ID: 902340664

View in Genome Browser
Species Human (GRCh38)
Location 1:15781583-15781605
Sequence CTGTTAACTAAGAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902340663_902340664 -5 Left 902340663 1:15781565-15781587 CCTGGAAGGAGTTGAGTGCTGTT 0: 1
1: 0
2: 0
3: 24
4: 263
Right 902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG 0: 1
1: 0
2: 4
3: 69
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902340664 Original CRISPR CTGTTAACTAAGAAGAAAAA TGG Intronic
900235564 1:1588219-1588241 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
901181645 1:7346185-7346207 CTATGAACTGAGAAGAGAAAAGG + Intronic
901619848 1:10575066-10575088 CTCTTAAATAAAAAAAAAAAAGG + Intronic
902148373 1:14422114-14422136 ATGTGAACCAAGAAGAAAATAGG + Intergenic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
902710046 1:18232925-18232947 TTGTTAAGTATGAAGGAAAAGGG + Intronic
902945495 1:19834165-19834187 CTTTTAGCTCAGGAGAAAAAAGG - Intergenic
903120721 1:21215442-21215464 TTGTTAACAAAGAAGGGAAAAGG + Intergenic
903303933 1:22399458-22399480 CTGTAAAATGAGAAGAATAATGG - Intergenic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906813034 1:48848930-48848952 CTTTTGAATAAGAAGAAGAAAGG - Intronic
906948752 1:50317482-50317504 CTCTGAAATATGAAGAAAAAAGG - Intergenic
907400067 1:54219600-54219622 CTGTAAAATAAAAAGTAAAATGG - Intronic
907491691 1:54812605-54812627 CTGTTAACAAAGCAGAGAACAGG + Intronic
907536543 1:55165944-55165966 CTCCAAACTGAGAAGAAAAAAGG + Exonic
907823912 1:57997161-57997183 ATGTTCACTAAGAGGTAAAATGG + Intronic
908547045 1:65172293-65172315 GTGTTAAATAAAAAGAAAAAAGG + Intronic
908736980 1:67286715-67286737 CAGATAACTCAAAAGAAAAATGG - Intergenic
909194205 1:72595159-72595181 TTGTTCACTAAAAAGAAAAGAGG + Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910367013 1:86476774-86476796 CAGTTAAAAAAAAAGAAAAAAGG - Intronic
910774319 1:90860108-90860130 CTGTTTACAAGGAAAAAAAAAGG + Intergenic
911189087 1:94929873-94929895 GTGTGAACTAAGAGGCAAAATGG - Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
912140829 1:106724678-106724700 TTGCTAACTCAGAAGATAAATGG + Intergenic
912847825 1:113092006-113092028 CTGTTAGCAAAGAATTAAAAAGG - Intronic
913406471 1:118497812-118497834 ATGTAAAGTAAGTAGAAAAAAGG + Intergenic
913466379 1:119147481-119147503 GTGGAAACTAAGAAAAAAAAAGG + Intergenic
913646908 1:120865721-120865743 CTATTAACAAAGAAGGAAGAGGG + Intergenic
914079740 1:144397142-144397164 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914174641 1:145265680-145265702 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914529368 1:148507168-148507190 CTATTAACAAAGAAGGAAGAGGG - Intergenic
915841633 1:159217782-159217804 CTTTTTACTAAGGAGAAAAATGG + Intergenic
916587553 1:166161765-166161787 TTGTTTACTAAGATGAAGAATGG + Intronic
916592717 1:166207974-166207996 CTGTTTACTAAGTAGAGAGATGG - Intergenic
916755003 1:167760969-167760991 CTGTTAAAAAACAAAAAAAAAGG + Intronic
916945907 1:169727300-169727322 CTGGTGATTAAAAAGAAAAAGGG - Intronic
917103136 1:171465730-171465752 ATGTTCACTAAGAGGCAAAATGG - Intergenic
917654029 1:177107866-177107888 CTGTTCACTCAAAGGAAAAAAGG + Intronic
917698109 1:177550366-177550388 CTGTATACTAAAAAAAAAAAGGG - Intergenic
917753241 1:178073752-178073774 CTGAGAACTAAAAAAAAAAAAGG - Intergenic
917778904 1:178369665-178369687 TTGTTAAATAAGAAGACCAATGG + Intronic
918190068 1:182165002-182165024 GTGTTCACTAGGAAGAAAACTGG - Intergenic
918792991 1:188855313-188855335 ATGTTAGCTAAGAAGTAACATGG - Intergenic
919195635 1:194281499-194281521 GTGTAAAGTAAGAAGAAAAGAGG - Intergenic
919231846 1:194783824-194783846 ATGCTAATTAAGAAGAAAATGGG + Intergenic
919562280 1:199136504-199136526 ATGTTAACTATTAAGGAAAAGGG - Intergenic
919729932 1:200907208-200907230 CTGTCAAAAAAAAAGAAAAAGGG - Intronic
921105015 1:211968135-211968157 TTGTTAAATAAAAACAAAAATGG + Intronic
921137083 1:212271231-212271253 CTGTTAACTGGGAGGAAAAGAGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
923115805 1:230936407-230936429 CTGTCAACTAGTAAGAAAGATGG - Intronic
923381448 1:233423579-233423601 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
924663403 1:246044119-246044141 CTGTTGAATTAGAAGAAAACTGG - Intronic
1062790609 10:302099-302121 CTATAAACTAATAAGAAAAAAGG + Intronic
1062840310 10:665354-665376 TTTTTAACTGAAAAGAAAAACGG + Intronic
1064815332 10:19254884-19254906 CAGTTAACTCATAAGAGAAATGG - Intronic
1064865156 10:19871176-19871198 CTGTTCTTTAGGAAGAAAAATGG - Intronic
1064912282 10:20415767-20415789 CTGTTATCTAAGATGACTAAGGG - Intergenic
1065049349 10:21775153-21775175 CTTTTAAGTGAGAAAAAAAAAGG - Intronic
1065141187 10:22719734-22719756 AAGTTCACTAAGAAGAAAGAAGG + Intergenic
1066323590 10:34330224-34330246 ATATTTACTAAGAAGCAAAAGGG - Intronic
1067295860 10:44974963-44974985 CTGGTATCTCAAAAGAAAAAAGG + Intronic
1067983055 10:51109277-51109299 ATGTTTAAAAAGAAGAAAAAAGG + Intronic
1069094764 10:64245505-64245527 CTGCAAACTAGGAGGAAAAAAGG - Intergenic
1069268948 10:66499805-66499827 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1071123220 10:82304664-82304686 CTGACAACTAACAAGAAAACAGG - Intronic
1071126136 10:82337086-82337108 CAGTTTAGTAAGAAGTAAAAGGG - Intronic
1071441601 10:85702845-85702867 GTGGTAAGTGAGAAGAAAAAAGG + Intronic
1071661052 10:87503630-87503652 ATGTTAACCAAGAAGAAACGGGG - Intergenic
1072099588 10:92216540-92216562 TTGTCAACAAAGGAGAAAAAGGG + Intronic
1072672135 10:97438216-97438238 CTCTTAAAAAAAAAGAAAAAAGG - Intronic
1073443540 10:103567292-103567314 CTATAAACGAAGAAAAAAAAAGG - Intronic
1073638135 10:105220387-105220409 CTGATACCCAAGAAGATAAAAGG - Intronic
1073779978 10:106826438-106826460 CTGTTAATTATGCAGAACAAAGG - Intronic
1073841273 10:107501826-107501848 CTGTTCACCAAGAAGAACAGTGG + Intergenic
1074218835 10:111415788-111415810 CTGTAAAGTATGCAGAAAAAAGG + Intergenic
1074269546 10:111940106-111940128 CTGTTTAATAAAAAGAAAAAAGG - Intergenic
1074731785 10:116385975-116385997 CTGTTTACTTAGCTGAAAAATGG + Intergenic
1074765188 10:116695069-116695091 CTGACAACCAAGAAGAAAGAGGG - Intronic
1074779732 10:116792889-116792911 CTGATGACTAAAAAGACAAAGGG + Intergenic
1075327513 10:121546210-121546232 CTGTTGTTTAAGAAGAGAAATGG + Intronic
1075694756 10:124425557-124425579 ATTTTGACTAAGAACAAAAAAGG + Intergenic
1076094265 10:127718308-127718330 CTGTTAAAGAAAAATAAAAATGG + Intergenic
1077596844 11:3540034-3540056 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1077767354 11:5174396-5174418 CTGTTAGATGAGAAAAAAAATGG + Intronic
1078782779 11:14455111-14455133 TTGTTTTATAAGAAGAAAAAGGG - Intronic
1078819831 11:14867060-14867082 CTGTTAAAAAAAAAAAAAAAGGG + Intronic
1079414494 11:20220969-20220991 CTGATGAATAAGGAGAAAAAGGG + Intergenic
1079573499 11:21974527-21974549 CTGTCTATTAACAAGAAAAATGG - Intergenic
1079632956 11:22699971-22699993 CTCTTACCTAAGAAGGGAAAAGG + Intronic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1079984987 11:27190724-27190746 ATGTCAAGTGAGAAGAAAAATGG - Intergenic
1080426728 11:32161754-32161776 CTGATGATTAAGAAGGAAAATGG - Intergenic
1080573004 11:33574029-33574051 TTGTAAACTAATAAGGAAAAGGG + Intronic
1080741081 11:35064802-35064824 CTGTTCAGAAAGAAGGAAAAAGG - Intergenic
1080913349 11:36628136-36628158 CTGTGCTCTAAGAAGACAAATGG - Intronic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1081284575 11:41251915-41251937 GTGATAATTAAAAAGAAAAATGG + Intronic
1081480290 11:43480070-43480092 CTGTTAACAAAGGAGAAATGTGG + Intronic
1081532841 11:43975241-43975263 CTGTTAAGTATGAAGAAGCAGGG + Intergenic
1083887773 11:65581195-65581217 CTGGCAACTGAGAAGAAAGAGGG - Exonic
1084252762 11:67913988-67914010 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1084260268 11:67972678-67972700 CTTCTATGTAAGAAGAAAAAAGG - Intergenic
1084820101 11:71682036-71682058 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1085453412 11:76652202-76652224 TAGTTAACTCAGTAGAAAAATGG + Intergenic
1086065826 11:82743439-82743461 CTGTTGTGTAAGAATAAAAATGG - Intergenic
1086541809 11:87921790-87921812 CTGCTATCTGAGAAAAAAAAAGG - Intergenic
1086561731 11:88176263-88176285 TTGTAAAATAGGAAGAAAAATGG - Intergenic
1087209121 11:95428269-95428291 CTGTGAGGGAAGAAGAAAAATGG - Intergenic
1087525932 11:99312771-99312793 ATGATAAATGAGAAGAAAAAAGG + Intronic
1087617844 11:100508725-100508747 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1087797476 11:102469745-102469767 ATGTTCACTAAGCAGCAAAATGG + Intronic
1087797929 11:102473855-102473877 ATGTGAACTAAGAGGCAAAATGG - Intronic
1087914887 11:103798843-103798865 ATGTCAACGAAGTAGAAAAATGG - Intergenic
1088077131 11:105863861-105863883 CTGGTTTCTAAGAAGAAAATTGG + Intronic
1088658379 11:112024133-112024155 CTGTTAAAAAAAAAAAAAAATGG - Intergenic
1089994693 11:122894748-122894770 CTGTTATCAAAGAAAAAAAAAGG + Intronic
1090196868 11:124824039-124824061 CTGCTCACTAAGAGGCAAAATGG + Intergenic
1090588828 11:128243024-128243046 AAGTTAAAAAAGAAGAAAAAAGG + Intergenic
1092322342 12:7489724-7489746 CAGTTTGCTCAGAAGAAAAATGG - Intronic
1092666288 12:10802843-10802865 CTGTTTACTAAGATGCAAATTGG + Intergenic
1093053229 12:14528740-14528762 ATCTTAATAAAGAAGAAAAATGG + Intronic
1093276680 12:17137373-17137395 CTGTTAACTTAAAACAAATATGG + Intergenic
1093418982 12:18952760-18952782 CTGTAAAGAAATAAGAAAAAGGG - Intergenic
1093962048 12:25284856-25284878 CTATTAAATAAAAAAAAAAATGG + Intergenic
1094030067 12:26001778-26001800 CAGTTAACTTAAAAAAAAAAAGG + Intronic
1094054376 12:26254268-26254290 TTGTTAACAAACAAGTAAAATGG - Intronic
1094582004 12:31741963-31741985 CTGTTAAAAAAGAAGAGGAAGGG + Intergenic
1095323001 12:40852306-40852328 CTATAAAATAAGAAGAAAAATGG - Intronic
1095660500 12:44727890-44727912 GAATTAACTAAGAAGCAAAAGGG + Intronic
1095665544 12:44793307-44793329 TTGTTAAACAAGAAGATAAAAGG - Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099120533 12:78684556-78684578 CAGTTAACTAAGAAAGGAAATGG - Intergenic
1099508930 12:83509634-83509656 CTGTTGACTTAGAGGAAAAGAGG - Intergenic
1099649931 12:85413311-85413333 CTGGTCATTAAGAAAAAAAAAGG - Intergenic
1099942811 12:89210201-89210223 CTGTAAACAAAACAGAAAAAAGG + Intergenic
1099957738 12:89367652-89367674 CTCTTAAAGAAGAAGAAGAAGGG + Intergenic
1100388476 12:94125841-94125863 CTGTAAATTAAAAGGAAAAAAGG - Intergenic
1100952495 12:99866980-99867002 CTCTTAAACAAGAGGAAAAAGGG + Intronic
1101298755 12:103455681-103455703 CTGCTCTCTAAGAAGAGAAAAGG - Intronic
1101306983 12:103538246-103538268 CTGCTAGCTGGGAAGAAAAATGG + Intergenic
1101404662 12:104417439-104417461 CTGTTAACTAATGAGAAAGATGG + Intergenic
1101493752 12:105235009-105235031 TTATTCACTTAGAAGAAAAAGGG + Intronic
1101880312 12:108621892-108621914 CTGTTAAAGAAAAAAAAAAATGG - Intergenic
1101895121 12:108750766-108750788 CTGTTAATTAATAACAACAAAGG + Intergenic
1104314734 12:127686895-127686917 GCGTTAATTAAGAAGAAAGATGG + Intergenic
1104583158 12:130025613-130025635 ATGTTAAGTAGTAAGAAAAACGG + Intergenic
1106282093 13:28283728-28283750 CTGTTAAATAGGAATAACAATGG - Intronic
1106845399 13:33732652-33732674 TTCTAAAGTAAGAAGAAAAATGG - Intergenic
1107260707 13:38487482-38487504 CTGAGAACTAACAAGAAAATGGG - Intergenic
1107269372 13:38596466-38596488 GTTTTAACTAGGAAGAAAAAGGG + Intergenic
1107293429 13:38883587-38883609 ATGTTAACTAAGGGCAAAAATGG - Exonic
1107485641 13:40824739-40824761 GTGTTAAACCAGAAGAAAAAAGG + Intergenic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108625201 13:52221757-52221779 GTGTTAAACCAGAAGAAAAAAGG + Intergenic
1108660856 13:52584660-52584682 GTGTTAAACCAGAAGAAAAAAGG - Intergenic
1109139767 13:58700014-58700036 CTTTTAAAAAATAAGAAAAAAGG - Intergenic
1109263619 13:60171702-60171724 GTATTAAATAAGTAGAAAAAAGG + Intergenic
1109501794 13:63246879-63246901 GTTTTAATCAAGAAGAAAAAAGG - Intergenic
1109678616 13:65715970-65715992 CTGTAAACTTAGAAAAATAAGGG + Intergenic
1110029451 13:70588087-70588109 CTGTTAACTAGGAAAAACATTGG - Intergenic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1110982622 13:81920136-81920158 CTTCTAATTAAGAAGAAAATGGG - Intergenic
1111237321 13:85426736-85426758 ATCTTAAATAAAAAGAAAAAAGG - Intergenic
1111311023 13:86486240-86486262 CTTTTAACTAAAATCAAAAATGG - Intergenic
1111610248 13:90596162-90596184 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1112691522 13:101901354-101901376 TTGATAACAAATAAGAAAAATGG - Intronic
1112822212 13:103350752-103350774 CACTTACCTAAGAAAAAAAATGG - Intergenic
1113038790 13:106081663-106081685 CTGATAACAAAGAAAAAAAGTGG + Intergenic
1113268697 13:108648399-108648421 CTGTGAACTAAGACATAAAAAGG - Intronic
1115089938 14:29562079-29562101 CTCTAAACTAACAAAAAAAATGG + Intergenic
1115758195 14:36550760-36550782 ATGGTAACTAAGATGAAAATTGG - Intergenic
1116059696 14:39906845-39906867 CTATTGACTAAGAAAAAAAGTGG + Intergenic
1116676269 14:47910049-47910071 CAGTGAAATAGGAAGAAAAATGG - Intergenic
1117020120 14:51561820-51561842 TAGTTCACTAAGAAGAAAAAGGG + Intronic
1117242160 14:53845035-53845057 CAGATAACTAGGATGAAAAATGG + Intergenic
1117391051 14:55263157-55263179 CTGTTAACAAGCAAGAAAAGGGG + Intergenic
1117429076 14:55634298-55634320 CTGTAAAATATCAAGAAAAATGG - Intronic
1117738557 14:58791985-58792007 ATGTTGACTTACAAGAAAAAAGG + Intergenic
1117821621 14:59656363-59656385 ATGTTAATTAAAAAGAAATATGG + Intronic
1118247989 14:64130327-64130349 ATTTCAACAAAGAAGAAAAATGG - Intronic
1120055872 14:79923584-79923606 CTGGTAACAAAGAACAAAAAGGG - Intergenic
1120223661 14:81765562-81765584 CTGCAACCTAAGAAGGAAAATGG + Intergenic
1120288577 14:82537287-82537309 CTGACAACTAACAAGAAAACAGG + Intergenic
1120520661 14:85524335-85524357 CTCTTAGCTAAGAAAAAGAAGGG + Intergenic
1120536521 14:85702742-85702764 CTGATAGCTAAGTTGAAAAAAGG + Intergenic
1122167004 14:99834078-99834100 CAGTGAACTAGGAAGAGAAAAGG - Intronic
1122370537 14:101226804-101226826 CTGTTGACCAAGAAGAGACAGGG + Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1122483441 14:102062628-102062650 CTTTTAAATAAAAAAAAAAAAGG - Intergenic
1123186820 14:106526237-106526259 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1123468089 15:20530840-20530862 TTGTTAACAAAGAAGAAATGAGG + Intergenic
1123650022 15:22470202-22470224 TTGTTAACAAAGAAGAAATGAGG - Intergenic
1123728405 15:23126049-23126071 TTGTTAACAAAGAAGAAATGAGG + Intergenic
1123740429 15:23279044-23279066 TTGTTAACAAAGAAGAAATGAGG - Intergenic
1123746569 15:23323514-23323536 TTGTTAACAAAGAAGAAATGAGG + Intergenic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1124278836 15:28346831-28346853 TTGTTAACAAAGAAGAAATGAGG + Intergenic
1124303863 15:28564777-28564799 TTGTTAACAAAGAAGAAATGAGG - Intergenic
1124532747 15:30521254-30521276 TTGTTAACAAAGAAGAAATGAGG - Intergenic
1124765907 15:32486390-32486412 TTGTTAACAAAGAAGAAATGAGG + Intergenic
1125013497 15:34906459-34906481 ATATTACCTAAGAAGCAAAAAGG + Intronic
1125285771 15:38090908-38090930 ATGATAACTATGTAGAAAAAAGG + Intergenic
1126080103 15:44952141-44952163 TTGTTAACTATGGAGTAAAAGGG - Intergenic
1126164337 15:45641582-45641604 CTGTTAACAAATAAAGAAAATGG - Intronic
1126204109 15:46023117-46023139 ATGATAACTAAGTTGAAAAAAGG + Intergenic
1126342618 15:47658913-47658935 CTTTTAAATAACAACAAAAATGG + Intronic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1127792625 15:62411835-62411857 AAGTTAACTAAAGAGAAAAATGG + Intronic
1127867398 15:63043381-63043403 TTGTTACCTAAGAACAAAGATGG + Intronic
1128100589 15:64995904-64995926 TTGATAAATATGAAGAAAAATGG + Intergenic
1129712634 15:77828351-77828373 CCGTTTACTGAGATGAAAAAGGG - Intergenic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130772925 15:86943247-86943269 ATGATAAGGAAGAAGAAAAATGG + Intronic
1130816293 15:87438273-87438295 ATCTTAACAAAGAAAAAAAATGG + Intergenic
1132093423 15:98964215-98964237 TTTTTAAGTAAGAAAAAAAAAGG + Exonic
1132270896 15:100523778-100523800 CTGTTCAGTAGGAAGAAAACTGG + Intronic
1132316026 15:100891228-100891250 CTGTAAAATAAGAATAATAACGG - Intronic
1132400590 15:101502478-101502500 CTTTTAAAAAAGAAAAAAAAAGG + Intronic
1133375240 16:5280748-5280770 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1133700755 16:8306266-8306288 CTGTCATCTAAGAAGCAGAAAGG + Intergenic
1133783490 16:8957197-8957219 GTGTTAACTTACTAGAAAAATGG + Intronic
1134403009 16:13928329-13928351 CTGTTATTTAAGAATAAAATTGG + Intronic
1134403235 16:13931786-13931808 CTGTTATTTAAGAATAAAATTGG - Intronic
1135690430 16:24533019-24533041 TGGTTAACTAAAAAAAAAAATGG + Intergenic
1136595912 16:31249832-31249854 CTCATAACAAAGAAAAAAAATGG - Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137442306 16:48507810-48507832 GTGTTAAAAAAGAAGTAAAAAGG + Intergenic
1137524193 16:49219487-49219509 CTGTGTTGTAAGAAGAAAAATGG - Intergenic
1137946554 16:52738188-52738210 TTTTTAACAAATAAGAAAAATGG - Intergenic
1139046528 16:63066868-63066890 ATGTTAAATAAAAATAAAAATGG - Intergenic
1139154656 16:64426073-64426095 ATGATAAATAAGAATAAAAAAGG + Intergenic
1139180026 16:64736092-64736114 CTGTTAACTCTGAAAAATAATGG - Intergenic
1139758817 16:69167631-69167653 CTATTAACAAAAAAAAAAAAAGG + Intronic
1140273109 16:73483815-73483837 CTGCAAATTATGAAGAAAAATGG + Intergenic
1140526520 16:75627432-75627454 GTATATACTAAGAAGAAAAATGG - Intergenic
1140898412 16:79346457-79346479 CTCTGAAATCAGAAGAAAAAGGG + Intergenic
1140977944 16:80078678-80078700 CTCTTAAAAAAGAAGAAGAAAGG - Intergenic
1141588530 16:85051404-85051426 ATGTTATCTCAGAAGAGAAATGG + Intronic
1142025187 16:87808981-87809003 CTGTACACAAAGAAGAAAGAAGG + Intergenic
1142791718 17:2271752-2271774 TTTTTAATTAAAAAGAAAAAAGG + Intronic
1143984781 17:10902861-10902883 TTTTTAGCTATGAAGAAAAAAGG - Intergenic
1144048545 17:11476169-11476191 GAGCTAACTAAGAAAAAAAAGGG - Intronic
1144688931 17:17246489-17246511 CTGTTTACAAAAAAAAAAAAGGG - Intergenic
1146327146 17:31896493-31896515 ATGAAAACTAAAAAGAAAAATGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146812074 17:35911753-35911775 TTGTTAAATAAGAAAAAAATAGG - Intergenic
1147061206 17:37880001-37880023 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1147295890 17:39482014-39482036 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1148950158 17:51303793-51303815 CAGTCAACAGAGAAGAAAAAAGG - Intergenic
1149360275 17:55888029-55888051 CAGTTAATTAAAAAAAAAAAAGG + Intergenic
1149613321 17:57974899-57974921 TTCTAAAATAAGAAGAAAAAGGG + Exonic
1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG + Intronic
1149747205 17:59109974-59109996 TTATTGACTAAGAAGATAAAGGG + Exonic
1149812416 17:59690043-59690065 CTGTTATCTAAGAAGTAATCAGG - Intronic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1150669379 17:67177606-67177628 CTGTTAAATAAGAAGGACAGTGG - Intronic
1151351991 17:73537284-73537306 CTGTTAACGAGGGAGATAAACGG + Intronic
1151663945 17:75534910-75534932 TTGTTAATTAAGTAGTAAAAGGG - Intronic
1153050253 18:896382-896404 ATGTGAAATAAGAACAAAAATGG + Intergenic
1153343415 18:4000838-4000860 CCTTTAAATAAAAAGAAAAAAGG - Intronic
1153394145 18:4598801-4598823 CTGTTCTCTAAGCAGCAAAAAGG - Intergenic
1153501291 18:5752515-5752537 CTGTTTCCTAAGAAGGAAAGTGG + Intergenic
1153538884 18:6133841-6133863 CTGTTCACTAAGAGGCAAAATGG + Intronic
1154000425 18:10477974-10477996 ATGTTAACTAAAACAAAAAAAGG + Intronic
1154004804 18:10517960-10517982 CTGTATACTAGAAAGAAAAATGG - Intergenic
1154240525 18:12649505-12649527 TTGTTGGCTAAGTAGAAAAAAGG - Intronic
1154276030 18:12961237-12961259 ATGTGCACTAAGAGGAAAAATGG - Intronic
1155590842 18:27425348-27425370 CACTTAACTAAGAATAAAAAAGG - Intergenic
1155694944 18:28674279-28674301 CTGGCAGCTAAGAAAAAAAAGGG - Intergenic
1155946057 18:31852657-31852679 TTGGTATCTAGGAAGAAAAAGGG + Exonic
1156476350 18:37408214-37408236 CTGCTTACTAATAAGAACAAAGG - Intronic
1156526271 18:37770237-37770259 CTGTTAAATAAAAAGAAAGCAGG - Intergenic
1156644253 18:39140771-39140793 ATGTTCACTAAGAGGCAAAATGG + Intergenic
1156674755 18:39514207-39514229 TTGTTATCACAGAAGAAAAATGG + Intergenic
1157144060 18:45143112-45143134 CTGTTGACTCACAAGAAAGATGG - Intergenic
1157244401 18:46040713-46040735 CAGGTAGCTAAGAAGAACAATGG + Intronic
1157849807 18:51037736-51037758 CTGTTAAATAAAAATAAAAATGG - Intronic
1157952487 18:52055328-52055350 CTGTTAACTAACTTGAAAAAAGG - Intergenic
1158044704 18:53142099-53142121 CTGTTACCTAAGTTGAAAAATGG + Intronic
1158295076 18:55987280-55987302 CAGATACTTAAGAAGAAAAAAGG + Intergenic
1158564175 18:58540395-58540417 TTTTTAATAAAGAAGAAAAAGGG - Intronic
1158971696 18:62674240-62674262 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1159374887 18:67580421-67580443 CTGCAATATAAGAAGAAAAATGG - Intergenic
1159429979 18:68338419-68338441 CTGTAATTTAATAAGAAAAAAGG + Intergenic
1159544042 18:69817287-69817309 TTTTTAAGTAAGAAGAAAAATGG - Intronic
1160287693 18:77560127-77560149 CTATTAAGGAAGTAGAAAAATGG - Intergenic
1161833964 19:6632341-6632363 TTCTGAACTCAGAAGAAAAACGG + Intergenic
1162456381 19:10787464-10787486 CTGTTTAAAAAAAAGAAAAAAGG + Intronic
1164432301 19:28198917-28198939 CTGTTAAAAAAAAAAAAAAATGG - Intergenic
1164796297 19:31035075-31035097 CTGTTAAATAAGCATACAAATGG - Intergenic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1164952581 19:32350199-32350221 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1166759735 19:45217285-45217307 CTGTTAAATAAGGCGAATAATGG - Intronic
1167073384 19:47233673-47233695 CTTTTATCTAAAAAAAAAAAAGG - Intergenic
1168546497 19:57254845-57254867 CTGTAAACTAATGAGAAAGATGG - Intronic
925155397 2:1645654-1645676 CATTGAACTTAGAAGAAAAAGGG - Intronic
925326692 2:3027881-3027903 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
925951610 2:8918548-8918570 TTGTTTAATAAAAAGAAAAAAGG + Intronic
926651618 2:15352754-15352776 ATGTTCACTAAGAGGCAAAATGG - Intronic
926743578 2:16132015-16132037 CTCTTATCTATGAAAAAAAAAGG - Intergenic
927039879 2:19218067-19218089 TTTATAACTAAGAAGAAAACTGG + Intergenic
927370569 2:22350260-22350282 CTATTAACTATGAAGAAACAGGG - Intergenic
927544151 2:23938553-23938575 CTGTTAAAAAAAAAAAAAAAGGG - Intronic
928835313 2:35537274-35537296 CTGTTACCTTATAAGGAAAAAGG + Intergenic
928953578 2:36837845-36837867 TAGTTAACTAAAAAGACAAACGG + Intergenic
929556383 2:42928061-42928083 CTGGTAATTAAGAAGAATCAGGG - Intergenic
930165727 2:48202045-48202067 CTTTTAGCTAAGAACAGAAAGGG - Intergenic
930291188 2:49494754-49494776 CTGATAACGAAGAAATAAAAAGG + Intergenic
930666931 2:54108466-54108488 GTGTGAACTAAGAAGAAATCAGG + Intronic
931796683 2:65717486-65717508 GTGTTAAGAAAGAAGAAAATAGG - Intergenic
933554384 2:83813678-83813700 TTGTTAAATAAAAAGAAAAAAGG + Intergenic
934682211 2:96292430-96292452 ATGTTAACTAACAAAAAATAAGG - Intronic
935219482 2:101000485-101000507 CTGTTAACAAAGAAGAAGAGGGG - Intergenic
935547046 2:104411358-104411380 CTTTTAAAGAAAAAGAAAAATGG + Intergenic
936028155 2:109049606-109049628 TTGTTAAATCAGAAGAAAGAGGG - Intergenic
936091270 2:109502873-109502895 TTTTTAAAAAAGAAGAAAAATGG - Intronic
936553400 2:113471129-113471151 CTGTTAACTATGGGGAAAAAAGG - Intronic
936604377 2:113934685-113934707 CTGTTAATTATGAATAAAAGAGG - Intronic
938230369 2:129654089-129654111 TTGTTACCTCAGAAGAAAAAAGG + Intergenic
938623007 2:133076965-133076987 TTGTTAAGTGAGGAGAAAAAAGG + Intronic
939282849 2:140087603-140087625 CTGGAAAGTAAGAAAAAAAATGG - Intergenic
939936731 2:148301820-148301842 ATGTACACTAAGAAGCAAAATGG - Intronic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
941020214 2:160399832-160399854 CCGATAACTAAGAAAAAAAGGGG + Intronic
941577750 2:167255686-167255708 CTGAAAACTAAGATGAAATAAGG - Intronic
941749311 2:169118613-169118635 CTATAAACTAAGAAGACAAAGGG + Intergenic
943685512 2:190813541-190813563 TAATTAACAAAGAAGAAAAAAGG + Intergenic
943951802 2:194138748-194138770 ATCTTAACTAGGAAGATAAAAGG - Intergenic
944199106 2:197086432-197086454 CTTTTAACTGAAAAAAAAAAGGG + Intronic
944582501 2:201144296-201144318 CTGTCATCTGAGAAGAGAAAGGG + Intronic
944715789 2:202375618-202375640 CTGTCAACTAAGAAGGCTAAGGG + Intergenic
944721984 2:202432875-202432897 TTGTTAACTAAAATGATAAAGGG + Intronic
944918888 2:204389924-204389946 CTTTTAATTCAGAATAAAAAGGG - Intergenic
945019471 2:205556744-205556766 CTGTTTACTACCAAGAAAACTGG - Intronic
945138092 2:206651695-206651717 GTGTGAACTATGAAGAAAACAGG - Exonic
945283088 2:208055704-208055726 TTTTTAAGTAAGAAGAAGAAGGG - Intergenic
945564945 2:211386151-211386173 CTGTTAGCATAGAAGAAGAAAGG + Intronic
945768435 2:214009546-214009568 CTTTTATCTAACAATAAAAATGG - Intronic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
946736885 2:222762700-222762722 CTTTTAATTAAAAAAAAAAAAGG - Intergenic
947048794 2:226018921-226018943 ATGTTAACTACCAAGAAAATGGG - Intergenic
947162545 2:227228722-227228744 CTTTTAACGAACAATAAAAATGG + Intronic
947288220 2:228542216-228542238 CTGTCATCTGAGAACAAAAATGG - Intergenic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
947406108 2:229779310-229779332 CAGTTCACTAAAGAGAAAAAGGG - Intronic
947863798 2:233381829-233381851 CAGTTAACAAATAAGAAAACTGG - Intronic
1168763588 20:366633-366655 TTGTTAAATAGGAAGGAAAAAGG + Intronic
1169495765 20:6113429-6113451 CTGTGATCTATAAAGAAAAAAGG - Intronic
1170565118 20:17595933-17595955 TGGTTAACAATGAAGAAAAAAGG - Intronic
1170667873 20:18402374-18402396 ATGTGCACTAAGAAGAAAAATGG + Intronic
1170816523 20:19719276-19719298 CTGTAAAGAAAGGAGAAAAACGG + Intronic
1171195369 20:23193476-23193498 GTTTTAACAAAGAAGAGAAAGGG - Intergenic
1171507181 20:25647120-25647142 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1172003380 20:31799597-31799619 CTGTCAATTAAAAAGAAAGAAGG + Intronic
1172245387 20:33442479-33442501 CTGTTAGCGGAGAGGAAAAATGG - Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1173205660 20:40991221-40991243 CAGACAACAAAGAAGAAAAATGG - Intergenic
1174315524 20:49697574-49697596 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1174534847 20:51243333-51243355 ATGTTAATTAAGGAAAAAAATGG + Intergenic
1176373200 21:6074760-6074782 CTTTTAACTTAAAAGAAAAAAGG - Intergenic
1176993885 21:15531072-15531094 CTGTAATTTATGAAGAAAAAAGG - Intergenic
1177038755 21:16079357-16079379 CTGTTAAATAAAAGGAGAAACGG - Intergenic
1177298981 21:19215337-19215359 CTGTTGACTAAGAAACAAATAGG + Intergenic
1178042148 21:28650804-28650826 ATGTTAACTCAGAAGATGAAAGG + Intergenic
1179228948 21:39483015-39483037 CTTTTAACTAATAAGAGCAAAGG - Intronic
1179750277 21:43463483-43463505 CTTTTAACTTAAAAGAAAAAAGG + Intergenic
1179957225 21:44748295-44748317 CTGTTAACTAAAAATAAAATTGG - Intergenic
1182739870 22:32559926-32559948 CTGTGCACTAAGAGGCAAAATGG + Intronic
1182976701 22:34629023-34629045 CTTTAATTTAAGAAGAAAAATGG + Intergenic
1183288064 22:36980381-36980403 CCGTTAATTCATAAGAAAAAAGG + Intergenic
1184301817 22:43565407-43565429 CTATTGAGTAAGAAGTAAAAAGG + Intronic
949268291 3:2185661-2185683 GTTTTAACTAAGAAGAAAGATGG + Intronic
949370202 3:3326371-3326393 CAGAAAACTAAAAAGAAAAAAGG - Intergenic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
949643007 3:6061017-6061039 TTTTTAACTAAGAAGAAAGGAGG + Intergenic
950375071 3:12564589-12564611 CTGTTAAAAAAGAGAAAAAAGGG - Intronic
950386827 3:12666597-12666619 CTCTTAAAAAAGAAGAAGAAAGG + Intergenic
951520597 3:23607509-23607531 CTGATAAGAAAGAAGAATAAAGG - Intergenic
951844065 3:27066436-27066458 CTGTTAGCAAAGAAGAAAGAAGG + Intergenic
951954631 3:28241289-28241311 ACGTTAACGAAGAAAAAAAAAGG + Intergenic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
952567415 3:34675643-34675665 CTATTAACTAGGAAGATAAAGGG + Intergenic
952841743 3:37652328-37652350 ATCTTAACTAAGAAGAAAACAGG - Intronic
953552080 3:43910918-43910940 CTGTTAGCTGAAAGGAAAAAGGG + Intergenic
953708066 3:45246067-45246089 CTGCAACCTAAGAAGGAAAATGG - Intergenic
953820618 3:46204725-46204747 CTCTTAAATAAGAACAACAATGG - Intronic
955101805 3:55857609-55857631 CTAATAACTAGCAAGAAAAAAGG + Intronic
955191285 3:56763936-56763958 ATATTAACTAAGAAGAAACACGG + Intronic
955363892 3:58295683-58295705 CTCTTATATAAAAAGAAAAAAGG + Intronic
955509034 3:59661033-59661055 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
956185931 3:66562030-66562052 CTGGTATCCAAGAAGAAAAGAGG + Intergenic
956327330 3:68068733-68068755 CTATTTACTAAGAAAAAAAGTGG - Intronic
956494026 3:69805143-69805165 TGGTTAGCTAAGAAGACAAAGGG - Intronic
957334809 3:78814020-78814042 CAATCAACTAAGAAGAAAACTGG - Intronic
957478305 3:80756125-80756147 GTGTTAAAAGAGAAGAAAAAGGG - Intergenic
957738195 3:84228449-84228471 ATGTGAACTAAGAGGCAAAATGG - Intergenic
957975624 3:87440415-87440437 GTGTCAACTAAAAAGGAAAAAGG - Intergenic
958146944 3:89637562-89637584 ATGTTCACTAAGAATAGAAAGGG - Intergenic
958789730 3:98637529-98637551 CTGTAATCCCAGAAGAAAAAAGG + Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
959255320 3:104003719-104003741 ATATTAATGAAGAAGAAAAACGG - Intergenic
959381937 3:105651851-105651873 CTGTTTACTACGAAGAGGAAAGG - Intergenic
959733923 3:109636039-109636061 CTGTTGACCAAGAAGGGAAATGG - Intergenic
959823030 3:110758836-110758858 TTGTTAATTAAAAATAAAAAGGG - Intergenic
960155878 3:114296836-114296858 GTGTAAACTGAGAAGATAAAAGG + Intronic
960421600 3:117452896-117452918 GTGTTAACTAGGAAGAGACAAGG + Intergenic
960882539 3:122360015-122360037 CTGTTGACTTAGGACAAAAATGG - Intronic
961900438 3:130205350-130205372 CTGTTACCAAAGAAATAAAAAGG + Intergenic
962335013 3:134521084-134521106 AAGTTAACTGAGTAGAAAAATGG + Intronic
962383143 3:134912830-134912852 CAGATAACCAAGAAGAAAACTGG - Intronic
962526527 3:136242582-136242604 CTGGTGACTCATAAGAAAAAGGG + Intergenic
962531914 3:136289760-136289782 ATGTTAATAAAGGAGAAAAATGG - Intronic
963591093 3:147260596-147260618 CATTTAACAAAGAAGAAAATGGG - Intergenic
963811438 3:149780684-149780706 CTGTAGACTAAGAAGTCAAAGGG - Intronic
964444831 3:156747881-156747903 TTGTTAACTAGGAAGAAAAATGG + Intergenic
964934687 3:162068416-162068438 CTGTTAAATAAAAAGAATGAGGG + Intergenic
965152393 3:164995341-164995363 AAGTTAAATAAGAAGAAAAAAGG + Intronic
965675395 3:171189892-171189914 ATGTTAACTAAGAAAAAAAATGG + Intronic
965682012 3:171261268-171261290 CTGTTTACTAAGCAAAAAAAGGG - Intronic
965725900 3:171715732-171715754 CTATTGACAAAAAAGAAAAAGGG - Intronic
965924708 3:173963578-173963600 TTGTGGACTGAGAAGAAAAAAGG + Intronic
966323565 3:178729136-178729158 TTGTTAACCAAGAAGAGACAAGG + Intronic
966391037 3:179452342-179452364 GAATTAACTCAGAAGAAAAATGG - Intergenic
966794374 3:183699251-183699273 CTGTTTACTGAGATGAAGAATGG + Intronic
967401354 3:189065811-189065833 CAGTAAGCTAAGAAAAAAAAAGG + Intronic
967691274 3:192476652-192476674 CTGAGAACAAAGAAGCAAAATGG + Intronic
968788426 4:2641933-2641955 CTCTTAAAAAAGAAAAAAAAAGG + Intronic
969011419 4:4066527-4066549 CTGTTACCAAAGAAATAAAAAGG + Intergenic
969026926 4:4180882-4180904 CTTTTCACTAGGAAGAAAACGGG - Intergenic
969260940 4:6033141-6033163 CTGTTAACTAAGAGGAGAAGAGG - Intronic
969742651 4:9043360-9043382 CTGTTACCAAAGAAATAAAAAGG - Intergenic
969802031 4:9575470-9575492 CTGTTACCAAAGAAATAAAAAGG - Intergenic
970054810 4:11958964-11958986 GTCTTAACTAAGAAACAAAAGGG - Intergenic
970371779 4:15414916-15414938 CTGTTGACTAAGAACAAATTTGG - Intronic
970531409 4:16989230-16989252 CAGTTAACTTAGAAGAAGGAAGG - Intergenic
970637485 4:18024564-18024586 CTGTTTAGAAAGGAGAAAAATGG + Intergenic
970763638 4:19520572-19520594 CTGGAAAGTAAGAAGATAAAGGG - Intergenic
971183448 4:24351864-24351886 CAGTCAACAAAGAAGAGAAAGGG + Intergenic
971596611 4:28537303-28537325 CTATAAACCAATAAGAAAAAAGG + Intergenic
971649470 4:29254222-29254244 CATTGAACTAAAAAGAAAAATGG + Intergenic
971716380 4:30182595-30182617 ATATTAAGTAAGAAAAAAAATGG + Intergenic
971986024 4:33825541-33825563 CTATATACTAAAAAGAAAAATGG - Intergenic
972221632 4:36962610-36962632 CTGTTGTCTAAGAAAAAAAATGG + Intergenic
972293268 4:37712058-37712080 TTTTTAACTAAGGAGATAAAAGG + Intergenic
972361363 4:38328428-38328450 CTGTAACCTGAGAAGAGAAAAGG - Intergenic
972662406 4:41129104-41129126 GTGTTAAGGGAGAAGAAAAATGG - Intronic
972709088 4:41575932-41575954 TTGTTCTCCAAGAAGAAAAAAGG + Intronic
972769235 4:42180646-42180668 GTGTTAACTAGAAAGGAAAAGGG + Intergenic
973035882 4:45405443-45405465 CTGTTAACATAAAATAAAAAAGG - Intergenic
973595780 4:52488010-52488032 CTGTCAAAAAAGAAGAAAAAAGG + Intergenic
973739412 4:53904708-53904730 CTCTTAAATAAGAAGACCAAGGG - Intronic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
975264883 4:72351696-72351718 TTGTTAACTAAGCACAAACATGG + Intronic
975334824 4:73163507-73163529 TAGTTAACTAAGAAACAAAAAGG + Intronic
975399830 4:73922212-73922234 CTGGTAAATAAGAAGGTAAAGGG - Intergenic
975853767 4:78600823-78600845 CTTTTAAATAAAAAGAAAATAGG - Intronic
976648832 4:87413724-87413746 ATGTTACCTAACATGAAAAAAGG + Intergenic
976847434 4:89505973-89505995 CTATTCATTAAGAAGGAAAAAGG - Intergenic
976865432 4:89720257-89720279 CTGGTAACTAGAAAAAAAAAAGG - Intergenic
977211410 4:94222641-94222663 CTGTTAACTAAGCATATTAAAGG + Intronic
977736830 4:100426995-100427017 CTTTTAACTAAAAAAAAAATTGG - Intronic
978102287 4:104856976-104856998 CTAGTAAATAAGAAAAAAAAAGG + Intergenic
978270826 4:106888087-106888109 CTTTTAAATCAGCAGAAAAAAGG + Intergenic
979880417 4:125950408-125950430 ATATTAATAAAGAAGAAAAAAGG - Intergenic
980054072 4:128062679-128062701 TTGTGAAATAAGATGAAAAAAGG + Intronic
980211525 4:129794588-129794610 CCCTTAAATAAAAAGAAAAATGG + Intergenic
980839787 4:138244262-138244284 TTTTTAATTATGAAGAAAAATGG + Intergenic
980843007 4:138289090-138289112 CTGTTAGGTAAAGAGAAAAAAGG + Intergenic
980849990 4:138369734-138369756 CCATTAACTAAGTAGAATAAGGG + Intergenic
981148458 4:141353339-141353361 CTGTTAAAAAAAAAAAAAAAGGG + Intergenic
981434283 4:144701985-144702007 CTGTTAAAAAAGAAAAAATAGGG + Intronic
981450044 4:144886224-144886246 ATGTGAACTAAGAGGCAAAATGG + Intergenic
981629072 4:146796989-146797011 GTGTAATCTAAGAAAAAAAAAGG + Intronic
981736037 4:147951293-147951315 GAGGTAACAAAGAAGAAAAATGG - Intronic
983432960 4:167674509-167674531 CCGTTATTTAAAAAGAAAAAAGG - Intergenic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
983973684 4:173905303-173905325 CATTTATCTGAGAAGAAAAAAGG + Intergenic
984044976 4:174785768-174785790 CTCTTAAAAAAGAAGAAGAATGG - Intronic
984070755 4:175109145-175109167 ATGTTGTCTGAGAAGAAAAAAGG + Intergenic
984298764 4:177888440-177888462 TTGTTCACAAAGAAGAGAAATGG - Intronic
984302368 4:177938388-177938410 CTGTCAATTAATAAGAAAACTGG - Intronic
984559690 4:181253821-181253843 TTGTTAAGTAATAAGAATAAAGG - Intergenic
985180614 4:187257429-187257451 CTGTTTTCTAAGGAGAAAAAAGG + Intergenic
986926107 5:12754063-12754085 CTTTTAATGAAGAGGAAAAAAGG + Intergenic
987666566 5:20949568-20949590 GTCTCAACTAAAAAGAAAAATGG - Intergenic
988009383 5:25463083-25463105 CTGCAAACTAAGAGAAAAAAAGG - Intergenic
988067348 5:26238175-26238197 CTATTAAGTAGGAAGGAAAAAGG - Intergenic
988136528 5:27178721-27178743 ATGTTAAATAAGAAAAAAAAAGG + Intergenic
989250211 5:39305086-39305108 ATCTTAAATAAGAAAAAAAATGG - Intronic
989489727 5:42036328-42036350 CTTGTTACTAAGAAAAAAAATGG + Intergenic
989513706 5:42317884-42317906 ATGTTAACTAAAAAGAGAGAAGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
990253196 5:53938221-53938243 ATGTTAACCAAGGAGAAATATGG - Intronic
992374563 5:76175429-76175451 GCTTTAACTAAAAAGAAAAATGG + Intronic
992920727 5:81516073-81516095 CCATGATCTAAGAAGAAAAAAGG + Intronic
993291032 5:86070487-86070509 ATGTTAAAAAAGAAGAAAATTGG - Intergenic
993519285 5:88880710-88880732 ATGTTTACAAAGAAGAAAAGAGG + Intronic
994115950 5:96061485-96061507 CAGCTAACAGAGAAGAAAAAAGG + Intergenic
994433143 5:99694660-99694682 CCGTTAATTATTAAGAAAAAAGG + Intergenic
994914058 5:105949512-105949534 CTGTTAAGTTATAAGAAAATTGG + Intergenic
994975504 5:106799358-106799380 CTGTTAAACAAGAACAACAAAGG + Intergenic
995433977 5:112114969-112114991 ATGTTATATAAGAAGAAGAATGG + Intergenic
995479979 5:112583908-112583930 CTGTTAAAAAAAAAAAAAAAGGG - Intergenic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
995668503 5:114572941-114572963 GTGATAAATATGAAGAAAAAAGG + Intergenic
995734413 5:115284208-115284230 CTGGTTAGTAAGAAGAACAATGG + Intronic
995745216 5:115395293-115395315 ATGTGCACTAAGAAGCAAAATGG + Intergenic
995889529 5:116935175-116935197 GTGGTAACTAAGAGGAATAAGGG + Intergenic
995918176 5:117276499-117276521 ATGTGCACTAAGAGGAAAAATGG + Intergenic
996877702 5:128258032-128258054 TTAATAACTAAAAAGAAAAAAGG - Exonic
997267981 5:132508627-132508649 ATTTTAATCAAGAAGAAAAACGG + Intergenic
997634288 5:135393368-135393390 CTATTTACTCAGAAGAAAAGAGG + Intronic
997897545 5:137733340-137733362 CTGATAACTAAAAAGAAAGTTGG - Intronic
998691771 5:144595339-144595361 CAGATAACCAAGAAGAAAAGAGG - Intergenic
999023449 5:148196970-148196992 CTGTTTCCTAAGGAGATAAAAGG - Intergenic
999387901 5:151168276-151168298 CTGTTCAAAAAGAAAAAAAAAGG + Intergenic
999605218 5:153306584-153306606 CTGTTTTCTAAGCTGAAAAATGG + Intergenic
999694196 5:154173951-154173973 GTGTTTGCTAAGAAAAAAAAGGG - Intronic
999772569 5:154786610-154786632 CTGTTTACTCAGAAAAACAAGGG + Intronic
1000227489 5:159279672-159279694 CTGTTGACTTGGAAGAAAAGTGG + Intronic
1000636296 5:163647325-163647347 CTGTAAACCAAGAAAAAAGAAGG - Intergenic
1000761197 5:165226696-165226718 CTGATACCTAAGAAGAAGTATGG - Intergenic
1002284515 5:178153490-178153512 TTGTCAACAAAGGAGAAAAAGGG - Exonic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003361189 6:5427079-5427101 GTGTCAACTAAAAATAAAAAAGG - Intronic
1003520352 6:6853391-6853413 CTGTTAACTGAGAAGGATAGTGG - Intergenic
1003783912 6:9461503-9461525 ATGTTCACTAAGAGGCAAAATGG - Intergenic
1004099515 6:12594476-12594498 CTGTAAACTAAGAGGCAAAATGG - Intergenic
1004147564 6:13082466-13082488 CAGTTCAGGAAGAAGAAAAATGG + Intronic
1004713723 6:18196482-18196504 CTATTATCAAAGAAGACAAAAGG - Intronic
1006292915 6:33154084-33154106 ATGATTACTAAGAAGACAAAGGG - Intergenic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007694345 6:43722708-43722730 CTGTTAACAATGAGGAATAATGG + Intergenic
1008020893 6:46575943-46575965 CTGTAATTTATGAAGAAAAAAGG + Intronic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1009279668 6:61731838-61731860 TTGTTAACTATGAAGAAAATAGG - Intronic
1009746274 6:67820772-67820794 ATGTGAACTAAGAGGCAAAATGG - Intergenic
1009890959 6:69681339-69681361 CTGTTAAATTACAAAAAAAATGG - Intronic
1009912545 6:69949587-69949609 CTGTTATTTTACAAGAAAAATGG + Intronic
1010355528 6:74928227-74928249 CTGTAAAAGAATAAGAAAAATGG - Intergenic
1010744964 6:79550463-79550485 GTGATAAATAAGAGGAAAAAAGG - Intergenic
1010922510 6:81701539-81701561 CTCTTCACTAAGGATAAAAAAGG - Intronic
1011047699 6:83104068-83104090 TTCTTAAATAAGAAGCAAAAAGG - Intronic
1012073181 6:94649305-94649327 CTCTTAACAGACAAGAAAAATGG + Intergenic
1012297573 6:97544274-97544296 CAGCTGACTAAGAAAAAAAAGGG - Intergenic
1013000933 6:106021562-106021584 CAGTTAATTGAGAAGCAAAATGG + Intergenic
1013421177 6:109968415-109968437 CTGTGAACTGAGCAGAGAAAAGG - Intergenic
1013917182 6:115354817-115354839 GTGTTAACTAGGAAAGAAAAAGG - Intergenic
1014249734 6:119102943-119102965 CTGTTAAGAAAGAATAAGAAGGG - Intronic
1014295767 6:119615327-119615349 CTGATCACTAAGAAGAAATGAGG - Intergenic
1014622200 6:123681917-123681939 CTGTTTGCTAATAAGAAAAGGGG + Intergenic
1015012695 6:128370907-128370929 ATGTTAACAAAGGACAAAAAGGG - Intronic
1015237909 6:130992229-130992251 CTGTTAAATATTAAGCAAAATGG + Intronic
1016459690 6:144269443-144269465 TTGTTAACTATGAAGTAAACAGG + Intergenic
1016478375 6:144453426-144453448 AAATTAACTAACAAGAAAAAAGG - Intronic
1016901890 6:149111243-149111265 GTGGCAACTAGGAAGAAAAAGGG - Intergenic
1016910771 6:149196486-149196508 CTATTAACTAAAAAGACACATGG + Intergenic
1017112850 6:150949008-150949030 CTAATGATTAAGAAGAAAAAAGG - Intronic
1017153346 6:151301044-151301066 CTGTTACCAAACAAGAAAGAAGG - Intronic
1017287578 6:152694410-152694432 ATGTAAACAAAGAAGAAAAAAGG + Intergenic
1018078830 6:160241035-160241057 CTTTGAAGTAAGAAGTAAAAGGG + Intronic
1018436935 6:163769122-163769144 CTGTATACCAAGAAGAATAAAGG + Intergenic
1020499622 7:8900517-8900539 CTTTTAACAAAAAAGAAATAAGG + Intergenic
1021181887 7:17516826-17516848 CTATTCACTATGAAGAAAAAAGG - Intergenic
1021531526 7:21651521-21651543 CTGTTCACTTAGAAAACAAAGGG - Intronic
1021675815 7:23080031-23080053 TTTTTAACTAAGAGGAAAAATGG - Intergenic
1021714976 7:23453242-23453264 CTTTTAAACAAGAAGAAAAAAGG + Intronic
1021758426 7:23878687-23878709 TTGTTAAAGAAGAAAAAAAAGGG + Intergenic
1022036033 7:26535596-26535618 GTGTAAACAAAGAAGATAAATGG + Exonic
1022083904 7:27048376-27048398 TTGTCAACAAAGGAGAAAAAGGG + Intergenic
1022513801 7:30962818-30962840 TTGTTGACAATGAAGAAAAATGG + Intronic
1023141840 7:37109689-37109711 CTGTTAACCAATAAGAATGAAGG - Intronic
1024509952 7:50196048-50196070 CTGTGACCTCAGGAGAAAAATGG + Intergenic
1025272342 7:57535705-57535727 CTATATACTAAAAAGAAAAATGG - Intergenic
1025793060 7:64710934-64710956 ATTTTAACTAAGATTAAAAATGG - Exonic
1027593976 7:80149880-80149902 TTGTTAAATGAGAAGAAAAAAGG + Intronic
1028055993 7:86244391-86244413 CTGTTTACGGAGAAGAAAATGGG - Intergenic
1028256109 7:88599567-88599589 CTGTTGACCAAAAAGAAACAGGG + Intergenic
1028308982 7:89305425-89305447 GTGTTAACAAAGTAGAAAAGAGG + Intronic
1028426685 7:90697229-90697251 TTTTTAACAAAGAAGAAAAGGGG - Intronic
1028456272 7:91041174-91041196 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1028651050 7:93151095-93151117 CTGTTAACTATGAAAAATTAAGG + Intergenic
1029005586 7:97205981-97206003 CTGTTTACTAAGAGGAAATGGGG - Intergenic
1029070711 7:97894549-97894571 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1029264807 7:99329868-99329890 TTGTTAACTAAAAATAAAATCGG - Intronic
1029648151 7:101871320-101871342 GTGTTAACAAAAAAAAAAAAAGG - Intronic
1030147823 7:106374312-106374334 CTGTTAACAGAGAAGTAAATTGG - Intergenic
1030250019 7:107432661-107432683 ATTCTAACTAGGAAGAAAAATGG + Intronic
1031405437 7:121380106-121380128 CTGTTTGCTAAGTAGATAAATGG + Intronic
1031928546 7:127661666-127661688 CTGTTGACCAAAATGAAAAAAGG - Intronic
1032639917 7:133754485-133754507 TTGTTAAATAAGAAGAGAACTGG + Intronic
1032713661 7:134485572-134485594 CAGAAAACTAAGAAGACAAAAGG - Intergenic
1034045320 7:147921110-147921132 CTGTTAAACAAAAAAAAAAAAGG - Intronic
1034373719 7:150625600-150625622 CTGTTCACTTAGAAATAAAATGG + Exonic
1034703244 7:153115730-153115752 TTGATAAGAAAGAAGAAAAAGGG + Intergenic
1034733440 7:153408132-153408154 AATATAACTAAGAAGAAAAATGG - Intergenic
1034830247 7:154302709-154302731 CTCTTTACTGAGAAGGAAAATGG + Intronic
1034910838 7:154997240-154997262 CTCTTAAACAAAAAGAAAAAGGG - Intronic
1035062984 7:156082708-156082730 CTGTTAACTTAGAAGAGTGAAGG + Intergenic
1035465704 7:159075149-159075171 CTGTTAAATAAGAATAAAAATGG + Intronic
1035877788 8:3210853-3210875 TTGTTAACTAATAATACAAAAGG - Intronic
1036046633 8:5149504-5149526 ATCTTAAATAACAAGAAAAAAGG + Intergenic
1036199013 8:6750623-6750645 CTGATAACTAGAAAGAAAAATGG + Intronic
1036247857 8:7135227-7135249 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036252956 8:7179146-7179168 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1036364540 8:8108328-8108350 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036894007 8:12616877-12616899 CTGTTATCAAAGAAATAAAAAGG + Intergenic
1037486360 8:19351108-19351130 CTGTTATTTTAGAAGCAAAAAGG + Intronic
1038195213 8:25360860-25360882 TTGTTAAGTAAGAAAAAAAGGGG + Intronic
1038501720 8:28050379-28050401 CTGTTAAAAAAAAAGAAAAAAGG + Intronic
1038814235 8:30884712-30884734 AGGATAACTAAGAAAAAAAAGGG - Intronic
1038864844 8:31428702-31428724 ATGTTAAGGAAAAAGAAAAAGGG + Intergenic
1039165633 8:34676667-34676689 CTCATAACTAAGAAAAAAAGGGG + Intergenic
1039204236 8:35132385-35132407 CTGTTAACAAAAAATAGAAAAGG - Intergenic
1040462333 8:47660865-47660887 CAGTTAACTGACAAGAAAATAGG - Intronic
1040688311 8:49903787-49903809 AAGATAACTATGAAGAAAAATGG - Intergenic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041029194 8:53718783-53718805 CTGTCAACTAGGCAGAAGAAAGG - Intronic
1041365362 8:57097045-57097067 TTATTAACTCAGAAGAAAACTGG - Intergenic
1041596809 8:59664709-59664731 CTGTGAAGAAAGAAAAAAAATGG + Intergenic
1041654137 8:60331582-60331604 CTTTTTAATAAAAAGAAAAATGG + Intergenic
1041825258 8:62088376-62088398 CTCTAAACTGAGAAGAGAAAGGG + Intergenic
1041867593 8:62594853-62594875 CTGTTGACAAAAAAGAAGAAGGG - Intronic
1041939517 8:63371269-63371291 CTACAAACTAAGAAGAGAAATGG + Intergenic
1042471149 8:69189428-69189450 CTGTTAGCAAATAACAAAAAGGG - Intergenic
1043005127 8:74809400-74809422 TTGTTCACTAAGAGGCAAAATGG + Intronic
1043510140 8:80942955-80942977 CAGTGAACTAAAAAGACAAACGG + Intergenic
1043529187 8:81130853-81130875 CTTCTAACTAAGAAGAAGAGGGG + Intergenic
1044097169 8:88080807-88080829 CTGTTTCCTAAGAAAAAAATTGG + Intronic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1045803474 8:106128560-106128582 CTGTTTACTCATAAGAAAAATGG + Intergenic
1045979034 8:108162398-108162420 CTGTTTACTGGGAAGAACAAAGG - Intergenic
1046686520 8:117233714-117233736 CTGTTAACTAAAGGAAAAAATGG + Intergenic
1046695630 8:117336141-117336163 ACGATAACTATGAAGAAAAATGG + Intergenic
1046926083 8:119790557-119790579 ATGTTAACAATGAAAAAAAATGG + Intronic
1047225002 8:122948756-122948778 TTGGTAACTCTGAAGAAAAATGG + Intronic
1047225794 8:122954630-122954652 CTTTGAAAAAAGAAGAAAAATGG + Intronic
1047485626 8:125328150-125328172 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1047833518 8:128662033-128662055 CTATTAAGGAAGAAGAAAACAGG + Intergenic
1048311950 8:133329869-133329891 GTAATAACTAAAAAGAAAAATGG - Intergenic
1048361544 8:133701340-133701362 CTGTAAACTCAGAAGTAAAGGGG - Intergenic
1048481456 8:134798718-134798740 CCATTAAACAAGAAGAAAAAAGG + Intergenic
1048561963 8:135548908-135548930 AAGTTAACTATCAAGAAAAATGG - Intronic
1048818371 8:138355489-138355511 CTTTTAAGGAAGGAGAAAAAGGG + Intronic
1048897075 8:139001698-139001720 GTCTTAACTATGAAGACAAAGGG + Intergenic
1049899602 9:146040-146062 CTGTTAACTATGGGGAAAAAAGG + Intronic
1050035815 9:1434794-1434816 TTCTTAACTAAAAAGAAAAAAGG - Intergenic
1050266868 9:3900182-3900204 CTGTTAAAAAAAAAAAAAAAAGG + Intronic
1050628155 9:7529233-7529255 AAGTTAACTAGGAAAAAAAAGGG - Intergenic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1051160775 9:14204861-14204883 AGGTTAACTCAGAAGACAAAGGG + Intronic
1051209452 9:14726344-14726366 TTTTTAACTCAGAAGAAAACAGG + Intergenic
1051720623 9:20033472-20033494 CTGTCTACTAAAAAGTAAAAGGG - Intergenic
1053081441 9:35181212-35181234 CTGTGAAATAAGAAAAATAAGGG - Intronic
1053393287 9:37751492-37751514 CTGTTAACGAAGGGGAAAAAAGG + Intronic
1053451208 9:38195662-38195684 ATGTGAACTAAGAGGCAAAATGG + Intergenic
1053742653 9:41156321-41156343 CTGTTAACTATGGGGAAAAAAGG + Intronic
1054195717 9:62030246-62030268 CGTTTAAGTAAGAAGAAATATGG - Intergenic
1054347925 9:63986166-63986188 CTGTTAACTATGGGGAAAAAAGG + Intergenic
1054445653 9:65312509-65312531 CTGTTAACTATGGGGAAAAAAGG + Intergenic
1054484617 9:65708998-65709020 CTGTTAACTATGGGGAAAAAAGG - Intronic
1054642691 9:67558443-67558465 CGTTTAAGTAAGAAGAAATATGG + Intergenic
1054685690 9:68274978-68275000 CTGTTAACTATGGGGAAAAAAGG - Intronic
1054909442 9:70440726-70440748 CTGTTAACTAAAATAAAAAAGGG + Intergenic
1055280420 9:74667768-74667790 CTATAAAGGAAGAAGAAAAATGG - Intronic
1057575312 9:96237805-96237827 CTGTTATCTAAGAAATTAAAAGG + Intronic
1057715790 9:97494446-97494468 ATGTTATTTAAGAAGAAAAAAGG - Intronic
1057886675 9:98834885-98834907 CAGTTAGCCAAGAAGAAGAAGGG - Intronic
1060182605 9:121544835-121544857 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1060420217 9:123463087-123463109 ATGTCACCTAAGAAGACAAAGGG - Intronic
1186108192 X:6227871-6227893 CTGTTAACCAGAAAGAAAAAGGG - Intronic
1186417996 X:9400113-9400135 CTGTCTATTAAGAAGAAAACAGG + Intergenic
1186607147 X:11104206-11104228 CTGTTAAATAAAAAGAAAGATGG + Intergenic
1187810750 X:23174162-23174184 CTGTTAATTTAGAAAGAAAATGG + Intergenic
1188120052 X:26293794-26293816 CTTTTGAGTGAGAAGAAAAAAGG + Intergenic
1188930161 X:36099219-36099241 CTGAAAACGAAGAAGAAAAGTGG - Intronic
1189461127 X:41243814-41243836 CTGTTAGCTTAGAATTAAAATGG + Intergenic
1189780407 X:44508445-44508467 GTGTTCACTAAGAGGCAAAATGG - Intergenic
1189829225 X:44953436-44953458 CTATTAACAAAGAGGAGAAAGGG + Intronic
1190112381 X:47601128-47601150 CTTTAGACTAAGAATAAAAAAGG + Intronic
1190949052 X:55124197-55124219 ATGTGCACTAAGAAGCAAAATGG - Intronic
1191054557 X:56228793-56228815 CTGTGGAATAAGAAGAAAAGTGG + Intergenic
1191156380 X:57278208-57278230 CTGGTAACAAAGAAGATATATGG + Intergenic
1191577109 X:62718155-62718177 TTGTTACCTAAGGAGAAAAAAGG - Intergenic
1192367421 X:70485643-70485665 ATGGTAACTAAGAAGGAAACTGG - Intronic
1192924227 X:75738630-75738652 CTGTTAACAGAGAATGAAAAGGG - Intergenic
1193069955 X:77296811-77296833 CTGTCCCCCAAGAAGAAAAATGG + Intergenic
1193258347 X:79376865-79376887 CTTGTAACTAGGAAGAAGAATGG + Intergenic
1193917431 X:87382588-87382610 ATGTAGATTAAGAAGAAAAATGG + Intergenic
1194017638 X:88644218-88644240 CTGTTAAGTTAAAAAAAAAAAGG + Intergenic
1194737739 X:97533430-97533452 CTGTTAAATATGAAGAAAACTGG + Intronic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic
1195394741 X:104398611-104398633 CTGTTGTCTAAAAAGAATAAGGG - Intergenic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1195992918 X:110700722-110700744 CTGTTTATTAAAAAGAAATAAGG + Intronic
1196223091 X:113135179-113135201 ATGCTTACTAAGAGGAAAAATGG - Intergenic
1196272239 X:113725767-113725789 ATGTTAAAGAAGAATAAAAATGG + Intergenic
1196351328 X:114734031-114734053 CTAATAACTAAGAATAGAAATGG + Intronic
1196366370 X:114928708-114928730 CTGAAAATTAATAAGAAAAAAGG - Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198923715 X:141762419-141762441 ATATGAAATAAGAAGAAAAAAGG - Intergenic
1199228280 X:145405762-145405784 CTGATTACTAATAAGAAATACGG + Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1200024317 X:153242909-153242931 CAGTTAACTCAGAGGAACAAAGG + Intergenic
1200362406 X:155622519-155622541 CTGCTAAGTAAAAATAAAAATGG + Intronic
1200660737 Y:5953840-5953862 ATACTAACTAAGAAAAAAAAGGG + Intergenic
1201965891 Y:19735238-19735260 CTCATAAATAAGAAGAAAGAAGG + Intronic