ID: 902335065

View in Genome Browser
Species Human (GRCh38)
Location 1:15749815-15749837
Sequence ACTGGGCTCTGGGTTCCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902335059_902335065 -8 Left 902335059 1:15749800-15749822 CCTTGCCGGACCCAGACTGGGCT No data
Right 902335065 1:15749815-15749837 ACTGGGCTCTGGGTTCCAAGCGG No data
902335058_902335065 -7 Left 902335058 1:15749799-15749821 CCCTTGCCGGACCCAGACTGGGC No data
Right 902335065 1:15749815-15749837 ACTGGGCTCTGGGTTCCAAGCGG No data
902335054_902335065 -2 Left 902335054 1:15749794-15749816 CCAGCCCCTTGCCGGACCCAGAC No data
Right 902335065 1:15749815-15749837 ACTGGGCTCTGGGTTCCAAGCGG No data
902335056_902335065 -6 Left 902335056 1:15749798-15749820 CCCCTTGCCGGACCCAGACTGGG No data
Right 902335065 1:15749815-15749837 ACTGGGCTCTGGGTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902335065 Original CRISPR ACTGGGCTCTGGGTTCCAAG CGG Intergenic