715-38003737 CCTTGGGCCTTGAGTGAACATGG - Intergenic
1125506434 15:40270349-40270371 CCATGGGCCTCCTAGGACCCAGG + Intronic
1127561945 15:60147451-60147473 CCTTGACCTTCCAGTGACCATGG + Intergenic
1128664276 15:69526898-69526920 CCTGGGGGCTCTTGTGACCCTGG + Intergenic
1129605954 15:77025147-77025169 CCTTGGTTCTAGAGTGACCCAGG + Intronic
1129607795 15:77033234-77033256 CCTGGGGCCTCATGTGAGCCTGG + Intronic
1130150253 15:81306341-81306363 CCCTGGGCTTCAAGTGAGCCCGG - Intronic
1130316759 15:82802875-82802897 CCTAGGTCCTTCTGTGACCCTGG + Intronic
1130330584 15:82919061-82919083 CCCTGGGACTCCTGTGGCCCAGG - Intronic
1130690705 15:86079514-86079536 TCTTGGGTCTCCTGTTACCCGGG + Intergenic
1131256944 15:90869276-90869298 CCTTGGGCCCCTAGGGCCCCAGG + Intronic
1131829438 15:96344771-96344793 CCTCTGGCCCCCAGCGACCCTGG - Intergenic
1132513528 16:355175-355197 CCTTGGGCCTCCAGCTCCTCGGG + Intergenic
1132690606 16:1180406-1180428 CCTCGGGCCTCCACAGACCTGGG - Intronic
1132705700 16:1242260-1242282 GGTTGGTCCTCCAGTGACCCAGG - Exonic
1132709046 16:1258516-1258538 GGCTGGCCCTCCAGTGACCCGGG - Exonic
1132761289 16:1509690-1509712 GCTCGGGTCTGCAGTGACCCCGG - Intronic
1133042371 16:3067493-3067515 CCTTGTCCCTCCAGGGTCCCAGG - Intronic
1133333633 16:4991961-4991983 CCGTGGGCCTCCAGGGAGCTGGG - Exonic
1134588876 16:15435528-15435550 GCAGGGACCTCCAGTGACCCTGG - Intronic
1137599002 16:49743638-49743660 CCTTGAGCCCCCTGTGTCCCGGG - Intronic
1139243581 16:65419246-65419268 CCTTGGGTCTACAGAGACCCAGG - Intergenic
1139504611 16:67392727-67392749 ACTAGGGCTTCCAGTGACCACGG + Intronic
1141665562 16:85463520-85463542 CCTCGTGCCTGCAGTGACCCGGG + Intergenic
1141695346 16:85616449-85616471 CCTTGGACTTCGAGTAACCCAGG - Intronic
1141838663 16:86559968-86559990 CTTTGGGCCTGCTGTGCCCCGGG - Intergenic
1145761784 17:27429641-27429663 CCTGAGGACTCCAGAGACCCAGG + Intergenic
1145792819 17:27638462-27638484 CATTGGGCCTCCCCTGAGCCAGG - Intronic
1145807685 17:27746331-27746353 CATTGGGCCTCCCCTGAGCCAGG - Intergenic
1147186815 17:38717517-38717539 CCTGGGGCCCCCAGGGACCTCGG + Exonic
1148770414 17:50063047-50063069 CCTTGGGCCATCAGAAACCCCGG - Intronic
1148871699 17:50662255-50662277 CCATCGTCCTCCAGTTACCCAGG - Intronic
1149833662 17:59893333-59893355 CCTCGGGCCCCCGGGGACCCCGG - Intronic
1150132597 17:62677375-62677397 CCTGGGCACTCCAGTGACGCCGG + Exonic
1152429696 17:80241855-80241877 CTGTGGGCCTCCAGGGTCCCAGG + Intronic
1152553496 17:81041281-81041303 CCCAGAGCCTCCAGGGACCCTGG - Intronic
1152583376 17:81178754-81178776 CCTCGGGCCTCCAGTGCAGCGGG - Intergenic
1152590752 17:81210727-81210749 CCTCGGGTCTCCAGTTTCCCAGG + Intronic
1152692682 17:81727281-81727303 CCTTGGGCCTCAAGGGCACCAGG + Intergenic
1152798014 17:82317413-82317435 CCTTGGGCAGCCAGGGCCCCAGG + Exonic
1153658746 18:7307873-7307895 CATGCGGCCTCCAGTGTCCCTGG - Intergenic
1154414806 18:14171108-14171130 CCCTGGCCCTCCACTGGCCCTGG - Intergenic
1158514717 18:58121485-58121507 GCTTGAGCCTGCAGTGAGCCAGG - Intronic
1160217343 18:76944093-76944115 ACTTGGGCCTGCTGAGACCCAGG - Intronic
1160351456 18:78184499-78184521 CCTTGGGTCTGCAGTGAGTCTGG + Intergenic
1160541827 18:79628122-79628144 CCCTGGGCCTGAAGTGTCCCCGG - Intergenic
1160897894 19:1411307-1411329 CCTTTGGCCTCCATTCACTCCGG + Intronic
1161058079 19:2200555-2200577 CCTTGGGCCTCCAGGGTCCCTGG - Intronic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1161389866 19:4015358-4015380 CCCTGAGCCACCAGGGACCCCGG + Intronic
1161727768 19:5940117-5940139 CCTCACGCCTCCAGTTACCCTGG + Intronic
1161998748 19:7730432-7730454 CCTTGACCCCGCAGTGACCCAGG - Exonic
1162042732 19:7980259-7980281 CCCTGAGCCTCCCGTGCCCCAGG - Intronic
1162069973 19:8147600-8147622 CCTTGGGCTCCCAGAGGCCCCGG - Intronic
1162094583 19:8302867-8302889 CATGGGGCCCCCTGTGACCCTGG - Exonic
1162094597 19:8302921-8302943 CATGGGGCCCCCTGTGACCCTGG - Exonic
1163129556 19:15264117-15264139 CCTTGGGGGCCCAGTGCCCCAGG - Intronic
1163710935 19:18846364-18846386 CCTTTGGCCTCCTCAGACCCTGG + Intronic
1164462815 19:28463481-28463503 CCTTGGTCTTCCAGAGCCCCTGG - Intergenic
1164711471 19:30359874-30359896 CCCAGGGCCTACACTGACCCTGG + Intronic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1164925159 19:32124571-32124593 CCTGTGGCCTCCCCTGACCCTGG - Intergenic
1165161697 19:33820420-33820442 CCTTGGCCCTGCGGGGACCCGGG - Intergenic
1165231670 19:34391118-34391140 CCTTGGGCTTCCAGTGCCTGAGG + Intronic
1165464584 19:35966072-35966094 CCCCGGGCCTCCAGGGTCCCTGG - Intergenic
1166258942 19:41624959-41624981 CCTTGGGCAGTCAGTGGCCCAGG - Intronic
1166266664 19:41688667-41688689 CCCTCTGTCTCCAGTGACCCAGG + Intronic
1166706905 19:44913099-44913121 CCTTTGACCGCCAGTGACCCTGG - Intergenic
1166709077 19:44925654-44925676 CCTTTGACCGCCAGTGACCCTGG - Intergenic
1167238711 19:48330574-48330596 CCTTCCGCCTCCAGGGACCCAGG + Intergenic
1167791364 19:51684792-51684814 CCATGGGCCTCATGTGGCCCAGG - Intergenic
1168259675 19:55186341-55186363 CCTGGGGGCTCCAGAGACCCTGG + Exonic
925406231 2:3606847-3606869 TCTTTGACCTCCAGCGACCCTGG - Intronic
926906210 2:17807984-17808006 ACTTGGGCATCCTGTGGCCCAGG - Intergenic
927555411 2:24027690-24027712 CCTTGGCCTCCCAGTGTCCCAGG - Intronic
927948324 2:27150533-27150555 CCTTGGGGCTGCGCTGACCCTGG + Intronic
928749633 2:34457078-34457100 CCCATGGCCACCAGTGACCCAGG + Intergenic
932285778 2:70530570-70530592 CCATGGGCCGCCTGTGGCCCAGG - Intronic
933170834 2:79122887-79122909 GCTTGGGGCTCCAATGCCCCAGG - Exonic
936055731 2:109260651-109260673 CCATGGGCCTCCATTGGCCCTGG - Intronic
936519812 2:113204627-113204649 TCCTGGGCCTGCTGTGACCCAGG + Intronic
938620181 2:133043597-133043619 CCTTGGGCTGCATGTGACCCAGG - Intronic
942290749 2:174467842-174467864 TCTTGTGCCTCCAGCCACCCAGG + Intronic
942294956 2:174508136-174508158 CCTTGGGCCTTGAGTGAACATGG + Intergenic
942446069 2:176079967-176079989 CCTTCGGCCTCCCGCGCCCCGGG + Exonic
943092466 2:183390736-183390758 TTTTGGGCCCCCAGTGACTCTGG - Intergenic
948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG + Intergenic
1169257388 20:4109772-4109794 CCTGGGGCTGCCAGTAACCCTGG + Intergenic
1169268327 20:4181173-4181195 ACTGGGGCCTCCTGAGACCCTGG + Intronic
1172527045 20:35606205-35606227 CCCTAGGCCTCTAGGGACCCTGG - Intergenic
1173554387 20:43955295-43955317 CATGGGCCCTCCTGTGACCCAGG - Intronic
1173785834 20:45792153-45792175 CCTCGGGGCTCCTGGGACCCTGG + Intronic
1174912862 20:54625299-54625321 CCTTGGACCCCCACTGTCCCAGG - Intronic
1175516020 20:59570614-59570636 CCGTGGGCCACATGTGACCCAGG + Intergenic
1175549620 20:59808666-59808688 CCCAGGGTCTCCAGTGACTCAGG - Intronic
1176858218 21:13987163-13987185 CCCTGGCCCTCCACTGGCCCTGG + Intergenic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1179888095 21:44323077-44323099 CCTTGGGTCTCCTGTGCCCTGGG - Intronic
1180657063 22:17430787-17430809 CCTTGGCTCTCAAATGACCCTGG + Intronic
1180921870 22:19525279-19525301 CCTGGGGCCACCACTGCCCCTGG - Intronic
1181469759 22:23130871-23130893 CCTCTGGCCTCCAGAGAGCCCGG - Intronic
1181888556 22:26041062-26041084 CCGTGGGACTCCTGTGACCCAGG + Intergenic
1181921183 22:26321609-26321631 TCTTGGGCCTCACGTAACCCTGG - Intronic
1183480309 22:38060597-38060619 CATTCGGCCTCCTGTGACCCAGG + Intronic
1183489147 22:38107572-38107594 CCTTGGGCCTCCATTCACTCTGG + Intronic
1183553245 22:38505768-38505790 CCTCGGGTCCCGAGTGACCCCGG + Intronic
1184057596 22:42062836-42062858 CCTTAGGCATCCAGGGACGCAGG - Exonic
1184057980 22:42065450-42065472 ACTTGGGTCTGTAGTGACCCTGG - Intronic
1184158529 22:42684610-42684632 ACATGGGCCTCCACTGCCCCTGG + Intergenic
952164410 3:30731227-30731249 CCTTCGTCCTCCAGGTACCCAGG + Intronic
953420994 3:42753080-42753102 CCTTGGGCCTTCTATGACTCTGG + Intronic
953979822 3:47408000-47408022 CCTGGGGCCCCCAGAGGCCCGGG - Intronic
954213065 3:49109101-49109123 CTTGGGGCCCCCAGGGACCCAGG + Exonic
954796137 3:53162013-53162035 GGTCGGGCCTCCAGGGACCCAGG - Intronic
955361044 3:58275212-58275234 TCTTGGGGCTCCAGCTACCCTGG - Intronic
955982382 3:64539990-64540012 CCTCTGGCCTCCAGTCTCCCTGG - Intronic
956364362 3:68483819-68483841 ACTTCGGGCTCCAGTGACACTGG - Intronic
959087481 3:101866872-101866894 GTTTGGGCCTCCAGTGTTCCGGG + Intergenic
961057469 3:123801235-123801257 ACTTGGACCTCAAGGGACCCTGG + Intronic
961636250 3:128334932-128334954 CCAGGGGCCCCCAGTGTCCCAGG - Intronic
961676465 3:128570096-128570118 CCTGTGGCCTCCAGCGACTCGGG + Intergenic
962211232 3:133480327-133480349 CCTTGAGCCTCCCCTGACACAGG + Intergenic
963801906 3:149684630-149684652 GGTTGGGCCTGCAGTGAGCCAGG - Intronic
967428588 3:189355591-189355613 CCCTGGCCCTACAGTGATCCAGG + Intergenic
968619153 4:1595940-1595962 CCTTGGGCAGACAGTGACCAGGG - Intergenic
969173261 4:5380622-5380644 CCTTGTGCCACCAGCCACCCTGG - Intronic
969692269 4:8710238-8710260 ACTTGGCCCTCCAGTGGGCCGGG + Intergenic
973980937 4:56307749-56307771 CATTGGGCCTCCAGTAACCCTGG + Intronic
975353630 4:73373449-73373471 CCTTTGGCTTCAAGTGGCCCAGG + Intergenic
976388073 4:84482863-84482885 CCCTGCGCCTCCGCTGACCCCGG - Intergenic
981828565 4:148973643-148973665 CCATGGGCCGCCTGTGACCCAGG + Intergenic
985492017 5:185794-185816 CCTTGGGCCTCCCAGGACCTTGG + Exonic
987631501 5:20478430-20478452 CCTTGGGCCTTGAGTGAACATGG + Intronic
992491711 5:77250737-77250759 CCTGAGGCCACCAATGACCCAGG - Intronic
994590274 5:101762307-101762329 CCCTTGGCCCCCAGTGATCCTGG - Intergenic
998018060 5:138748597-138748619 CATTGGGCCTCCAGGGCACCAGG - Intronic
999692198 5:154157807-154157829 CCTTGGCCCTCCAGTGGCTAAGG - Intronic
1000062729 5:157671278-157671300 CGTGGGGACTGCAGTGACCCCGG - Intronic
1001695484 5:173666989-173667011 CCTGGGCCTTCCAGAGACCCAGG + Intergenic
1002430805 5:179202860-179202882 CCTTGGTCCACAGGTGACCCAGG + Intronic
1002994792 6:2272629-2272651 CCTTCGGTCTCCACTGACACAGG - Intergenic
1003122524 6:3329807-3329829 CCTTGGGCCTGCAGAGTGCCCGG - Intronic
1004740656 6:18457214-18457236 CCTGTTGCCTCGAGTGACCCAGG + Exonic
1007176203 6:39899332-39899354 CCTGGGTCCTCCACTGGCCCAGG - Intronic
1007421784 6:41724022-41724044 CCCAGGGCCTCCAGACACCCAGG + Intronic
1014986283 6:128014329-128014351 CCTTGTGCTTTCAGTGACACTGG - Intronic
1017614283 6:156228232-156228254 CCTTGGTCCTGCAGTGTCCTAGG - Intergenic
1017725651 6:157274644-157274666 CCGGGAGCCTCCAGTGGCCCCGG + Intergenic
1018544051 6:164916076-164916098 CCCTGGGCCTCATGTGTCCCTGG + Intergenic
1019497359 7:1346703-1346725 CCTTGGGTCTCCAAAGACCCAGG + Intergenic
1019672332 7:2287839-2287861 CTTTGGGACTGCAGTGAGCCAGG + Intronic
1019735401 7:2647750-2647772 CCTGTGACCTCCAGTGGCCCTGG - Intronic
1022506370 7:30910622-30910644 CCGTGGGCCGCCTGTGCCCCGGG - Intergenic
1022624339 7:32019188-32019210 CCTTGTGCTTCCAGGGACCTTGG - Intronic
1023186817 7:37541233-37541255 CCTTGGGCCTACCTTGACCTCGG - Intergenic
1024440837 7:49415868-49415890 CCCTGCGCCTCCAAGGACCCAGG + Intergenic
1026343232 7:69452120-69452142 GCTTGGGCTTCAAGTGACCTTGG + Intergenic
1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG + Intronic
1028387058 7:90267421-90267443 CCTTGGGCATTCAGAGAACCTGG + Intronic
1029279113 7:99425325-99425347 ACTTGGGCCTCCAGAGCCTCCGG - Exonic
1031857274 7:126937778-126937800 GGATGTGCCTCCAGTGACCCCGG - Intronic
1034416095 7:150964956-150964978 CCCTGGGCCTGCAATGTCCCTGG - Intronic
1034530468 7:151693262-151693284 CCTTGGGCCTCCTGTGCTGCGGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1037594902 8:20346870-20346892 CCTTGGGGCTCAACTGACACAGG - Intergenic
1037900273 8:22684093-22684115 CCTTCGTCATCCAGGGACCCTGG + Intergenic
1038338104 8:26661702-26661724 TCTTGGGACCCCAGGGACCCTGG + Intergenic
1038424604 8:27456522-27456544 CCTTGGGCCTCCCTTTTCCCTGG + Intronic
1039479148 8:37858783-37858805 CCTTGGGACTCCTGGGAACCAGG + Intronic
1039507128 8:38060123-38060145 CCTTGTGCCTCCACTGATGCAGG + Exonic
1042906514 8:73777541-73777563 CCTGAGGACTCCAGTCACCCTGG + Intronic
1047400169 8:124539352-124539374 CCTTGAACCTCCAGGTACCCAGG - Intronic
1047726952 8:127692399-127692421 CCTTGAGCCCCCAGTGCTCCCGG + Intergenic
1048985619 8:139733269-139733291 CCTAGGGGCTCCAGCCACCCAGG - Intronic
1049210843 8:141385819-141385841 CCCTGGCCCACCAGGGACCCAGG - Intergenic
1049342735 8:142121922-142121944 CCACGGGCCTCCACTGACCTGGG + Intergenic
1049354291 8:142179972-142179994 CCTGGGGCCACCTGTGGCCCAGG - Intergenic
1050992301 9:12169869-12169891 CTTTGTGCCTCTAATGACCCAGG - Intergenic
1051837023 9:21350773-21350795 TCATGGTCCTCCTGTGACCCAGG + Exonic
1053268002 9:36729872-36729894 CTTTGGGCCTCCAGAGATACGGG + Intergenic
1054792356 9:69268006-69268028 CTGTGGGGCTTCAGTGACCCAGG - Intergenic
1055115729 9:72603226-72603248 GTTTGGGCCTTCAGTGACTCCGG - Intronic
1055664138 9:78536305-78536327 CCATGGGCCTCATGTGGCCCAGG - Intergenic
1056826722 9:89880992-89881014 CCTAGGTCACCCAGTGACCCTGG + Intergenic
1059977351 9:119731619-119731641 CCTTGGGCAGCCAGTTCCCCAGG - Intergenic
1060723874 9:125995032-125995054 CCTGGGGGATCCAGTCACCCAGG + Intergenic
1060990650 9:127846820-127846842 ACTTGGGGTTCCAGTCACCCAGG - Intronic
1061041581 9:128144021-128144043 GCTTGGGACTGCAGTGACCTGGG + Intergenic
1061089887 9:128420676-128420698 CCCTGGCCCTCCGGTGCCCCGGG + Exonic
1061432004 9:130537023-130537045 CCTTGGGACTCCACTCACGCTGG - Intergenic
1061518842 9:131105329-131105351 GCTTGGGCCACAAGTGACCAGGG - Intronic
1061537559 9:131259301-131259323 CCCTGGAGCTCCAGTGACCTGGG + Exonic
1061864603 9:133485795-133485817 CCTGGTGCCTTCCGTGACCCTGG + Intergenic
1061864608 9:133485813-133485835 CCTGGCGCCTTCCGTGACCCTGG + Intergenic
1062032141 9:134366530-134366552 CCATGGGCCTCCAGGTCCCCCGG + Intronic
1062078201 9:134603657-134603679 CCTCGGGCCTCCAGCGCCCAGGG + Intergenic
1062228787 9:135469432-135469454 CCCTGGGAGTCCAGAGACCCTGG - Intergenic
1062267453 9:135693796-135693818 CCTCGACCCTCCAGAGACCCTGG + Exonic
1062394836 9:136348611-136348633 CCTTGGCCCCCCAGAGACTCTGG + Intronic
1062539768 9:137036366-137036388 CCTGGGGCCCCCAGGGACTCTGG - Exonic
1203775959 EBV:73375-73397 CCTTGGGATTCCACTGGCCCCGG + Intergenic
1185507982 X:643540-643562 CCTTGGGGACCTAGTGACCCGGG + Intronic
1189272056 X:39758880-39758902 CCTTGGGCCTGGGCTGACCCTGG - Intergenic
1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG + Intronic
1191841135 X:65514232-65514254 CCTTGGGTCACCAGGGAGCCAGG - Intronic
1192184127 X:68935036-68935058 TCTTTGGGCTCCAGGGACCCAGG - Intergenic
1193198188 X:78658057-78658079 CCTGGCGCCTCCAGCAACCCGGG - Exonic
1194421644 X:93682119-93682141 CCTTTACCCTCCAGTGACCTTGG + Intronic
1196464404 X:115958178-115958200 CCTTGGGCCTCCAGAGAGCCTGG + Intergenic
1196647053 X:118129014-118129036 CCTAGAGCCTCCAGTCACCCGGG + Intergenic
1198070508 X:133143710-133143732 CCATGGGCCTCATGCGACCCAGG - Intergenic
1199785629 X:151102489-151102511 CCTGGTCCCTTCAGTGACCCAGG - Intergenic
1200057913 X:153471040-153471062 CCTTGGTCCTCCTGGGAACCAGG - Intronic
1200285612 X:154819564-154819586 CACTTGGCCTCCAGTCACCCAGG + Intronic
1201538806 Y:15083989-15084011 GTTTGAGCCTCCTGTGACCCGGG - Intergenic
1201915003 Y:19172337-19172359 CCTTTTTCCTTCAGTGACCCAGG - Intergenic
1202168570 Y:22017517-22017539 CTTTTGGCCTCCAGTGATCCTGG - Intergenic
1202222791 Y:22568851-22568873 CTTTTGGCCTCCAGTGATCCTGG + Intergenic
1202320324 Y:23626809-23626831 CTTTTGGCCTCCAGTGATCCTGG - Intergenic
1202550443 Y:26043247-26043269 CTTTTGGCCTCCAGTGATCCTGG + Intergenic