ID: 902337307

View in Genome Browser
Species Human (GRCh38)
Location 1:15760907-15760929
Sequence CAGTGGGACGGGAGGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 588}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902337299_902337307 -6 Left 902337299 1:15760890-15760912 CCCAGCTGAATCGGTGGCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588
902337293_902337307 21 Left 902337293 1:15760863-15760885 CCCCAGGGAACTTACACACAGCC 0: 1
1: 0
2: 2
3: 27
4: 247
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588
902337295_902337307 19 Left 902337295 1:15760865-15760887 CCAGGGAACTTACACACAGCCTG 0: 1
1: 0
2: 1
3: 13
4: 175
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588
902337294_902337307 20 Left 902337294 1:15760864-15760886 CCCAGGGAACTTACACACAGCCT 0: 1
1: 0
2: 2
3: 19
4: 158
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588
902337301_902337307 -7 Left 902337301 1:15760891-15760913 CCAGCTGAATCGGTGGCAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588
902337297_902337307 0 Left 902337297 1:15760884-15760906 CCTGCTCCCAGCTGAATCGGTGG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG 0: 1
1: 0
2: 9
3: 63
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902337307 Original CRISPR CAGTGGGACGGGAGGGAAGC CGG Intronic
900109547 1:999812-999834 CCGGGGGGCGGGAGGGACGCGGG - Exonic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901469045 1:9442986-9443008 CAGGGAGACAGGAGGAAAGCAGG + Intergenic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901799168 1:11697554-11697576 CATTGGGATAGGAGGGAACCAGG - Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902230675 1:15025500-15025522 CCATGGCACGGGAGGGAAACAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902822434 1:18951441-18951463 CACTCGCACGGGAGGGAACCAGG + Intronic
903216433 1:21846072-21846094 CAGTGGGACGGGAAGGCCGGGGG - Intronic
903239547 1:21973872-21973894 GAGAGGGAGGGCAGGGAAGCTGG - Intergenic
903767011 1:25741516-25741538 CAGTGGGACGGCAGGAGGGCAGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903945494 1:26960027-26960049 CGTCGGGACGGGAGGGAGGCTGG - Intronic
904034618 1:27551983-27552005 CAGGGGGCCGGGTGGGAAGCAGG + Exonic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
904731984 1:32600151-32600173 AAGTGGTACAGGAGGGAACCAGG + Exonic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905271227 1:36789058-36789080 TAGTGGGAGGGAGGGGAAGCTGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905830197 1:41059511-41059533 CAGTGGGATGGATGGGGAGCTGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
906073411 1:43034442-43034464 GAAAGGGAAGGGAGGGAAGCGGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906644734 1:47466229-47466251 CACTGGGTCAGGAGGTAAGCAGG - Intergenic
909185618 1:72481908-72481930 GAGTGAGAGGGAAGGGAAGCTGG + Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910998133 1:93131209-93131231 CAGTGAGATGGGAGGAAACCAGG + Intronic
911335435 1:96575166-96575188 CAGTGGGATGGATGGGGAGCTGG + Intergenic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
914226278 1:145721606-145721628 CAGCGGGATGGGAGGGGCGCAGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915449446 1:155994526-155994548 CACAGGGAAGGGAGGGAGGCAGG + Intronic
915564564 1:156706401-156706423 TAGGGGGAAGGGAGGGAGGCGGG + Intergenic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915878817 1:159643453-159643475 GAGGGGGAGGGGAGGGGAGCGGG + Intergenic
916918804 1:169439794-169439816 CAGAGGGATAGGTGGGAAGCTGG + Intronic
916951571 1:169785478-169785500 CAGTGGGATGGATGGGGAGCTGG + Intronic
917539906 1:175902191-175902213 CAGTGGGATGGATGGGGAGCTGG - Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918789938 1:188813088-188813110 GAGAGGCACGGGAGGGAAGCAGG + Intergenic
919048998 1:192489223-192489245 CAGTGGGATGGCAGGCCAGCAGG - Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
919807041 1:201386338-201386360 GAGTGTGACGGGTGGGAGGCGGG + Exonic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920696867 1:208187426-208187448 GATTTGGAAGGGAGGGAAGCAGG + Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923315225 1:232773554-232773576 CAGTGGGATGGAATGGGAGCTGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1064599352 10:16977525-16977547 CAGTGGGATGGATGGGGAGCTGG - Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066305119 10:34133027-34133049 CAGTGGGATGGATGGGAAGCTGG - Intronic
1066564830 10:36710557-36710579 CAGTGGGATGGATGGAAAGCTGG - Intergenic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069709192 10:70478369-70478391 CAGAGGGGGGCGAGGGAAGCCGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071092608 10:81936476-81936498 AAGATGGATGGGAGGGAAGCAGG + Intronic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074414214 10:113253123-113253145 GAGGGGGAAGGGAGGGAGGCAGG - Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076102515 10:127794409-127794431 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1076193784 10:128500632-128500654 CAGCGGGAGGGGAGCGAGGCAGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077051234 11:568024-568046 CACGGGGACGCGAGGGCAGCTGG - Intergenic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1077712444 11:4550847-4550869 CAGTGGGATGGGTGGGGAGCTGG - Intergenic
1077714746 11:4569575-4569597 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1080502662 11:32885489-32885511 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1080723832 11:34875105-34875127 CAGTGGGATGGATGGGGAGCTGG - Intronic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082162503 11:48900587-48900609 CAGCGGGACAGGTGGGAGGCCGG + Intergenic
1083144869 11:60750583-60750605 CAGTGGGACGTGCGGAAAGCAGG - Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083318064 11:61828390-61828412 CATGGGGAAGGGAGGGAACCAGG + Exonic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083894130 11:65611696-65611718 CAGTGGGGAGGGTGGGGAGCAGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1087317051 11:96615119-96615141 CAGGGAGACGGGAGTGGAGCTGG - Intergenic
1087955890 11:104287638-104287660 CACAGGGACGGGAGCAAAGCTGG + Intergenic
1088450622 11:109977758-109977780 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1088802664 11:113320518-113320540 CAGTGGGATGGATGGGGAGCTGG - Intronic
1088814070 11:113409782-113409804 CAGTGGAAGGGAAGGGAAACAGG + Exonic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089175164 11:116543450-116543472 CACTGGGACAGGAAAGAAGCAGG + Intergenic
1089262638 11:117232886-117232908 AAGTGGGACGGGGGGGTGGCTGG + Intronic
1090457631 11:126863838-126863860 CTTTGGCACGGGAGGGAGGCAGG - Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1094745603 12:33341216-33341238 CAGTGGGAAGGATGGGGAGCTGG + Intergenic
1095448214 12:42303201-42303223 CAGTGGGATGGATGGGGAGCCGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097906988 12:64930867-64930889 CACTGGGACAGGAGTGAGGCTGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098744088 12:74213568-74213590 CAGTGGGATGGACGGGGAGCAGG + Intergenic
1098757667 12:74386947-74386969 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1102531354 12:113548570-113548592 GAGTGGGAAGGGAGGGAGCCAGG + Intergenic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1105726242 13:23164985-23165007 CAGTGGGAGGGGAGGGCCACAGG - Intergenic
1106879405 13:34112933-34112955 CAGTGGGATGGGTAGGAAGCTGG - Intergenic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1108254645 13:48598561-48598583 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109300727 13:60587366-60587388 CAGAGGGATGGATGGGAAGCTGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112171489 13:96977169-96977191 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113120310 13:106917739-106917761 CAGAGGGCCGGGACGGAAACGGG + Intergenic
1113288330 13:108878450-108878472 CAGTGGGATGGATGGGGAGCTGG - Intronic
1113913271 13:113854783-113854805 CTGTTGGATGGGAGGGATGCTGG + Intronic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1115906503 14:38208691-38208713 CTGCGGGACGGGAGAGAAGCTGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115949775 14:38708070-38708092 AAGAGGGAGGGGATGGAAGCTGG - Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1116846407 14:49868296-49868318 AACTGGGAGGGGAGGGAGGCGGG + Intergenic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1118474291 14:66102367-66102389 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119023812 14:71136956-71136978 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1119031639 14:71197325-71197347 CAGTGGGGAGGTAGGGGAGCTGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119519625 14:75276709-75276731 GAGGGGGACGGGAGGGAAAGGGG - Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121171112 14:91855138-91855160 CAGTGGAACGGCAGGGATGGAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122978818 14:105181923-105181945 CAGGGGGAGGGAAGGGCAGCTGG - Intergenic
1123053173 14:105557300-105557322 CAGTGGCACGGGACGGCCGCCGG + Intergenic
1123077748 14:105677714-105677736 CAGTGGCACGGGACGGCCGCCGG + Intergenic
1124257204 15:28153872-28153894 CGGTGGGAGGGGCGGGAATCAGG + Intronic
1124532583 15:30520435-30520457 CAGTCGGACGGGAAAGAAGGGGG - Intergenic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124646922 15:31443824-31443846 CAATGGGACGGGAGGGAGGGAGG - Intergenic
1124766070 15:32487209-32487231 CAGTCGGACGGGAAAGAAGGGGG + Intergenic
1125594136 15:40873672-40873694 CAGCGGGACAGGTGAGAAGCTGG - Exonic
1126102811 15:45129899-45129921 CAGTGGGGCGGGATGGAGTCTGG - Intronic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1127815896 15:62608622-62608644 CAGCGACACAGGAGGGAAGCAGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130086236 15:80780122-80780144 CACTGGGAGGCGAGGGAAACTGG - Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130803428 15:87291945-87291967 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1132688043 16:1170446-1170468 CAGAGGCAGGGGAGGGGAGCGGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132872754 16:2123062-2123084 CAGTGGGATGGGCGGGGAGCCGG - Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134551840 16:15142241-15142263 CAGTGGGATGGGTGGGGAGCGGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134873676 16:17676180-17676202 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135049993 16:19185074-19185096 AAGCGGGAAGGGAGGGAAGGAGG - Intronic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136365106 16:29806232-29806254 GGGTGGGACGGGAGGGAGGGCGG - Intronic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1140893133 16:79302071-79302093 TAGTGGCACTGGAGGGATGCAGG - Intergenic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141768180 16:86072360-86072382 CAGAGGGACAGAGGGGAAGCGGG - Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141884041 16:86879585-86879607 GAGATGGACGTGAGGGAAGCAGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142175901 16:88645183-88645205 CAGGGAGACGGGGGGGATGCGGG + Intronic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142836844 17:2593840-2593862 GAGGGGGAGGGGAGGGGAGCGGG - Exonic
1142847590 17:2689790-2689812 CAGTGGGCCGGGGGCGAGGCTGG - Exonic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143570853 17:7757454-7757476 CAGTGGGGTGGGAGGGGACCTGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143756558 17:9072034-9072056 CCGAGAGTCGGGAGGGAAGCCGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1149654356 17:58302481-58302503 CAGGGGGTCAGGAGGGAATCAGG - Intronic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151185238 17:72359397-72359419 CAATGGGAGGTGAGGGAGGCTGG - Intergenic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152265688 17:79293350-79293372 GAGGGGGAGGGGAGGGAGGCAGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153411916 18:4802967-4802989 CAGTGGGACGGACAGGGAGCTGG + Intergenic
1154155922 18:11944046-11944068 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156507577 18:37608059-37608081 GAGGGAGACGGGAGAGAAGCAGG + Intergenic
1156723824 18:40103385-40103407 GAGGGAGACGGGTGGGAAGCAGG - Intergenic
1157539705 18:48491820-48491842 CAGTGGGAGGGACGGGGAGCAGG + Intergenic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160196275 18:76758226-76758248 CAGTGTGACGGTAGGGGTGCGGG - Intergenic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1160988761 19:1852104-1852126 CAACGGGGCGGGCGGGAAGCTGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161505015 19:4639310-4639332 CACTGCGACGGGGGGGAAGTGGG - Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162497081 19:11029313-11029335 CACTGGGATGGGTGGGAACCAGG - Intronic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1164904496 19:31955957-31955979 CAGTGGGAAGGATGGAAAGCGGG - Intergenic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165133344 19:33647270-33647292 CAGTGAGACAGGAAGAAAGCAGG + Intronic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1167200749 19:48063560-48063582 CGGGGGGACGGGAGGGATGGGGG - Intronic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
926506451 2:13721883-13721905 CAGTGGGATGGATGGGGAGCTGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927322395 2:21762567-21762589 CAGTGGGATGGATGGGGAGCTGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928401163 2:30979719-30979741 CAATGGGATGTGATGGAAGCAGG - Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
930768131 2:55105723-55105745 CTTTGGGAGGGGAAGGAAGCAGG + Intronic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933409751 2:81910242-81910264 CAGTGGGATGGATGGGGAGCTGG + Intergenic
933425953 2:82112551-82112573 CAGTGGGATGGATGGGGAGCTGG - Intergenic
933656206 2:84888981-84889003 CAGCAGCACGGAAGGGAAGCTGG + Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937315710 2:120930892-120930914 CACTGGCAAGGGAAGGAAGCAGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
937921880 2:127136868-127136890 CATGGGGACGGAAGAGAAGCAGG + Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939450455 2:142367062-142367084 CAGTGGGATGGATGAGAAGCTGG + Intergenic
941693144 2:168522642-168522664 CAGTGGGAGGGGAATGAAACTGG - Intronic
942179969 2:173370974-173370996 CAGTGGGACAGTAGGAAACCAGG + Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946207973 2:218124516-218124538 CACTGGGAAAGGAGTGAAGCTGG - Intergenic
946219727 2:218216485-218216507 CTGTGGGACGTGGGGGCAGCTGG - Intergenic
948145233 2:235703571-235703593 GCGGGGGAGGGGAGGGAAGCGGG - Intronic
948554287 2:238796552-238796574 CAGGAGGATGGGAGGGAACCAGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
1168889823 20:1287798-1287820 AAGGGGGAAGGGAGAGAAGCCGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169792732 20:9428720-9428742 GAGGGGAACGGGAGGGAACCTGG + Intronic
1169867417 20:10217233-10217255 CATTGCGGAGGGAGGGAAGCGGG - Intergenic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1170669359 20:18416349-18416371 AGGTGGGACCGGAAGGAAGCTGG - Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170972098 20:21125943-21125965 CTGAGGGACGGGGCGGAAGCCGG - Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1172703380 20:36865546-36865568 CAGTGGGCCGTGAGGGGAGCTGG - Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175532385 20:59682841-59682863 GAGGGAGACGGGAGAGAAGCAGG + Intronic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176606637 21:8839497-8839519 CAATGGGATGGATGGGAAGCTGG + Intergenic
1177605053 21:23367239-23367261 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179912743 21:44459082-44459104 CAGCGTGGCGTGAGGGAAGCAGG - Exonic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1180994611 22:19959441-19959463 CACTGGGCCGGGAGGGACGCGGG - Intronic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1182415176 22:30216829-30216851 CTTTGGCACGGGAGGGGAGCAGG - Intergenic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183391102 22:37546103-37546125 CAGCGGGACGGGAAGGAATCTGG + Intergenic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184836069 22:47021804-47021826 CACTGGGGCGGGAGGGAGACAGG - Intronic
1184836089 22:47021893-47021915 CAGTGGGCGGGGTGGCAAGCGGG - Intronic
1184880219 22:47299889-47299911 CACTGGGACTGCAGGGGAGCTGG - Intergenic
1185409400 22:50674333-50674355 GCCTGAGACGGGAGGGAAGCGGG - Intergenic
949802111 3:7915277-7915299 CAGTGGGAGGGATGGGGAGCTGG - Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950100729 3:10355125-10355147 GAGTGGGGCGGGATGGATGCAGG - Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
951656073 3:25009851-25009873 CAGTGGAAGGGGAGACAAGCAGG + Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957984968 3:87562473-87562495 CAGCGGGATGGATGGGAAGCTGG - Intergenic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959857354 3:111175011-111175033 CAGTGGGATGGATGGGGAGCTGG + Intronic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
959984945 3:112561898-112561920 GAGTGAGAAGGAAGGGAAGCCGG - Exonic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961105212 3:124234967-124234989 CAGGGGAGCGGGAGGGGAGCTGG + Intronic
961343122 3:126243645-126243667 CAGTGGGATGGATAGGAAGCTGG + Intergenic
961372563 3:126440534-126440556 TAGGGAGACGGTAGGGAAGCTGG - Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963043181 3:141083877-141083899 CAGAGGGGAGGGAGGTAAGCAGG - Intronic
963071524 3:141308907-141308929 CAGTGGGACAAAAGGGCAGCTGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966347700 3:178997550-178997572 CAGTGGGATGGATGGGGAGCTGG - Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
968554166 4:1238857-1238879 CAGGGGGACAGGAGGGACCCAGG + Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968632905 4:1661400-1661422 CAGGGAGGCGGGTGGGAAGCAGG - Intronic
968937063 4:3617112-3617134 GAAAGGGACGGGAGGGAAGAAGG - Intergenic
969110585 4:4841718-4841740 TAGTGGGACGGGGAGGAGGCTGG - Intergenic
969196678 4:5568847-5568869 CAGTTGGACGGGATGGATGGAGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971242238 4:24899303-24899325 CATTGAGGCGGGATGGAAGCAGG + Intronic
971502057 4:27328355-27328377 CAGTGGGATGGATGGGAAGCTGG + Intergenic
973371475 4:49251660-49251682 CAATGGGATGGATGGGAAGCTGG - Intergenic
973389533 4:49543651-49543673 CAATGGGATGGATGGGAAGCTGG + Intergenic
973623613 4:52750855-52750877 CAGTGGGACCGGAGGGTTCCTGG - Intronic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975114923 4:70669871-70669893 CAGTGAGACAGGAGGAAAACAGG - Intronic
977790949 4:101102288-101102310 GAGAGGGAGGGGAGAGAAGCAGG + Intronic
978203386 4:106049588-106049610 CAGTGGGACAGGGGAGAACCAGG + Intronic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979952498 4:126910804-126910826 GACTTGGATGGGAGGGAAGCTGG + Intergenic
980554613 4:134387063-134387085 CAGTGGGATGGATGGGGAGCTGG - Intergenic
981362773 4:143866560-143866582 CAGTGGGATGGATGGGGAGCTGG - Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983798893 4:171902621-171902643 CAGTGAGAGGGTAGGGAGGCTGG + Intronic
983810191 4:172051462-172051484 CAGTGGGATGGAGGGGGAGCTGG + Intronic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
984761460 4:183366365-183366387 CAGTGGGACGGGAGAAATTCAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985293184 4:188407030-188407052 CAGTGGGATGGATGGGGAGCTGG - Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985777547 5:1852626-1852648 TAGAAGGACGGGAGGGCAGCAGG - Intergenic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989719128 5:44504025-44504047 CAGTGGGATGGTTGGGGAGCTGG - Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
992228910 5:74644135-74644157 GAAGGGGAAGGGAGGGAAGCAGG + Intronic
992250079 5:74867098-74867120 GAGAGGCACGGGAGGAAAGCCGG - Intergenic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993426664 5:87773594-87773616 CAGGAGGACGGGAAGGCAGCTGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
996536739 5:124585496-124585518 CAGTGGGAAGGATGGGGAGCTGG + Intergenic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
999304442 5:150510516-150510538 CCTTGGGACGGGAGGGTGGCAGG + Intronic
999668491 5:153937311-153937333 CAGTGGGATGGATGGGGAGCTGG + Intergenic
999702693 5:154242602-154242624 GAGAGTGACAGGAGGGAAGCAGG - Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000071481 5:157744205-157744227 CCGCGGGCCGGGCGGGAAGCGGG + Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001710024 5:173771168-173771190 AAGGGGGAGGGGAGGGAGGCGGG - Intergenic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1003593141 6:7452725-7452747 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004166777 6:13264211-13264233 TACTGGGACAGCAGGGAAGCAGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1005825299 6:29628369-29628391 GAGTGGGACGGGAGAGAAACGGG + Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006583325 6:35089055-35089077 CAGTGGGTCGGAAGAGAAGGCGG + Exonic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006831458 6:36970614-36970636 CAGTGGGAAGGAAGGACAGCTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009404087 6:63291403-63291425 CAGTGGGATGGTTGGGGAGCAGG + Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011491826 6:87900743-87900765 CAGTGGGATGGATGTGAAGCTGG + Intergenic
1011510308 6:88093394-88093416 CAGTGGGATGGATGGGAAGCTGG - Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1011873599 6:91927296-91927318 CAGTGGTACGGGAGTGGAGCAGG - Intergenic
1012939544 6:105402725-105402747 GAGGGGGAGGGGAGGGACGCGGG + Intronic
1012945462 6:105461173-105461195 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1014299662 6:119665682-119665704 CAGTGGCATGGGTGGGAACCGGG + Intergenic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018969383 6:168515695-168515717 CAGTGGGACAGGCTGGATGCTGG - Intronic
1019376809 7:697180-697202 CTGTGGGACGGGATAGGAGCAGG - Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1020748770 7:12112253-12112275 CTTTGGGAGGGGAAGGAAGCAGG - Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022963854 7:35455048-35455070 CAGTGGGACGGAAGGGTCTCGGG - Intergenic
1024635836 7:51289554-51289576 CTCTAGGACGGGAGGTAAGCAGG - Intronic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026307541 7:69154908-69154930 GAGGGGGAAGGGAGGGGAGCAGG - Intergenic
1026877172 7:73886481-73886503 CTCTGGGACAGGAGGGAGGCGGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1033573313 7:142655519-142655541 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1033629279 7:143140939-143140961 CAGTGGGATGGATGGGGAGCCGG + Intergenic
1034099391 7:148437994-148438016 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035370350 7:158375879-158375901 CAGTGGGATGGATGGGGAGCTGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1039311243 8:36320809-36320831 CAGTGGGACGGCCGGGCAGAGGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039608443 8:38901267-38901289 CCGAGGGACGGGAGAGAAGGAGG + Intronic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040481469 8:47831479-47831501 CAATGCGGCGGGAGGGCAGCTGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040829885 8:51664756-51664778 CAGTGGGACCGCAGGGCACCTGG - Intronic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042348526 8:67751789-67751811 CAGTGGGATGGATGGGGAGCCGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1042601440 8:70503181-70503203 CAGTGGGATGGATGGGAAGCTGG + Intergenic
1043702005 8:83300816-83300838 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1045257114 8:100535543-100535565 GACTGGCATGGGAGGGAAGCAGG - Intronic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1046567260 8:115917672-115917694 CAGTGGGATGGATGGGGAGCTGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047195177 8:122714485-122714507 CAGTGGGACGGGATGGCTGCTGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047878452 8:129166691-129166713 AAGAGGGATGGGAGGGATGCAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048573009 8:135670380-135670402 CAGTGGGACAGTGGGGAGGCTGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049441613 8:142612304-142612326 GAGTGGGCCGGGTGGGAGGCAGG - Intronic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051221187 9:14850190-14850212 TAGTGGGAGGGGAGGACAGCTGG - Intronic
1051917976 9:22230356-22230378 CAGTGGGGAGGGATGGATGCAGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053357075 9:37455332-37455354 CAGTGGGATGGATGGGGAGCTGG - Intronic
1054454084 9:65420576-65420598 GAAAGGGACGGGAGGGAAGAAGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058093861 9:100836995-100837017 CAGTGGGATGGATGGGCAGCTGG - Intergenic
1058343647 9:103930287-103930309 CACGGGGAAGGGAGGGAGGCAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060124027 9:121024283-121024305 GAGGGGGAGGGGAGGGGAGCGGG + Intronic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1061012942 9:127966063-127966085 GGGTGGGCCGGGAGGGAGGCTGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061887636 9:133600581-133600603 CAGTGGGATGGGGTGGGAGCAGG + Intergenic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062638236 9:137502684-137502706 GAGGGGGACGGGGGGGACGCGGG + Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203553945 Un_KI270743v1:190357-190379 CAATGGGATGGATGGGAAGCTGG + Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185610611 X:1392024-1392046 CAGCGGAACGGGAGGACAGCCGG + Exonic
1186039233 X:5457723-5457745 CAGTGGGATGGATGGGGAGCTGG + Intergenic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186416234 X:9385182-9385204 CTGTGGAACGGGACTGAAGCAGG + Intergenic
1187032586 X:15503197-15503219 CAGTGGTACAGAAGGGGAGCAGG - Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189920799 X:45901414-45901436 CACTGGTACAGGAGGGAGGCAGG + Intergenic
1189967262 X:46387596-46387618 CAGTGGGTGGGGTGGGAACCTGG - Intergenic
1192113909 X:68392854-68392876 CAGTGGGCCGGATGGGGAGCTGG - Intronic
1192172916 X:68867867-68867889 CCGTGAGACGGGAGGCCAGCAGG - Intergenic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1193300983 X:79887894-79887916 CACTGGGACAGGAGTGAGGCTGG + Intergenic
1193344828 X:80393377-80393399 CAATGGGAGGGGAGAGAAACGGG - Intronic
1195067660 X:101252316-101252338 AAGGGAGACAGGAGGGAAGCAGG - Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1198147038 X:133867961-133867983 CAGTGGGATGGACGGGGAGCTGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1200017954 X:153180171-153180193 CAGTGGGACGGGACGGGGGGTGG - Intronic
1201300736 Y:12502570-12502592 CAGTGGGATGGTTGGGGAGCTGG - Intergenic
1201741285 Y:17326410-17326432 GAGGGGGAAGGGAGGGAGGCGGG + Intergenic